ID: 902511202

View in Genome Browser
Species Human (GRCh38)
Location 1:16967879-16967901
Sequence GGTCCCAGGGTACCACAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902511202_902511211 13 Left 902511202 1:16967879-16967901 CCAGGTTGTGGTACCCTGGGACC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 902511211 1:16967915-16967937 TACTGTACAGATATGAAATGGGG 0: 1
1: 0
2: 3
3: 15
4: 214
902511202_902511209 11 Left 902511202 1:16967879-16967901 CCAGGTTGTGGTACCCTGGGACC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 902511209 1:16967913-16967935 CCTACTGTACAGATATGAAATGG 0: 1
1: 0
2: 2
3: 19
4: 167
902511202_902511213 21 Left 902511202 1:16967879-16967901 CCAGGTTGTGGTACCCTGGGACC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 902511213 1:16967923-16967945 AGATATGAAATGGGGCCATAGGG 0: 1
1: 0
2: 2
3: 14
4: 167
902511202_902511214 29 Left 902511202 1:16967879-16967901 CCAGGTTGTGGTACCCTGGGACC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 902511214 1:16967931-16967953 AATGGGGCCATAGGGCGCGAAGG 0: 1
1: 0
2: 0
3: 0
4: 50
902511202_902511212 20 Left 902511202 1:16967879-16967901 CCAGGTTGTGGTACCCTGGGACC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 902511212 1:16967922-16967944 CAGATATGAAATGGGGCCATAGG 0: 1
1: 0
2: 1
3: 10
4: 143
902511202_902511210 12 Left 902511202 1:16967879-16967901 CCAGGTTGTGGTACCCTGGGACC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 902511210 1:16967914-16967936 CTACTGTACAGATATGAAATGGG 0: 1
1: 0
2: 0
3: 20
4: 205
902511202_902511215 30 Left 902511202 1:16967879-16967901 CCAGGTTGTGGTACCCTGGGACC 0: 1
1: 0
2: 1
3: 6
4: 105
Right 902511215 1:16967932-16967954 ATGGGGCCATAGGGCGCGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902511202 Original CRISPR GGTCCCAGGGTACCACAACC TGG (reversed) Intronic
901684423 1:10935641-10935663 GGTCCCAAGCTGCCACCACCTGG - Intergenic
902511202 1:16967879-16967901 GGTCCCAGGGTACCACAACCTGG - Intronic
913585407 1:120270359-120270381 GCACCCAGGGAACTACAACCAGG - Intergenic
913622776 1:120628008-120628030 GCACCCAGGGAACTACAACCAGG + Intergenic
914567411 1:148882218-148882240 GCACCCAGGGAACTACAACCAGG - Intronic
914605410 1:149248027-149248049 GCACCCAGGGAACTACAACCAGG + Intergenic
915766840 1:158371650-158371672 GGTGCCAGGGTACACCACCCTGG + Intergenic
919731106 1:200914097-200914119 GGTCTCTGGGTACCCCAGCCTGG + Intronic
920301685 1:204992751-204992773 GGTCCCAGGGTGCCAGAACAGGG - Intronic
922528978 1:226328537-226328559 GGTCCCAGGCTTCCTCAACCAGG - Intergenic
1063308469 10:4930225-4930247 GGTCCAAGGGAAACACAAACAGG - Intronic
1063583995 10:7334506-7334528 TGTCCCTGAGTCCCACAACCAGG + Intronic
1064364955 10:14699397-14699419 AGTCCCAGGGAACGAGAACCAGG + Intronic
1064973296 10:21088182-21088204 GGACACAGTGTACCACATCCTGG + Intronic
1075588076 10:123671646-123671668 GGACTCTGGGTACCACCACCAGG + Intronic
1076544400 10:131235083-131235105 GGGCCCAGGGTACCACAGGCAGG + Intronic
1077462050 11:2715581-2715603 GGTCCCAGGGGACCCCAGCAGGG - Intronic
1078851199 11:15165628-15165650 GGTACCAGGGTACCACCACCAGG - Intronic
1081858080 11:46316493-46316515 CGTCCCAGGGTACACCATCCTGG + Intronic
1083512686 11:63226667-63226689 GGTCCTAGGGTTCTACAATCAGG + Intronic
1083620810 11:64048454-64048476 GGTCCCTGGCAACCACAGCCTGG - Intronic
1084006992 11:66328370-66328392 GGTCCCAGGGACCCACCACTGGG + Intergenic
1085495012 11:76960934-76960956 CTTCCCAGGGTACCAAAACATGG - Intronic
1085691517 11:78667982-78668004 TGTCCCAGGGTCCCACAGGCAGG - Intronic
1087821418 11:102717048-102717070 CATGCCAGGGTGCCACAACCAGG - Intronic
1092527098 12:9315941-9315963 GGTCCCAGGGCATCACACTCAGG - Intergenic
1092540171 12:9415831-9415853 GGTCCCAGGGCATCACACTCAGG + Intergenic
1093925292 12:24903094-24903116 GGGCGCTGGGTACCACGACCTGG + Intronic
1096720118 12:53515037-53515059 GGACGCAGGTTACCACATCCAGG - Exonic
1097379185 12:58874879-58874901 GGTCCCAGATGACCAGAACCAGG + Intronic
1098902956 12:76131866-76131888 CCTCCCTGGGTTCCACAACCTGG + Intergenic
1101889866 12:108703704-108703726 GATCCCAGGGCTGCACAACCAGG + Intronic
1101953442 12:109193969-109193991 GGTAACAAGGTACCACAAACTGG + Intronic
1111726207 13:92012984-92013006 GGTCACAGGCCCCCACAACCTGG - Intronic
1113794023 13:113046344-113046366 GGACCCAGGGTCCCAGAGCCTGG - Intronic
1121459589 14:94064603-94064625 GGTCCCTGGGTACACCACCCTGG - Intronic
1123696426 15:22882172-22882194 GGTCCCGGGGTGCCACAATGAGG + Intronic
1125038670 15:35157557-35157579 GGGGACAGAGTACCACAACCCGG - Intergenic
1127803193 15:62495049-62495071 GGGCCCAGGGTAGCACAGCTAGG - Intronic
1130555291 15:84918344-84918366 AGTCCCAGGGTTCCACATGCAGG - Intronic
1131087265 15:89587566-89587588 GCTTCCAGGGTACCACAATCTGG - Intronic
1132744384 16:1430632-1430654 GGTCCCAGGGACCCCCAGCCAGG - Intergenic
1133275971 16:4638641-4638663 GGTCCCAGGATGCCCCCACCAGG - Intronic
1143541333 17:7571247-7571269 GGAGCCAGGGTCCCACAGCCTGG - Intronic
1150861015 17:68800696-68800718 GCTCCCAGGGGACCAGAACAAGG + Intergenic
1160875385 19:1294260-1294282 GGGCCCTGGGGACCACAGCCGGG + Intronic
1161330541 19:3684809-3684831 GGTCACAGGGAACCAGATCCTGG - Intronic
1162574278 19:11489801-11489823 GGGCCCAGGATACCACAGCGTGG - Intronic
1163171290 19:15532949-15532971 GGCCCCAGGGTGCCCCCACCTGG + Intronic
1166177028 19:41081578-41081600 GGCCCCTGGGAAGCACAACCTGG + Intergenic
1168588563 19:57614412-57614434 GGTGCCAGGGTCCCGCGACCTGG + Exonic
925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG + Intergenic
925644728 2:6024092-6024114 AGTCCCAGGGAACCAACACCCGG + Intergenic
927111880 2:19869376-19869398 GGTCCCAGGGAAGCAGACCCAGG - Intergenic
927191013 2:20516886-20516908 GGTCCCAGGTTCACACGACCTGG - Intergenic
929249377 2:39735884-39735906 GGGCCCAGGTTTCCACACCCTGG + Intergenic
931859029 2:66334315-66334337 GGACCCAGGGTAGAACACCCTGG + Intergenic
934950244 2:98570996-98571018 GGTCCCTGTGTGCCACAGCCAGG + Intronic
941447831 2:165624506-165624528 GGTACCAGGGTACCTCAAAATGG - Intronic
944426395 2:199587888-199587910 GCTCCCACGCTACCACAATCTGG + Intergenic
944768086 2:202885113-202885135 GACCCCAGGGTACAAAAACCAGG + Intronic
945995912 2:216435818-216435840 GGGCTCTGGGTACTACAACCTGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946312888 2:218892633-218892655 GGAGCGAGGGTCCCACAACCAGG - Intronic
947736223 2:232456816-232456838 GATCCCAGAGGACCAGAACCAGG + Intronic
949003902 2:241634471-241634493 GGACTCTGGGTACCAAAACCAGG + Intronic
1171283854 20:23922167-23922189 TGTCCCAGCAGACCACAACCTGG - Intergenic
1176107158 20:63394858-63394880 GGACCCCGGGCACCACACCCAGG - Intergenic
1178750615 21:35299220-35299242 TATCCCAGAGTACCACAAACTGG - Intronic
1179653990 21:42833927-42833949 CTTCCCAGGGTACCACACCAGGG - Intergenic
1180658041 22:17441021-17441043 GATCTCAGCTTACCACAACCCGG + Intronic
1181083767 22:20429919-20429941 GGGTCCAGGGTCCCAGAACCGGG + Intronic
1181290733 22:21791061-21791083 GGTGCCACGGTACCCCAGCCTGG + Intronic
1183784083 22:40019245-40019267 GGTCCCAGTGTACATCATCCTGG + Exonic
950429568 3:12943185-12943207 GGTCTCAGGGTCCCACCACTTGG - Intronic
955799021 3:62667326-62667348 GGTCCCAGGGTTCCCCACCCTGG - Intronic
959951508 3:112184990-112185012 GGTCTCTGGGTACCCCAGCCTGG - Intronic
961365575 3:126397546-126397568 GGTCATAGGGTACCCCAACTAGG - Intronic
961659234 3:128459582-128459604 GAACCCAGGGAGCCACAACCTGG + Intergenic
965041248 3:163509749-163509771 GGTCCCACTGTATTACAACCTGG - Intergenic
966160999 3:176968293-176968315 GGTGCCAGTGTACTACAGCCTGG - Intergenic
968472632 4:789027-789049 GCTCCGAGTGTCCCACAACCTGG - Intronic
968612031 4:1561683-1561705 AGGCCCAGGGTCCCAGAACCAGG - Intergenic
978966944 4:114751611-114751633 TGTCCCATGTTACCACAACATGG + Intergenic
985547681 5:518297-518319 GGTCTCAGGGTACCAGGTCCTGG - Intronic
986200541 5:5574481-5574503 TGTCACAGAGTACCACAGCCTGG + Intergenic
986568777 5:9143931-9143953 TGTACCAGGGGACCAAAACCAGG + Intronic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
997263175 5:132479066-132479088 GGTCCCAGAGAATGACAACCTGG + Intergenic
998519122 5:142783762-142783784 GATCCCAGGGTGTCACCACCAGG + Intronic
998872187 5:146563515-146563537 TGTCCAAGGGTACAAAAACCAGG - Intergenic
1001241525 5:170075177-170075199 GGTCTCAGGGAAACATAACCAGG - Intronic
1003117389 6:3292428-3292450 GATGCCAGTGTCCCACAACCTGG - Intronic
1003785714 6:9484676-9484698 GGCCTCATGGTACCACAAACAGG + Intergenic
1005018485 6:21395715-21395737 GGACCCATGCTATCACAACCTGG + Intergenic
1005925833 6:30444649-30444671 GGGCCCAGGATACTCCAACCTGG - Intergenic
1007289119 6:40771603-40771625 GGTCACAGAGTAGCACAGCCAGG - Intergenic
1008676984 6:53829563-53829585 GGGCCCATGGTACCAGAACATGG + Intronic
1018003944 6:159603082-159603104 GGTACCAGGGGACCACTCCCAGG - Intergenic
1018624911 6:165767975-165767997 GGTCCCACTGTACCACCACTAGG - Intronic
1019135010 6:169902511-169902533 GGTCCCAAGGCACCAAGACCGGG + Intergenic
1019382545 7:731933-731955 GGTCCCAGGGCACCAGTCCCTGG - Intronic
1022622501 7:31999414-31999436 TATCCCAGGGTCCCACAGCCAGG + Intronic
1029405886 7:100373806-100373828 GGGCCCAGGCTCCCACCACCAGG + Intronic
1034331484 7:150287007-150287029 GGTCCCAGCATGCCACAAGCCGG + Intronic
1042990341 8:74632309-74632331 GGTCTCAGGGTGCCACCAGCAGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049738168 8:144221136-144221158 GGTCACAGAGCATCACAACCAGG + Intronic
1061540060 9:131273371-131273393 GGTCCCCGTGTATCCCAACCGGG + Intronic
1061836417 9:133332798-133332820 GATCCCAGGGTCCCCCAGCCTGG + Intronic
1061861394 9:133470330-133470352 GGGCCCGGGGTCCCACTACCTGG - Exonic
1062015052 9:134287210-134287232 GGTCCCAGGGCCCCAGGACCAGG + Intergenic
1196574912 X:117305739-117305761 GGCCCCAGGGTAGCATAAACTGG - Intergenic