ID: 902512758

View in Genome Browser
Species Human (GRCh38)
Location 1:16975181-16975203
Sequence TTGAATAAACATCAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902512754_902512758 -5 Left 902512754 1:16975163-16975185 CCTGGTGGATAATATGTGTTGAA 0: 1
1: 1
2: 0
3: 62
4: 256
Right 902512758 1:16975181-16975203 TTGAATAAACATCAGGTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 155
902512753_902512758 7 Left 902512753 1:16975151-16975173 CCTGGAAGTGGGCCTGGTGGATA 0: 1
1: 0
2: 1
3: 21
4: 331
Right 902512758 1:16975181-16975203 TTGAATAAACATCAGGTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902512758 Original CRISPR TTGAATAAACATCAGGTGGG TGG Intronic
900885149 1:5409889-5409911 TGGAATAAACATCTGGTGAAGGG - Intergenic
902184988 1:14718282-14718304 TTGAATTCACATCAAGCGGGAGG - Intronic
902230303 1:15023382-15023404 TTGAATAAAGAGGAGATGGGAGG + Intronic
902512758 1:16975181-16975203 TTGAATAAACATCAGGTGGGTGG + Intronic
907174806 1:52509328-52509350 CTCAATAAACATCAGTTGGATGG + Intronic
908925911 1:69255038-69255060 TTGAACAAATATCAGTTGGCTGG - Intergenic
910830662 1:91458027-91458049 GTGAGTAAACAGCAGGTGTGAGG - Intergenic
912833502 1:112974324-112974346 CTGAAAAAAGTTCAGGTGGGAGG + Intergenic
916633967 1:166648256-166648278 CTGAATAAATATCTGGAGGGAGG - Intergenic
919329292 1:196148756-196148778 GTCAATCAACAACAGGTGGGAGG - Intergenic
920344366 1:205296537-205296559 TTGAATAAAAACCTGGTGGCAGG - Intergenic
920841939 1:209562418-209562440 ATGAAGAAAAAGCAGGTGGGTGG + Intergenic
923652522 1:235887447-235887469 TTGAGTAAAGAATAGGTGGGAGG + Intergenic
1066271905 10:33832327-33832349 TTGAGAAAACATCAGAAGGGAGG - Intergenic
1069379597 10:67829323-67829345 TTGAATAAACCTGAGAGGGGCGG - Intronic
1072556982 10:96526049-96526071 GTGGATAAACATCACGTGGCTGG - Intronic
1074799717 10:116987327-116987349 TTGTATAAACATTAGGGTGGTGG - Intronic
1078508296 11:11967872-11967894 TTGGAGAAAGATCTGGTGGGTGG + Intronic
1080711897 11:34756606-34756628 TTGACTTAACATCAGGAGGCAGG + Intergenic
1084622491 11:70282458-70282480 TAGAATAAACATTAGGTAGCTGG - Intronic
1085899833 11:80685844-80685866 TTGAATATAGGTCAGGTGGAAGG - Intergenic
1086800023 11:91161917-91161939 TTGCATAAATGTCTGGTGGGGGG - Intergenic
1087713183 11:101578034-101578056 TTGAATAAATATCAAGGAGGAGG + Intronic
1092233331 12:6790088-6790110 ATAAATAAATATAAGGTGGGAGG + Intronic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1094223598 12:28021893-28021915 TTGATTTAACGTCAGGTGTGTGG - Intergenic
1097003925 12:55901575-55901597 TTAAAAGAAAATCAGGTGGGTGG - Exonic
1097365052 12:58702558-58702580 TTGAAAAAACATTAGGTGAATGG + Intronic
1098954307 12:76672597-76672619 ATGAATGGACATCAGGAGGGAGG - Intergenic
1099153197 12:79141162-79141184 ATGAATAAACATCATATGGAAGG - Intronic
1099495197 12:83338938-83338960 TTGAATATTCCTCTGGTGGGTGG - Intergenic
1100002289 12:89851641-89851663 TTTAATCAACATCAGTTGGCAGG - Intergenic
1103534500 12:121625737-121625759 TTTAAAAAATATCAGGTGGCCGG + Intergenic
1106078974 13:26484878-26484900 TTGAAAAATCATCAGGGGGCCGG + Intergenic
1108684824 13:52809691-52809713 TTGAAAAAACATCTGCAGGGAGG + Intergenic
1111056889 13:82962284-82962306 CTGAATAAACATCAGCTCTGAGG + Intergenic
1111640892 13:90968480-90968502 TTGAATTACCATCAGGCTGGGGG + Intergenic
1115057382 14:29146545-29146567 TTGAATAAATTTCATGTGGTGGG - Intergenic
1116147347 14:41091525-41091547 ATGAATAATAATAAGGTGGGAGG - Intergenic
1118078782 14:62333605-62333627 ATGAAAAAAGAACAGGTGGGTGG - Intergenic
1120115931 14:80617548-80617570 TTTAAAGAACATAAGGTGGGGGG + Intronic
1120197883 14:81506144-81506166 ATGAATGTACATCAGATGGGAGG - Exonic
1127376912 15:58393498-58393520 TTTAAAAAAAATGAGGTGGGTGG + Intronic
1128878135 15:71218884-71218906 TTTAATAAATATCTGGTGGAAGG - Intronic
1129534318 15:76299576-76299598 TTTAAGAAACATCAGGAGGCAGG - Intronic
1129993866 15:79988002-79988024 TTGAATGAAAAACAGATGGGTGG + Intergenic
1131804862 15:96110610-96110632 TTCAAAAAACATCAGGCGGAGGG - Intergenic
1131932334 15:97457111-97457133 ATGACTAAACATCAGGTAAGAGG + Intergenic
1133247448 16:4458704-4458726 TTGCTTAAACATTAGGAGGGTGG + Intergenic
1133688028 16:8185426-8185448 TTGAGTATACATCGCGTGGGTGG - Intergenic
1134291481 16:12905330-12905352 TTGAATAAACATCAGGATCTGGG + Intronic
1138237347 16:55395820-55395842 TTGAATCAAAATCAGGAGGCAGG + Intronic
1140612709 16:76620077-76620099 TTGAATCAACATTAGGTAAGTGG - Intronic
1141556641 16:84840891-84840913 TTGATTAAATATCAGGTATGTGG - Intronic
1142873236 17:2834873-2834895 TTAAATAAAGGTCAGGTGGATGG - Intronic
1143005240 17:3827824-3827846 GTAAATAAACAACAGGTGGTGGG - Intronic
1143278388 17:5731534-5731556 TAGACTAAACAGCAAGTGGGTGG - Intergenic
1144686850 17:17231786-17231808 CTGCAGAAACGTCAGGTGGGTGG - Exonic
1149544315 17:57491805-57491827 TTGAATGAACAGCAGGAAGGAGG - Intronic
1151418951 17:73985003-73985025 TTTAATAAACGTGAGGTGGATGG - Intergenic
1151891259 17:76951763-76951785 TTTAATAAGCTCCAGGTGGGCGG + Intergenic
1153757806 18:8301544-8301566 TTGAATAAAGATCAGAAGAGAGG - Intronic
1154137272 18:11790951-11790973 TTGAAAAACCATCAGCTGGCTGG - Intronic
1158861849 18:61600184-61600206 ATGTATAAAAATCAGGTGGTGGG + Intergenic
1159022764 18:63156629-63156651 TTACGTAAACATCAGGTGGACGG - Intronic
1160054929 18:75470123-75470145 CTGATTAAACAATAGGTGGGTGG + Intergenic
1160137412 18:76284206-76284228 GTCAATAAACATCATATGGGTGG + Intergenic
1160959148 19:1710323-1710345 TTCAATAAAACTGAGGTGGGGGG + Intergenic
1162776816 19:12984822-12984844 ATGAATATTCATGAGGTGGGGGG + Intergenic
1165766933 19:38357413-38357435 TGGAATATACCTGAGGTGGGAGG + Intronic
925681549 2:6427404-6427426 TTGATTAGACATCAGGGTGGGGG + Intergenic
926521385 2:13919741-13919763 TTAAATAAACAACAGGAGAGAGG - Intergenic
927015339 2:18953520-18953542 TTGAAGAATTATCTGGTGGGAGG + Intergenic
930558165 2:52926548-52926570 TTGAATAAAGTTATGGTGGGTGG - Intergenic
931526478 2:63160777-63160799 TTTAAAAAACATCAGGTGAAAGG + Intronic
933264842 2:80170797-80170819 GTGAATAAGCATCTGTTGGGTGG + Intronic
935165720 2:100567105-100567127 TTCAGTAAACACTAGGTGGGTGG - Intronic
935623684 2:105150691-105150713 TTGAAGACTCATCAGGTGGGTGG + Intergenic
936791209 2:116155329-116155351 TTGCACAAACATCAGTTTGGGGG + Intergenic
940491230 2:154363752-154363774 TTGCATAAACATGATGTGGAAGG - Intronic
1172949656 20:38714681-38714703 TAGAATAAACATGTGGGGGGCGG + Intergenic
1175378381 20:58545184-58545206 TTAAATAAACATGATGTGGCTGG - Intergenic
1177062026 21:16387905-16387927 TTGAAGAAATATCAGATTGGAGG - Intergenic
1178351679 21:31876094-31876116 TTTAAGAAACATAAGATGGGAGG - Intronic
1178378240 21:32086114-32086136 GAGGATAAACAGCAGGTGGGAGG - Intergenic
1182546982 22:31082139-31082161 ATGAATCAACAGGAGGTGGGGGG + Intronic
1182838547 22:33364381-33364403 TTGAAAAAACAAAAGATGGGAGG - Intronic
1183046437 22:35224238-35224260 TTGTACACACATCAGGTGGGTGG - Intergenic
954078265 3:48196827-48196849 TTCAAGAAACAGCAGGAGGGAGG + Intergenic
954488553 3:50878378-50878400 TTGAAAAAAGATTAGATGGGTGG + Intronic
955815685 3:62839849-62839871 TTGATTAAACATGAGATGAGAGG + Intronic
956818211 3:72928396-72928418 TTGAATGAACTTCAGGTAGAAGG - Intronic
957259689 3:77884926-77884948 TTGAATAATCATGAGATGGAAGG + Intergenic
957912093 3:86633022-86633044 ATCAATAAAAATAAGGTGGGGGG + Intergenic
957977170 3:87461191-87461213 TTGAATAAACATCAGTAGCCAGG + Intergenic
958605933 3:96358474-96358496 TTGAATAGGAATGAGGTGGGAGG + Intergenic
958686191 3:97399392-97399414 TGCAATAAACATGATGTGGGGGG + Intronic
962725584 3:138223645-138223667 TTCAATAAACTTCAGGTCTGGGG - Exonic
965311198 3:167130583-167130605 TTGAATAAAGATTAGATGAGTGG + Intergenic
966001840 3:174958371-174958393 TGGAAAAAAGATCAGGTAGGTGG + Intronic
966106430 3:176340918-176340940 TTGGATAAACATCCGGTAGTGGG + Intergenic
968929223 4:3569559-3569581 ATAAATAACCACCAGGTGGGAGG + Intergenic
976291591 4:83423956-83423978 TTCAAAAAAGGTCAGGTGGGGGG + Intronic
977658049 4:99546494-99546516 CTGAATAAACATCTTTTGGGAGG - Intergenic
977759593 4:100717449-100717471 TTGAATAAAATTCAGGTAGTTGG - Intronic
987091835 5:14514747-14514769 TTGAAAAAAAATAAAGTGGGGGG - Intronic
989559834 5:42837382-42837404 ATGAACAAACTTCAGATGGGAGG + Intronic
989762050 5:45027630-45027652 ATGAGTAAACATCTGGTTGGTGG - Intergenic
990649378 5:57880936-57880958 GTGAAGAAACAGCAGCTGGGAGG - Intergenic
993292237 5:86088538-86088560 TTAAATAAACCTGATGTGGGAGG - Intergenic
993574913 5:89588877-89588899 TTCAGTAAATATCAGTTGGGTGG - Intergenic
994143420 5:96366721-96366743 TTGAAAAAAGATTAGGTGAGTGG - Intergenic
994673000 5:102784855-102784877 GTGCATAAACACCAGGTGAGTGG + Intronic
997309049 5:132864614-132864636 TTAAATAAATTTCAGGTGTGTGG + Exonic
997372147 5:133368893-133368915 CTGAATAAAGATCAGCTGGCAGG + Intronic
1003445348 6:6178629-6178651 TGGGAAGAACATCAGGTGGGTGG + Intronic
1004961602 6:20796537-20796559 TTGAATAAGAATAAGGTTGGAGG + Intronic
1007507178 6:42344725-42344747 TTGAGCAAGCATCTGGTGGGGGG - Intronic
1007543355 6:42670887-42670909 TTAAATAAACTTCAGGAGGCCGG + Intronic
1010351540 6:74880911-74880933 TTGGATAAACACCAGGAGGCTGG + Intergenic
1012243357 6:96898448-96898470 TTGAAAATGCATCAGGCGGGGGG - Intergenic
1013608075 6:111769050-111769072 TTTAAAAAACTTCAGGTGTGGGG - Intronic
1016667463 6:146658481-146658503 TTGTCTAAACTTGAGGTGGGAGG + Intronic
1017023938 6:150165258-150165280 TTCAATAAATATCAGCTGGTTGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022704797 7:32792328-32792350 TTGAAAAATCATAATGTGGGAGG + Intergenic
1022910132 7:34892931-34892953 TTGAAAAATCATAATGTGGGAGG + Intergenic
1023084755 7:36559121-36559143 TTGAATAAAGAAAATGTGGGAGG - Intronic
1028608608 7:92682796-92682818 TTGACTAAAGATCATGTTGGTGG - Intronic
1032173620 7:129606522-129606544 TTGATTAAACTTCTGGTGGCTGG + Intergenic
1032846843 7:135758595-135758617 TTGAAAGAACAAGAGGTGGGTGG + Intergenic
1032989775 7:137380806-137380828 TTTAAAAAAAATCTGGTGGGAGG + Intergenic
1033232100 7:139607711-139607733 TTGAATCAAAATTATGTGGGAGG + Intronic
1034920254 7:155073643-155073665 CTGAATAAACATCAGGGGAGAGG - Intronic
1037064563 8:14561461-14561483 TTGAATTAACATCAAAAGGGAGG - Intronic
1037176671 8:15955137-15955159 TTCAATAAACATCAAGTAGGAGG - Intergenic
1040411014 8:47154005-47154027 TTGAAAAAACATTAGATGAGTGG + Intergenic
1040825358 8:51614022-51614044 TGGCACAACCATCAGGTGGGAGG - Intronic
1042298462 8:67249040-67249062 ATGAATAAACATTGGCTGGGTGG - Intronic
1045930643 8:107621909-107621931 ATGAATTAACATCAGTTTGGTGG + Intergenic
1046834553 8:118785343-118785365 TTGAAAAAAAATCAGCTGTGTGG + Intergenic
1048251247 8:132868514-132868536 TTGAATAAACGGCACGTGTGGGG + Intronic
1050152267 9:2628629-2628651 TTAAATTGACATCAGGTGAGAGG + Intronic
1051036391 9:12751491-12751513 TTGAATAAACATGAAGAGAGTGG + Intergenic
1051521317 9:17992049-17992071 CAAAATAAACATCAGGTAGGTGG - Intergenic
1052161501 9:25266071-25266093 CTAAATAAACAACTGGTGGGAGG - Intergenic
1053803921 9:41782996-41783018 ATAAATAACCACCAGGTGGGAGG + Intergenic
1054141360 9:61532461-61532483 ATAAATAACCACCAGGTGGGAGG - Intergenic
1054192225 9:61994494-61994516 ATAAATAACCACCAGGTGGGAGG + Intergenic
1054461051 9:65462897-65462919 ATAAATAACCACCAGGTGGGAGG - Intergenic
1054646181 9:67594197-67594219 ATAAATAACCACCAGGTGGGAGG - Intergenic
1055582399 9:77720915-77720937 TGGGAAAAACATCAGGAGGGAGG + Exonic
1059870811 9:118572646-118572668 TTGAAAAAACATCAATTTGGGGG + Intergenic
1061028808 9:128067548-128067570 GTGAATAAAGGTTAGGTGGGCGG - Intronic
1192863310 X:75102657-75102679 TTGGATAAATATCAGGTAGTGGG + Intronic
1194246342 X:91516622-91516644 TTGATTACACATCAGGTAAGTGG - Intergenic
1197067200 X:122247517-122247539 TTGAATTAACATAAGAGGGGTGG - Intergenic
1200565307 Y:4757870-4757892 TTGATTACACATCAGGTAAGTGG - Intergenic
1201650709 Y:16282921-16282943 TTGGATAAATATCCAGTGGGTGG + Intergenic
1201718048 Y:17067834-17067856 TTCAATAAACAACAGGTAAGTGG - Intergenic