ID: 902512217

View in Genome Browser
Species Human (GRCh38)
Location 1:16972625-16972647
Sequence GGCTGGACTGCAGGTGTTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902512217_902512227 29 Left 902512217 1:16972625-16972647 CCAGCAACACCTGCAGTCCAGCC 0: 1
1: 0
2: 3
3: 27
4: 245
Right 902512227 1:16972677-16972699 CATTAAAGTTCCTCCTTGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 95
902512217_902512219 -10 Left 902512217 1:16972625-16972647 CCAGCAACACCTGCAGTCCAGCC 0: 1
1: 0
2: 3
3: 27
4: 245
Right 902512219 1:16972638-16972660 CAGTCCAGCCCCCCTCTTCTAGG 0: 1
1: 0
2: 0
3: 29
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902512217 Original CRISPR GGCTGGACTGCAGGTGTTGC TGG (reversed) Exonic
901087622 1:6621112-6621134 GGCTTGACTGCAGGAGTTTGAGG + Intronic
901868815 1:12125604-12125626 GGCAGCACTGCTGGTGTGGCCGG - Intronic
902512217 1:16972625-16972647 GGCTGGACTGCAGGTGTTGCTGG - Exonic
902605827 1:17568896-17568918 GACTGGGCTGGAGGTGTTGGGGG - Intronic
903006468 1:20302158-20302180 GGCTGGACTCCAGGTCTCTCAGG + Intronic
903043549 1:20550049-20550071 GGCTGAACTCCAGCTGTTGATGG - Intergenic
903777815 1:25804592-25804614 GGCTGGACTGGCAGTGTGGCTGG - Intronic
904414131 1:30345432-30345454 GGCTGGAGTGCAGTGGTGGCAGG - Intergenic
905895146 1:41540896-41540918 GGCTGGACTCCAGGTCCAGCGGG + Intronic
906154328 1:43605312-43605334 GGATGGACACCAGGTGCTGCAGG - Exonic
907937334 1:59054339-59054361 AGCTGGACCTCAGGTGCTGCTGG - Intergenic
908112435 1:60910619-60910641 GGCTGGAATGCAGGTCTGCCTGG - Intronic
908439513 1:64139660-64139682 TGCTGGACGGCAAGAGTTGCTGG - Intronic
908511038 1:64850225-64850247 GGCTGCCCTGGAGCTGTTGCTGG - Intronic
909614054 1:77587131-77587153 GGCTGGATTGGTTGTGTTGCTGG + Intronic
913490816 1:119378193-119378215 GGCTGGAGTGCAGTTGGTTCTGG - Intronic
916979386 1:170116687-170116709 GACTGGACTGAAGGCCTTGCAGG + Intergenic
920435326 1:205943388-205943410 GGCAGGGCTGCAGGTGTGTCTGG + Exonic
921192560 1:212723752-212723774 GGATGGTCTGCTGGTCTTGCTGG - Intergenic
922404913 1:225302592-225302614 GGCTGTGCTGCTGCTGTTGCTGG - Intronic
922860088 1:228809131-228809153 TGCTGCACTGCAGGTGGTGCAGG - Intergenic
922955318 1:229594504-229594526 GTCTGGACTGAAGGTGAGGCTGG + Exonic
923276456 1:232400996-232401018 GGCTGGGTTGGAGGTGTTGGTGG - Intronic
923489924 1:234475478-234475500 AGCTGGTCTGCAGGTGCTGGAGG + Intronic
924147765 1:241094753-241094775 GTCTGGATTGCAGATGTTGCAGG + Intronic
924517673 1:244780059-244780081 GGCAGGACTGTAGGTCTTGGTGG - Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1067249197 10:44573090-44573112 GGGTGGACTGCAGGCATAGCTGG - Intergenic
1067726901 10:48777259-48777281 GGATGGACTGCAGCTGGTGCTGG - Intronic
1068214751 10:53968757-53968779 TGCTGGACTGTTGGAGTTGCTGG - Intronic
1069843988 10:71358140-71358162 GGCAGGACTGGAGCTGTTTCTGG + Intronic
1070328287 10:75401635-75401657 GGCTGGACTGCGGGAGTGCCGGG + Exonic
1072814239 10:98489076-98489098 GGCTGGAATGAAGGTCTGGCTGG + Intronic
1073073213 10:100807719-100807741 GCCTGGGCTGCATGTGTAGCAGG - Intronic
1073473504 10:103738502-103738524 GGCTGGACCGCTGGTGTCACTGG - Intronic
1074963632 10:118469922-118469944 GGGAGGACTGCAAGTGTTTCAGG - Intergenic
1075998835 10:126899243-126899265 CGCTGGACATCAGGTGGTGCAGG - Intergenic
1076267570 10:129120606-129120628 GCCTGGGCTGGAGGTGTTTCTGG - Intergenic
1076436164 10:130443500-130443522 AGCTGGACTGCAGGTGACACAGG + Intergenic
1076473555 10:130736705-130736727 GGGTGGACAGAAGCTGTTGCAGG - Intergenic
1076815638 10:132913454-132913476 GACTGGAATGCAGCTGTTGATGG - Intronic
1076824880 10:132961787-132961809 GGCTGGGCTGCAAGTGCAGCGGG - Intergenic
1077060439 11:615558-615580 GGTGTGACTGCAGGTGTGGCCGG + Exonic
1077478993 11:2804167-2804189 GGGTGAACTGCAGTTGTTTCTGG - Intronic
1079079083 11:17401496-17401518 AGCTGGACTTCAGGGGTTGGGGG + Intronic
1079178857 11:18170790-18170812 GGCTGGAATGCTGATGTAGCTGG - Intronic
1080779555 11:35418551-35418573 GGCGGGCTTGCAGGTGGTGCCGG - Intronic
1080936415 11:36868587-36868609 GGCTGGAATGTAGGTGTGGAGGG + Intergenic
1081464204 11:43301243-43301265 GTCTGAAATTCAGGTGTTGCTGG - Intergenic
1081862384 11:46340677-46340699 AGCTGGGTTGCAGGTGCTGCTGG - Intronic
1082081545 11:48016090-48016112 GGCTGGATTGGAGGTGTTGAGGG + Intronic
1083451275 11:62747079-62747101 GGCTGGAGTGCAGCGGTGGCTGG - Intergenic
1085281040 11:75330968-75330990 TGCTGGAATGCAAGTGCTGCAGG - Intronic
1087034653 11:93743356-93743378 GGCTGGAGTGCAGTTGAAGCAGG + Intronic
1087309239 11:96521180-96521202 GGTTGCACTGGAGGTGGTGCTGG + Intergenic
1088117894 11:106333368-106333390 GGCTGGACAGGAGGTATGGCTGG + Intergenic
1088937304 11:114416340-114416362 TGCTGGCCTGCATGTGGTGCTGG + Intronic
1089319144 11:117613231-117613253 TGCAGGACTGCTGATGTTGCTGG + Intronic
1090242860 11:125196310-125196332 GGCTGGGCTGCACATTTTGCTGG + Intronic
1090442862 11:126738462-126738484 GGCAGGACTGTATGTGATGCGGG + Intronic
1090471310 11:126983705-126983727 GGCTGGCATCCAGGTGCTGCAGG - Intronic
1092333688 12:7608801-7608823 TGCTGCACTGCTGTTGTTGCTGG + Intergenic
1093993803 12:25619697-25619719 GGCAGGACGGCAGGTGGGGCTGG + Intronic
1096218486 12:49811724-49811746 GGCTGGAGTGCAGCAGTAGCCGG - Intronic
1096608520 12:52785261-52785283 GCCTGGACTGGAAGTGTTGATGG + Intergenic
1099112959 12:78586367-78586389 GGCTTGTCTTCAGGTGTTGGTGG + Intergenic
1102222510 12:111204047-111204069 TGGTGGACTGCAGGGGTTCCAGG - Intronic
1102487595 12:113268696-113268718 GGCTGGGCTGCAGGGGCTGACGG + Intronic
1102819909 12:115899246-115899268 GGGTGGACTGCAGCAGATGCAGG + Intergenic
1103756060 12:123208140-123208162 GGCTGGAGTGCAGTGGTTCCAGG - Intronic
1104899043 12:132178338-132178360 GGCTGGAGTGCAGGGGGTGGGGG - Intergenic
1104966036 12:132509231-132509253 GGCTGGGCTGGAGCTGTTGCTGG - Intronic
1109212163 13:59547507-59547529 GAGAGGACTGCAGGTGTTCCAGG - Intergenic
1113397350 13:109960992-109961014 GGCTGAACTCCAGGTGTGGCAGG - Intergenic
1113711550 13:112468340-112468362 GGCTTTACTGCAGGTGTTGGGGG - Intergenic
1114249938 14:20950657-20950679 GGCTGGAGTGCAGGTGATCTCGG + Intergenic
1114527954 14:23378107-23378129 GGCCAGACTGCTGGGGTTGCTGG + Intronic
1115081651 14:29460042-29460064 GGCAGTGCTGCAGGTGTTTCTGG + Intergenic
1118906500 14:70027431-70027453 GGCAGGAGTAGAGGTGTTGCAGG + Intronic
1119373367 14:74166979-74167001 GTCAGGAGAGCAGGTGTTGCTGG + Intronic
1121011298 14:90521730-90521752 GCCAGGACTGCAGGGGATGCAGG - Intergenic
1121451312 14:94010054-94010076 CGCTTGACTCCAGGTGCTGCTGG + Intergenic
1122520726 14:102341732-102341754 GGCTGGGCTGCTGGTGGTTCAGG - Exonic
1122816760 14:104317880-104317902 GGCTGAACTGCAGGGATTTCAGG + Intergenic
1122999753 14:105286991-105287013 TGCTGGACTGCAGGGGACGCAGG + Intronic
1124354179 15:28983188-28983210 GGCTGGGCTGCAGGTGTTGAGGG - Intronic
1129523874 15:76202001-76202023 GGCTGGACTGCACTGGGTGCTGG - Intronic
1129558139 15:76535656-76535678 TGCTGGCCTACAGGTATTGCTGG + Intronic
1130510677 15:84586881-84586903 GGCTGGACTGAAGGAGCTGGAGG - Intergenic
1130736647 15:86557375-86557397 GGCTGGGCCCCAGGGGTTGCTGG + Intronic
1130956425 15:88630314-88630336 GGCTGGGCTTCCGGTGTGGCCGG + Exonic
1132415395 15:101615382-101615404 GGCTGGCCTGGAGGGGCTGCAGG + Intergenic
1132525449 16:411951-411973 GGCTGGGCTGCAGGCATTGCTGG - Exonic
1132566928 16:627820-627842 GGCTGGGCTGCTGGTGCTTCCGG + Exonic
1132883661 16:2173043-2173065 GGCAGGACGGCAGGTGTGGGTGG + Intronic
1133037363 16:3041323-3041345 GGCTGGAGAGCAGGTGAGGCTGG - Intergenic
1134038583 16:11050758-11050780 TGCTGGACGGCAGGTGCTGGTGG - Intronic
1136550682 16:30980854-30980876 GGCTGGGCTGCAGGAGGGGCTGG + Intronic
1137692709 16:50440724-50440746 GGCTGGGCTGCAAGGGTTGGGGG + Intergenic
1138132163 16:54489634-54489656 AGCTGGACTGCAGCTATTACCGG - Intergenic
1138417362 16:56879145-56879167 GGCTGGCCTGCAGCTATGGCTGG + Exonic
1139375455 16:66493855-66493877 GGATGGCCTGCAGGAGTTGAGGG - Intronic
1139648150 16:68346947-68346969 AGGTGGCCTGCAGGTGGTGCAGG + Intronic
1140987320 16:80170677-80170699 GGCTGCACTTCAAGTGTTCCAGG - Intergenic
1142142719 16:88479724-88479746 GGCTGGCCTCCTGGTCTTGCTGG - Intronic
1146482052 17:33212683-33212705 GGCTGGCCTGCAGGTGTCCTTGG + Intronic
1147836671 17:43337768-43337790 GCCTGGACTGCAGGTATACCTGG + Intergenic
1148050868 17:44769426-44769448 GGCTGGGCTGCAGGTGCAGCTGG - Intronic
1148323457 17:46770897-46770919 GGTTGGGCTGCAGGTCTTGCAGG - Intronic
1148346438 17:46906501-46906523 GGCTTGACTCCAGGTGTTGAAGG - Intergenic
1149362534 17:55910683-55910705 GACTGGCCTGCAGGTGTCCCTGG - Intergenic
1152256736 17:79244358-79244380 GTCTGGAATGCAGGTGTCTCAGG - Intronic
1153551845 18:6270752-6270774 GGCTGCACTGCAGGGGCTGGAGG + Intronic
1155017798 18:21863024-21863046 GGCTGGAGAGCAGTTGATGCAGG + Intronic
1155762596 18:29586412-29586434 GGCTGCACAGCAGGTGGTGAAGG + Intergenic
1158281981 18:55838472-55838494 GGGTGTGCTGCAGGTGGTGCTGG + Intergenic
1160412262 18:78683166-78683188 GGCGGGAGTGGGGGTGTTGCGGG + Intergenic
1160742920 19:695542-695564 GCCTGGGCTCCAGGCGTTGCTGG - Intergenic
1163313021 19:16525374-16525396 GGTTGAACTGCGGGTGCTGCTGG + Exonic
1164914945 19:32045009-32045031 GGCTCCACTGCAGGTGCTGTTGG - Intergenic
1165049309 19:33131669-33131691 GGCTGGGGTGCTGGTTTTGCTGG + Intergenic
1165428938 19:35760969-35760991 GCCTGGACTGCAGGTGAGGGAGG - Intronic
1165719550 19:38069391-38069413 GGCTGGAGCGCAGGTGTGGTTGG - Intronic
1165898645 19:39157754-39157776 GGGTGGATTGCTGCTGTTGCCGG + Intronic
1166682220 19:44776111-44776133 GGCTGGAGTGCAGTGGTTGTTGG - Intergenic
1168275625 19:55276758-55276780 GGCTGCACTGCAGGTCTTCTCGG + Intronic
1168385114 19:55956658-55956680 GCCAGGACTGAAGGTGTTCCTGG + Intronic
925326162 2:3023645-3023667 AGCTGGATTGCACGTGTTGCAGG + Intergenic
929806927 2:45154231-45154253 GGCTGGCCTGCAAGGGCTGCTGG - Intergenic
933189705 2:79320640-79320662 GGCTGGTCTGTAGGTCTTGCCGG - Intronic
933851518 2:86370632-86370654 TGCTGGCCTCCAGATGTTGCAGG + Intergenic
934660102 2:96138675-96138697 GGCGGGGCTGCAGGTGGAGCTGG - Intergenic
934697881 2:96413293-96413315 GGCTTGAGTGCAGTTGTTACAGG - Intergenic
934751591 2:96797422-96797444 GGCTGGAGAGCAGGAGCTGCGGG + Intronic
935880073 2:107556524-107556546 GCTGGGATTGCAGGTGTTGCAGG - Intergenic
936066944 2:109339591-109339613 GGTGGGGCTGCAGGGGTTGCCGG + Intronic
937870188 2:126780987-126781009 AGCAGGACTGCAGCTGTTGTGGG - Intergenic
937898616 2:126998147-126998169 GGCTGGAGTGCAATTGTTCCTGG - Intergenic
938112624 2:128578998-128579020 GGCTGGGGTCCAGGTGTTGGGGG - Intergenic
938295206 2:130173719-130173741 AGCTGGGCAGCAGGTGGTGCAGG - Intronic
938461417 2:131500119-131500141 AGCTGGGCAGCAGGTGGTGCAGG + Intergenic
938983000 2:136544436-136544458 GCCTGGCCTGCAGGCTTTGCAGG - Intergenic
939647016 2:144712552-144712574 GGCAGGGCTGCAGGGGTTGGGGG - Intergenic
940453897 2:153872516-153872538 TGCGGGGCTGCAGGTGTTGCGGG + Intronic
942311675 2:174662326-174662348 GGCTGGACTGCGGATGTAGAGGG + Intronic
943358930 2:186894814-186894836 GGCTGGAGTGCAGTTGATACAGG - Intergenic
944017347 2:195058245-195058267 GGCTGGACTCCAGGCTTTGGTGG + Intergenic
945332963 2:208560796-208560818 GGCTGCAATCAAGGTGTTGCAGG + Intronic
946023696 2:216659191-216659213 GCCTTGACAGCAGGTGCTGCTGG + Intronic
946263639 2:218519679-218519701 GGCTGGAGTGCAGTAGTGGCGGG + Intronic
948171868 2:235910268-235910290 GCCTGGCCTGCCTGTGTTGCAGG + Intronic
948388810 2:237597886-237597908 GGCAGGGCTGCAGGTGGGGCAGG - Intronic
948508770 2:238448982-238449004 GGCTGGCCTGCAGGTGTCTAGGG + Exonic
948587210 2:239026919-239026941 GGCTGTGCTGCAGGTGCTCCGGG - Intergenic
949046464 2:241874638-241874660 GGCTCGGATGCAGGTGGTGCGGG + Intergenic
1168964172 20:1889153-1889175 GGGTGTACTGGTGGTGTTGCAGG - Intergenic
1169159154 20:3361458-3361480 GGCTAGACGGCTGTTGTTGCAGG + Intronic
1169663021 20:8001093-8001115 GGCTGGACCACAGGTATAGCTGG - Intronic
1172062055 20:32193391-32193413 GGCTGGAGGGCGGGGGTTGCAGG + Exonic
1172649646 20:36493643-36493665 GGCTGGGCTGCCGGTGTTTGGGG - Intronic
1172780724 20:37435703-37435725 GTCTGGGCTGCAGGGGATGCTGG - Intergenic
1173859140 20:46270615-46270637 GGAGGCACTGCAGGTGTTGAAGG + Intronic
1174179571 20:48666256-48666278 GGCTGGGCTGCAGGTGGGGGTGG + Intronic
1175322681 20:58100455-58100477 GGCTGGACTGGAGGGGAGGCAGG - Intergenic
1175645502 20:60667337-60667359 GGCTGGCTTGCAGGAGCTGCAGG + Intergenic
1177882474 21:26710384-26710406 GGCTGGCATGCAGGTCTGGCTGG + Intergenic
1179992972 21:44958225-44958247 GGCTGTAGTGCTGGTGCTGCTGG + Intronic
1180093206 21:45542856-45542878 GCCAGGAATGCAGGTGTTCCAGG - Intronic
1181114533 22:20622914-20622936 AGCTGGGCAGCAGGTGGTGCAGG - Intergenic
1182151567 22:28030768-28030790 GACTGGACTGCAGCTTGTGCAGG - Intronic
1183173459 22:36204824-36204846 GGCTGGACTGCAGGAGGTGCTGG - Exonic
1183178204 22:36239637-36239659 GCCTGGACTGCAGGTGGTGCTGG - Intronic
1184896345 22:47409329-47409351 GGAGGGTCTGCAGGTGTTTCAGG - Intergenic
1185157684 22:49204160-49204182 GGCTGGACCTCAGGTGCAGCTGG + Intergenic
1185239496 22:49735112-49735134 GGCTGGGCTGCTGGGGCTGCAGG + Intergenic
949373074 3:3356025-3356047 GACTGGAAAGCAGGAGTTGCTGG + Intergenic
950171064 3:10839422-10839444 GGCTGGCCTGCAGCGTTTGCAGG + Intronic
950494929 3:13328104-13328126 GGCTGCACTGCAGGTCATTCTGG - Intronic
951581943 3:24173851-24173873 GGCTGGAATGCAGGTCTGGAAGG - Intronic
953853774 3:46485285-46485307 GGCGGGAATGCAGGTACTGCTGG + Intergenic
953925894 3:46982284-46982306 GGGAGGGGTGCAGGTGTTGCTGG - Intronic
959580053 3:107974147-107974169 GGCTGGAGTCCAGGTGTTTGAGG - Intergenic
961305851 3:125958883-125958905 GGCTGGGCTGGAGCTGTTCCTGG - Intergenic
961371555 3:126434770-126434792 GGCTGGACTGGAGGGGCTGGAGG + Intronic
961793466 3:129393079-129393101 GGCTGCCCTGCAGGTGTTCCTGG - Intergenic
961807463 3:129499697-129499719 GGCTGCCCTGCAGGTGTTCCTGG - Intronic
961824038 3:129589470-129589492 GGATGGACAGCGGGTGCTGCAGG + Exonic
962906722 3:139810197-139810219 GGTTGGACTGCAGGTGGGGCAGG + Intergenic
963136581 3:141911079-141911101 GACTTGACTGCAGGTTTTTCAGG + Intronic
963593884 3:147300718-147300740 GGCTAGAATGCAGGTATTGAGGG + Intergenic
968735280 4:2291913-2291935 GGCTGCAGGGCAGGAGTTGCAGG + Intronic
969228884 4:5816202-5816224 GGCTGGACTGCAGGCTATGTCGG - Intronic
969320683 4:6410609-6410631 GGCTGGTCTGCAGGTGTGTGAGG + Intronic
969430581 4:7151531-7151553 GGCTGGGCTGCAGGTTATGAGGG + Intergenic
970072889 4:12182315-12182337 AGCTGGACTGCAGGTGATTGAGG + Intergenic
971433600 4:26594822-26594844 GGCTGGAGTGCAGTTGTAGCGGG - Intronic
973047183 4:45549313-45549335 GGTAAGACTGCAGGTGTTACTGG - Intergenic
975737210 4:77392877-77392899 TGATGCTCTGCAGGTGTTGCTGG + Intronic
979536156 4:121823278-121823300 GTCTGGAGTGCAGTTGGTGCTGG - Intronic
981501100 4:145452754-145452776 CACTGAACTGCAGGTGTTGTGGG - Intergenic
982484412 4:155950631-155950653 GGCTGCACAGCAGGTGGTGAGGG + Intronic
985565456 5:613205-613227 GTGTGGTCTGCAGGTGTTACTGG + Intronic
985704355 5:1391922-1391944 GGCAGGGCTGCAGGTGGGGCTGG + Intergenic
985932272 5:3067875-3067897 GGCTGGAATGCAGATTTTGCGGG - Intergenic
996710487 5:126538283-126538305 GGCTGTACGGGAGGTGTGGCTGG - Intergenic
998446398 5:142201997-142202019 CGCTGGAGTGCAGGGATTGCAGG + Intergenic
1001871940 5:175163765-175163787 GGCTTCACTGTAGGTGTCGCGGG + Intergenic
1002055772 5:176597245-176597267 TGCGGGCCTGCAGGTGTCGCTGG - Exonic
1002896174 6:1381879-1381901 GCCTCGGCTGCAGGGGTTGCGGG + Intergenic
1002971698 6:2029543-2029565 GGCTGGACTGCAGGTGCAGTTGG - Intronic
1004213454 6:13677821-13677843 ACCTGGCCTGCAGTTGTTGCTGG - Intronic
1005267503 6:24127116-24127138 GGGTGGAGGGCAGGTGTTGGGGG + Intronic
1006780921 6:36631751-36631773 GCCTGGAATGCAGGAGTGGCAGG - Intergenic
1009585663 6:65598437-65598459 GGCTATACTCCAGGTGATGCTGG - Intronic
1011101610 6:83728373-83728395 ACCTGGACTACAGGTGTTGGTGG + Intergenic
1016094762 6:140021475-140021497 GGCTGTACAGGAGGTGTGGCTGG + Intergenic
1018206968 6:161445330-161445352 GGCTGGAATGCAGTTGCTGGGGG + Intronic
1019875159 7:3803792-3803814 GGCTGGAGTGCAGTGGTGGCTGG + Intronic
1020641329 7:10757791-10757813 GGCTGGACTCCAGAAATTGCTGG + Intergenic
1021216891 7:17927324-17927346 TGCTGGAGTCCAGGTGTTGGAGG - Intronic
1021263908 7:18495549-18495571 GGCTGGACAGCTGGGTTTGCTGG + Intronic
1025942787 7:66086321-66086343 GGCTGGACTTGGGGTGTTTCTGG + Intronic
1026656521 7:72261387-72261409 TTCAGGACTGCAGGTGATGCTGG - Intronic
1026889600 7:73974237-73974259 GCCTGGACTGCATGGGGTGCTGG + Intergenic
1030110496 7:106022587-106022609 GGCTGGACTGGAGTAGCTGCAGG + Intronic
1030598231 7:111563836-111563858 GGCTTTAATGCAGGTGATGCTGG - Intergenic
1030609964 7:111678688-111678710 GGCTGGAGTACAGGGTTTGCTGG - Intergenic
1031430627 7:121664091-121664113 GGATGGATTTCAGGTGTTCCTGG + Intergenic
1034475553 7:151279609-151279631 GCTTGGACAGCAGGTGTGGCAGG + Intergenic
1035326359 7:158068396-158068418 GGCTGGACTGCAGCTGGGGCAGG + Intronic
1035463236 7:159059274-159059296 TGATGCCCTGCAGGTGTTGCTGG - Intronic
1036802736 8:11804648-11804670 GGCTGGAGTGCAGTGGTGGCGGG + Intronic
1037167359 8:15847131-15847153 GGCAGGTCTGCATGTATTGCAGG + Intergenic
1039162846 8:34641695-34641717 GACTGGTCTGCAGGTTTTGCAGG - Intergenic
1040291518 8:46127959-46127981 GGCAGGACTGCAGGAAATGCTGG - Intergenic
1040298260 8:46174507-46174529 GGCAGGACTGCAGGGAATGCTGG + Intergenic
1040315900 8:46260770-46260792 AGCGGGACTGCAGGGGATGCTGG + Intergenic
1040331522 8:46388140-46388162 GGCTAGACTGCAGGAAATGCTGG + Intergenic
1040342407 8:46447574-46447596 GGCTAGACTGCAGGGAATGCTGG - Intergenic
1040360369 8:46658984-46659006 GGCTGGCCTGCAGATGGTGCTGG + Intergenic
1040583426 8:48716245-48716267 GGCTGGCCTGCGGGTGCCGCCGG - Intronic
1045216900 8:100158046-100158068 GGCTGCACTGCAGGTGCTGAGGG - Intronic
1045737996 8:105318801-105318823 GGCCGGACTCCAGGTGCTCCGGG - Exonic
1045892631 8:107175176-107175198 GGCTGTACTCCAGGGGTAGCAGG + Intergenic
1048268537 8:133009348-133009370 GGCTTGACTGCAAGAGATGCTGG - Intronic
1048859924 8:138716631-138716653 TGGTGGCCTGCAGGTGTTGGGGG - Intronic
1049603758 8:143519817-143519839 GGCTGCACTGCAGGGGACGCAGG + Intronic
1049801966 8:144522100-144522122 GGCTGGATGGCAGTTGTTGCCGG - Exonic
1051291000 9:15545767-15545789 TGCTTGACTGCAGGAGTTTCAGG + Intergenic
1055022605 9:71686205-71686227 GGCTGTAATGCAAGTGTTGTGGG - Intronic
1055275407 9:74610472-74610494 GGCTGGACTGAATGCTTTGCAGG + Intronic
1056644642 9:88400184-88400206 GGCTGGACTGTAGTTGCAGCAGG + Intronic
1056815943 9:89800902-89800924 GACTGGAGTGGAGGTGGTGCTGG + Intergenic
1057208751 9:93188177-93188199 GGACAGACTGCAGGTGCTGCGGG - Intronic
1057336265 9:94157567-94157589 GGCTGGGCTGGAGGTGGTGCAGG + Intergenic
1060846726 9:126843135-126843157 CGCTGGAATGCAGGTGGTGGAGG - Intergenic
1061283835 9:129611340-129611362 GGCTGGAACGCAGGTGTGGCAGG + Intronic
1061289165 9:129641120-129641142 GTCCTGGCTGCAGGTGTTGCCGG - Intronic
1061876979 9:133548941-133548963 GGCTGAACTGCAGCTGGTGTAGG + Intronic
1062534302 9:137014795-137014817 GGCTGCGCTCCAGGTGCTGCAGG + Exonic
1062573539 9:137196240-137196262 GGGTGGAGTGCAGGGATTGCAGG - Intronic
1203633606 Un_KI270750v1:92135-92157 GGGTGGGCTGCAGGTGGTGTAGG + Intergenic
1186193166 X:7085956-7085978 GGCTTGTCTGCAGGAGTGGCTGG - Intronic
1189896865 X:45665100-45665122 CGCTGGCCTGCAAGTGCTGCAGG + Intergenic
1190070780 X:47277511-47277533 GGCTGGAGTGCAGGGCTTGAGGG - Intergenic
1192504158 X:71670723-71670745 GGGTGGACTGCAGGTATAGGTGG + Intergenic
1194226056 X:91259321-91259343 GGCTGGAGTGCAGTGGTGGCAGG + Intergenic
1195382463 X:104283890-104283912 GCTTGGACTACAGGTGTTGAAGG + Intergenic
1195718459 X:107841617-107841639 GGATGAACTACTGGTGTTGCAGG - Intronic
1196324969 X:114391700-114391722 GGCTGGAGTGCAGGGGATGGGGG + Intergenic
1198802261 X:140459948-140459970 GGCTGGAGTGCTGGTGTTTGCGG - Intergenic
1199973425 X:152877217-152877239 GTCTGGACTTCAGGTCCTGCAGG + Intergenic
1200184869 X:154175647-154175669 GACTGACCTGCAGCTGTTGCTGG - Intergenic
1200190522 X:154212785-154212807 GACTGACCTGCAGCTGTTGCTGG - Intergenic
1200196273 X:154250587-154250609 GACTGACCTGCAGCTGTTGCTGG - Intergenic
1200201928 X:154287705-154287727 GACTGACCTGCAGCTGTTGCTGG - Exonic