ID: 902512797

View in Genome Browser
Species Human (GRCh38)
Location 1:16975373-16975395
Sequence CAGTGGGATTGGGTGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 325}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902512797_902512814 28 Left 902512797 1:16975373-16975395 CCCACTTCCACCCAATCCCACTG 0: 1
1: 0
2: 1
3: 30
4: 325
Right 902512814 1:16975424-16975446 AGCCCGGACAGAACCTGGCACGG 0: 1
1: 1
2: 0
3: 8
4: 115
902512797_902512811 12 Left 902512797 1:16975373-16975395 CCCACTTCCACCCAATCCCACTG 0: 1
1: 0
2: 1
3: 30
4: 325
Right 902512811 1:16975408-16975430 CAGAACCTGGCACGGGAGCCCGG 0: 2
1: 0
2: 1
3: 23
4: 233
902512797_902512807 4 Left 902512797 1:16975373-16975395 CCCACTTCCACCCAATCCCACTG 0: 1
1: 0
2: 1
3: 30
4: 325
Right 902512807 1:16975400-16975422 AGCCCAGACAGAACCTGGCACGG 0: 1
1: 1
2: 0
3: 15
4: 249
902512797_902512806 -1 Left 902512797 1:16975373-16975395 CCCACTTCCACCCAATCCCACTG 0: 1
1: 0
2: 1
3: 30
4: 325
Right 902512806 1:16975395-16975417 GGGATAGCCCAGACAGAACCTGG 0: 1
1: 0
2: 2
3: 8
4: 115
902512797_902512815 29 Left 902512797 1:16975373-16975395 CCCACTTCCACCCAATCCCACTG 0: 1
1: 0
2: 1
3: 30
4: 325
Right 902512815 1:16975425-16975447 GCCCGGACAGAACCTGGCACGGG 0: 2
1: 1
2: 0
3: 5
4: 138
902512797_902512813 23 Left 902512797 1:16975373-16975395 CCCACTTCCACCCAATCCCACTG 0: 1
1: 0
2: 1
3: 30
4: 325
Right 902512813 1:16975419-16975441 ACGGGAGCCCGGACAGAACCTGG 0: 2
1: 0
2: 1
3: 4
4: 79
902512797_902512808 5 Left 902512797 1:16975373-16975395 CCCACTTCCACCCAATCCCACTG 0: 1
1: 0
2: 1
3: 30
4: 325
Right 902512808 1:16975401-16975423 GCCCAGACAGAACCTGGCACGGG 0: 1
1: 2
2: 2
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902512797 Original CRISPR CAGTGGGATTGGGTGGAAGT GGG (reversed) Intronic
900037414 1:427864-427886 CAGGAGGATTGGGTAGATGTTGG - Intergenic
900059042 1:663605-663627 CAGGAGGATTGGGTAGATGTTGG - Intergenic
900187162 1:1337881-1337903 CAGCGGGGTGGGGTGGAACTGGG + Intronic
900338285 1:2175532-2175554 GAGTGGGGTTGGGTGGATATTGG - Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900854964 1:5173569-5173591 CAGAGGGTTTGGGTGGGAGCCGG - Intergenic
900906614 1:5563998-5564020 TAGTGGGATGGGGTGGGGGTAGG + Intergenic
901810667 1:11765407-11765429 CAGTGGGCTGGGGTGAAAGCAGG - Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902919448 1:19657412-19657434 CTGTGGGAGGGGGAGGAAGTTGG + Exonic
903309435 1:22442715-22442737 CAGCTGCATTGGGTGGAGGTGGG + Intergenic
904076968 1:27850466-27850488 GGGTGGGATTGGGTGGGAATGGG + Exonic
904301524 1:29557541-29557563 GTGTGGGACTTGGTGGAAGTTGG + Intergenic
904829922 1:33299865-33299887 CAGGGGGATGGGGAGGGAGTGGG + Exonic
905013720 1:34763154-34763176 CAGTGGGATTTGGTGCCAGTGGG - Exonic
905684143 1:39896748-39896770 CATTGGGAGTGGGAGGAAGGGGG + Exonic
906756753 1:48325036-48325058 ATGTGGGATTGGGTGGGAATGGG - Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907325909 1:53638548-53638570 CTTTGGGATTGGGTGGCAGTGGG - Intronic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
907975991 1:59432033-59432055 CTGGTGGATTGGGTGGATGTGGG - Intronic
908522589 1:64958279-64958301 CACTTGGGTTGGTTGGAAGTAGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
912474425 1:109926611-109926633 CTGTGGGCTTGGGTGGGAGGGGG - Intronic
912716533 1:111987720-111987742 CAGTGCCATTGGCTGGAAATGGG - Intronic
913460619 1:119082633-119082655 GAGAGGGGTTGGGTGGGAGTGGG - Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917675352 1:177313644-177313666 CAGTGGGGATAAGTGGAAGTTGG + Intergenic
918048392 1:180954588-180954610 CGGAGGGATGGGGAGGAAGTGGG + Intergenic
920292944 1:204936687-204936709 CAATGGGCCAGGGTGGAAGTGGG - Intronic
921959860 1:221023240-221023262 CAGTGGGAATTGGTGGATGCTGG - Intergenic
922428877 1:225527105-225527127 AAGAGGGATTAGGTGAAAGTTGG - Intronic
922688113 1:227663892-227663914 CACTGGGCTTGGGTGGGAGTGGG - Intronic
923659373 1:235945177-235945199 CACTGGGATGGGATGGGAGTGGG + Intergenic
923723499 1:236487060-236487082 AAGTGGGCCTGGGTGGAAATGGG - Intergenic
924741209 1:246795123-246795145 GAGTGGGGTGGGGTGGAAGCCGG + Intergenic
1063113544 10:3056902-3056924 CAGTGGGATTAGCAGGAAGCGGG + Intergenic
1065739520 10:28784556-28784578 CCATGGGATTGGGGGGAAGGAGG - Intergenic
1068577179 10:58697790-58697812 CAGGGGGTGTGGGTGGAGGTTGG - Intronic
1068966052 10:62912989-62913011 CAGGAGGATTGGGTTAAAGTGGG - Intronic
1069281113 10:66654935-66654957 CTGTGGGATGGGGTGGAGTTGGG + Intronic
1070483198 10:76905367-76905389 CAGTGGCATTAGGAGGAAGCTGG + Intronic
1071432062 10:85613877-85613899 CAGTGGAATAGGGTGGGAGAGGG - Intronic
1071527139 10:86365423-86365445 GAGGGGGAGTGGGTGGGAGTTGG - Intronic
1071922988 10:90372470-90372492 CAGAGTCATTGGGTGGAGGTAGG - Intergenic
1072573910 10:96682414-96682436 CAGTGTCATTGGTTTGAAGTAGG - Intronic
1072987212 10:100151427-100151449 CAGAGGGCTTGGTTTGAAGTTGG - Exonic
1073900019 10:108209389-108209411 TAGGGGGATTGGGGGGAAGTTGG - Intergenic
1075270185 10:121042787-121042809 CAGTGCCTTTGGGTGAAAGTAGG - Intergenic
1076788976 10:132766941-132766963 CAGGGAGCTTGGGTGGGAGTTGG + Intronic
1076964140 11:65787-65809 CAGGAGGATTGGGTAGATGTTGG - Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1078080318 11:8199685-8199707 CAGCTGGACTGGGTGGGAGTGGG + Intergenic
1080885914 11:36368020-36368042 GAGTGGGAGTGGGTGTAAATAGG + Intronic
1081506439 11:43721905-43721927 TAGTGGCAAAGGGTGGAAGTAGG + Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1083913828 11:65727129-65727151 CAGTGGTATGGGGTGGGGGTGGG + Intergenic
1085254415 11:75164349-75164371 AAGTGGGAGTGGGTGGATATGGG - Intronic
1087662942 11:101009028-101009050 CAAGGGGATTGCTTGGAAGTAGG + Intergenic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1089639849 11:119840471-119840493 CAGTAGGATTTGGGGGAATTTGG + Intergenic
1089972424 11:122704871-122704893 AAGTGGCATTGGGTGAAAATAGG + Intronic
1090223562 11:125053471-125053493 CACTGGGATTGGTTCCAAGTTGG + Intergenic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1092138675 12:6167680-6167702 CACTGGGGATGGGTGGATGTGGG - Intergenic
1092173513 12:6388028-6388050 AAGTGGGATTGGGAGACAGTAGG - Intronic
1092791729 12:12076225-12076247 GGGTGGGATTGGATGGAATTGGG + Intronic
1092996959 12:13959605-13959627 CATTGGCATGGAGTGGAAGTGGG + Intronic
1093657633 12:21715108-21715130 CAGTGGGATTTGATGGTATTGGG + Intronic
1094168515 12:27466618-27466640 CAGAGGGCTGGGGTGGAAGAAGG + Intergenic
1094456538 12:30641382-30641404 TAGAGGGATAGGGTGGAAGCTGG + Intronic
1094664923 12:32510194-32510216 TAGTGGGAATGGGAAGAAGTGGG + Intronic
1096053560 12:48632032-48632054 CAGTGGGGTTTGGTGGGAGAGGG + Intergenic
1098876539 12:75871858-75871880 CAGTGGGAGTGGGAGGAGGGAGG - Intergenic
1100045283 12:90372638-90372660 TAATGGAATGGGGTGGAAGTGGG - Intergenic
1101969774 12:109304833-109304855 AAATGGGAGTGGTTGGAAGTGGG + Intronic
1102451281 12:113043794-113043816 CCCTGGGACTGGGTGGAATTTGG - Intergenic
1102595370 12:113988276-113988298 CAGTGAGATTGGATGCCAGTTGG + Intergenic
1104259252 12:127167384-127167406 ATGTGGGATAGGGTGGAAGAAGG + Intergenic
1104414977 12:128590550-128590572 CAGAGGAATCGGGTGGCAGTGGG - Intronic
1106157448 13:27171650-27171672 CGCTGTGATTGGGTGGAAGATGG - Exonic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106879405 13:34112933-34112955 CAGTGGGATGGGTAGGAAGCTGG - Intergenic
1107385742 13:39907053-39907075 TAGAGGTATTGGGTGGTAGTGGG - Intergenic
1111543217 13:89695899-89695921 CAGTGTGCTTGGGTGCAACTGGG - Intergenic
1111840968 13:93450526-93450548 GAGTGGTATTGTGTGGGAGTGGG - Intronic
1112104091 13:96221515-96221537 CAGTGGGATGGGGAGGAGGTAGG + Intronic
1114547522 14:23513518-23513540 CAGAGGGATGGAGTGGAAGAAGG + Intergenic
1115397636 14:32926578-32926600 CAGTGGGGTAAGGGGGAAGTGGG + Intergenic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1117963682 14:61186590-61186612 CAGTGGGGTGGGGTGGGGGTGGG - Intergenic
1118435577 14:65767956-65767978 TGGTGGTATTGGGTGGAAGTGGG - Intergenic
1118480539 14:66160786-66160808 CAGTGGACCTGGGTAGAAGTAGG + Intergenic
1118506116 14:66413767-66413789 CAGAGTGATTGGGTGGGTGTTGG - Intergenic
1118821534 14:69349276-69349298 CAGTGGGAGGGGGTGGGCGTGGG - Intronic
1120757994 14:88262236-88262258 GAGTGGGTTTTGGTGGAAGGCGG - Intronic
1120941488 14:89954581-89954603 CACAGGAAGTGGGTGGAAGTAGG - Exonic
1121158361 14:91709334-91709356 CAATGGGATTGGTTCAAAGTTGG + Intronic
1121392654 14:93589431-93589453 CTGGGGGATGGGGGGGAAGTTGG + Intronic
1121453257 14:94022862-94022884 CAGTGGGATTGGGGGGATTAGGG - Intergenic
1123102690 14:105816338-105816360 CAGTGGGCTTGGGAAGGAGTGGG - Intergenic
1123489163 15:20765960-20765982 CGGGGGCATTGGGTGGAAATGGG + Intergenic
1123545662 15:21335047-21335069 CGGGGGCATTGGGTGGAAATGGG + Intergenic
1124022824 15:25939592-25939614 CAGTGGGGTGGGGCGGAAGGAGG + Intergenic
1126745031 15:51817649-51817671 CAGTGGGATGAGGTGGAGTTTGG - Intergenic
1127891990 15:63260452-63260474 CAGTGGCATTTAGTGGAAATAGG + Intronic
1128758250 15:70197589-70197611 CAGTGGGGGTAGGTGGGAGTCGG + Intergenic
1130249176 15:82285707-82285729 CAGAGAGATAGGGTGGAAATGGG - Intergenic
1130854276 15:87827111-87827133 CAGTGGGGTTGGATGGGAATTGG + Intergenic
1132013964 15:98299931-98299953 CTGTGGGATGGGCTGGAGGTGGG - Intergenic
1132444411 15:101899396-101899418 CAGGAGGATTGGGTAGATGTTGG + Intergenic
1202954005 15_KI270727v1_random:62317-62339 CGGGGGCATTGGGTGGAAATGGG + Intergenic
1132464963 16:73043-73065 TAGTGGGATTGGGTGAGTGTGGG - Intronic
1133523084 16:6577741-6577763 CAATGGGATTTGGTGATAGTAGG - Intronic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1136067347 16:27768073-27768095 CAGTGGGATGAGGTGGGGGTGGG + Intronic
1141606921 16:85159063-85159085 CAGTGGGATGGGGTGGGGGCAGG - Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144537063 17:16100911-16100933 CAGTGGGATGTGGTAGAAGAAGG - Intronic
1144725729 17:17501411-17501433 CAGTGGGGATGGGTGTTAGTTGG + Intergenic
1146255225 17:31388453-31388475 AAGTGGAATTGGGTGGGGGTAGG + Intergenic
1146518976 17:33511587-33511609 CAGTGAGACAGGGAGGAAGTGGG - Intronic
1146931845 17:36783230-36783252 CAGTGGGAATGCCTGGAATTTGG - Intergenic
1147495575 17:40912059-40912081 CAGTGTGGATGGGTGGAAGAGGG + Intergenic
1147610553 17:41799472-41799494 CACTGGGACTGGCTGGGAGTAGG + Intergenic
1147952908 17:44116976-44116998 GCGTGGCATTGGGTGGGAGTGGG - Intronic
1148861289 17:50605659-50605681 CAGTGGGAAAGGGTGGAGGCGGG - Intronic
1149980611 17:61308363-61308385 GAGGGGGATGGGGTGGGAGTGGG - Intronic
1150306202 17:64087461-64087483 TTGTGTGACTGGGTGGAAGTGGG - Intronic
1152132692 17:78486585-78486607 CAGCAGAATTGGGTGGAGGTAGG - Intronic
1152150516 17:78597314-78597336 CAGAGGGATGGGGTGGCAGCTGG - Intergenic
1152325650 17:79634340-79634362 TAGAGGGTGTGGGTGGAAGTGGG - Intergenic
1153167084 18:2274250-2274272 CAGTGGCATTGGATGGATGGGGG + Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1157467723 18:47961856-47961878 TGGGGGGATTGGGTGGAAATGGG - Intergenic
1157688754 18:49664088-49664110 CACTGTGAGTGGCTGGAAGTAGG - Intergenic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160640943 19:135419-135441 CAGGAGGATTGGGTAGATGTTGG - Intergenic
1161607169 19:5221543-5221565 CAGTGGGATTGGGGCTCAGTCGG - Intronic
1161984479 19:7646202-7646224 CAGGGGGATTGAGGGGAAGGAGG - Intronic
1163166964 19:15505249-15505271 CAGTGGGGTGAGGTTGAAGTGGG - Intergenic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163494336 19:17636791-17636813 CAGTTGAATTGGGTTGAATTGGG - Intronic
1163546719 19:17945093-17945115 CAGTGGGCTCGGGTAGAGGTTGG + Intergenic
1164304341 19:23991088-23991110 CAAGGGGAGTGGGTGGATGTGGG + Intergenic
1164492752 19:28729476-28729498 CAGTGCTGTGGGGTGGAAGTTGG - Intergenic
1168093920 19:54103510-54103532 GAGTTGGCTTGGGTGGAGGTGGG + Intronic
925560983 2:5195201-5195223 CAGTGAGATTGGATACAAGTTGG + Intergenic
926591198 2:14742070-14742092 CAGTGGGATGAGGTGTAGGTAGG - Intergenic
926909668 2:17840351-17840373 CAGCAGAAGTGGGTGGAAGTGGG - Intergenic
927067531 2:19488485-19488507 CAAAGGTATTGGGAGGAAGTGGG + Intergenic
927089023 2:19696403-19696425 CAGTGGGAAGTGGTGGCAGTGGG + Intergenic
928498592 2:31862924-31862946 AAATGGGATTGGGGGGAGGTGGG + Intergenic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
929732965 2:44515299-44515321 CAGTGGGACTGGGAGGAGTTAGG + Intronic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933443149 2:82340638-82340660 CCACAGGATTGGGTGGAAGTTGG - Intergenic
935300122 2:101686566-101686588 AAGTGGGGTGGGGTGGGAGTTGG + Intergenic
935886712 2:107628456-107628478 CCATGGGTTTGGGGGGAAGTGGG - Intergenic
937025045 2:118690763-118690785 CAGGGGGATTGAGGAGAAGTTGG - Intergenic
938276239 2:130026808-130026830 CAGTAAGATTTGTTGGAAGTGGG - Intergenic
939417952 2:141924844-141924866 CTATGGCAGTGGGTGGAAGTGGG + Intronic
940761408 2:157742888-157742910 CAGTGGGATAGGGTGGAGGTTGG - Intronic
941805832 2:169711662-169711684 CTGAGGGAGTGGGTGGATGTGGG + Intronic
941995973 2:171602431-171602453 CTGAGGGATTGGCTGGAAGATGG - Intergenic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
944675762 2:202033649-202033671 CCTTCGGATTGGGCGGAAGTCGG - Intergenic
948885076 2:240878324-240878346 CAGTGGGCTGGGGTGGGAGCAGG - Intronic
1168805784 20:671636-671658 CAGAGGGAGTGAGAGGAAGTGGG + Intronic
1170084182 20:12510677-12510699 CAGTGGGACTTGGTGGAAAATGG + Intergenic
1171443766 20:25188296-25188318 CAGTGGGGTAGGGTGGAGGGTGG - Intergenic
1172855892 20:38002114-38002136 CAGTGGGGTGGGGTAGAAGTGGG - Intronic
1173009356 20:39167780-39167802 CAGTGGGTTAGGGAGGAGGTAGG - Intergenic
1173076260 20:39822705-39822727 GAGGGGGATTGGGTGAAAGTGGG - Intergenic
1173581945 20:44153402-44153424 CAGTGGCATTGGATGGACCTAGG - Intronic
1174090055 20:48039580-48039602 AAGGGGGGTTGGGTGGAAGTGGG + Intergenic
1174888993 20:54369290-54369312 CTGTGGGATTGGATGGATCTCGG + Intergenic
1175328753 20:58148236-58148258 ATGTGGCTTTGGGTGGAAGTGGG - Intergenic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1179044003 21:37829251-37829273 CAGTGAGATGGGGTGGCAGTTGG + Intronic
1179184755 21:39076798-39076820 GAGTGGGGTTGGGTGTAAGCAGG - Intergenic
1179373405 21:40827966-40827988 CAGAGGAATTGGATGGAAGAAGG + Intronic
1180206416 21:46264153-46264175 CAGAGGGACTGTGAGGAAGTTGG - Exonic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182299440 22:29329533-29329555 CACTGTGAATGTGTGGAAGTGGG + Intronic
1183454115 22:37912234-37912256 CAGTGGGATGGGGTGACTGTGGG - Intronic
1183988929 22:41585067-41585089 CAGTTGGAGTGGGTGGGAGGTGG + Intronic
1184153173 22:42649916-42649938 CACTGGGATGGGGTGGGAGTGGG - Intergenic
1184645205 22:45891549-45891571 CTGAGGGATGGGGTGGAAGCGGG - Intergenic
949606800 3:5662267-5662289 CAGTGGGGTGGGGTGGAAGGAGG - Intergenic
949949163 3:9215221-9215243 CTTTGGGATTGGGTGGAAAAAGG - Intronic
950375587 3:12569620-12569642 CAGTGGGAGATGATGGAAGTAGG + Intronic
950671765 3:14531628-14531650 CAGTGGCCTTGGGAGGAGGTAGG + Intronic
950950332 3:16992182-16992204 CAGAGGGATTGGGTGGTGATCGG + Intronic
951565601 3:24009867-24009889 TAGGGGGATTGGGGGGATGTTGG - Intergenic
954101048 3:48372875-48372897 CAGCGGGCTTGGGGGGCAGTGGG - Intronic
954695406 3:52422048-52422070 CAGTGGGAGAGGGTTGAAGCAGG - Intronic
955095664 3:55795483-55795505 CAGTGGGATTGTTTGCAATTAGG + Intronic
960148308 3:114226454-114226476 CAGTGGAGGTGGGTGAAAGTGGG + Intergenic
961684494 3:128620338-128620360 CAGGCAGATTGGGTGGTAGTGGG - Exonic
963469835 3:145726442-145726464 CAGTGGGCTATGGTGTAAGTTGG - Intergenic
964282309 3:155079979-155080001 CAGTGGGATTCGGGAGAAGTTGG - Intronic
966578074 3:181525924-181525946 AAGTGGGTTGGGGTGGAAGCAGG - Intergenic
966890819 3:184406326-184406348 CAGTGGGTGTGGGTGGGGGTGGG - Intronic
966941767 3:184752463-184752485 GAGAGGGGTTGGGTGGAAGCTGG + Intergenic
968573383 4:1353957-1353979 CAGGGGGCTTGGGAGGAAGCTGG - Intronic
968577103 4:1372549-1372571 CAATGTGATGGGGTGGAAGGAGG - Intronic
968819362 4:2837922-2837944 CAGTGAGAATGGCTGGAAGATGG - Exonic
969360496 4:6660360-6660382 CACTGGGACTGGGAGGAAGAAGG + Intergenic
970104104 4:12560793-12560815 CAGTGAGAGTGGGAGAAAGTGGG + Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971538074 4:27779949-27779971 CAGTAGGATTGGGTGTTTGTTGG + Intergenic
971978755 4:33726237-33726259 CAACGGGATGGGGTGGAAGTTGG - Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974886373 4:67822929-67822951 CAGTGGGATTAAGTGTAAATAGG - Intronic
975139102 4:70902344-70902366 CAGGGGGAGGGGGCGGAAGTGGG - Intronic
975528693 4:75378338-75378360 CATTGGGACTGGTTGGCAGTGGG + Intergenic
976127508 4:81849658-81849680 CAGTGGATTTGGGCTGAAGTTGG - Intronic
976149741 4:82079952-82079974 CCCTGGGGTTGGGTGGAAGGTGG - Intergenic
980101159 4:128542826-128542848 GGGTGGGATTGTGTGGAAGCAGG - Intergenic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981407778 4:144391915-144391937 CAGTGGGACTCCGTGGACGTAGG - Intergenic
984941983 4:184940953-184940975 CAGTAGGCATAGGTGGAAGTGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
987997396 5:25302601-25302623 CAGGGGGATTGGGTTGATGTTGG - Intergenic
991422607 5:66456370-66456392 GAGTGGGGTTGGGGGGTAGTGGG - Intergenic
992441777 5:76803392-76803414 CATTGAGAGTGGGTGGAAGTGGG + Intergenic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993636032 5:90344756-90344778 CAGAGGTATTGGGTGGATGCTGG + Intergenic
994475053 5:100257147-100257169 CAGGGGGAGTGAGCGGAAGTGGG - Intergenic
995019309 5:107349038-107349060 TAGTGGGGTTAGGGGGAAGTGGG - Intergenic
995047492 5:107669298-107669320 CACTGGGCTGGAGTGGAAGTTGG - Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997979238 5:138458838-138458860 AAGAAGGAGTGGGTGGAAGTGGG - Intergenic
999342120 5:150781204-150781226 CATTGGAATTGGGGGGAACTAGG + Intronic
1000380894 5:160628429-160628451 CAGTGGGAGTGTGTGTATGTGGG + Intronic
1000849777 5:166325645-166325667 CAGGGTGATTGGCTGGTAGTTGG - Intergenic
1001332866 5:170774360-170774382 TAGTGGGGTTGGGGGGATGTAGG + Intronic
1001375405 5:171251779-171251801 CTCTGTGATTGGGTGGAAGATGG + Intronic
1001569300 5:172719662-172719684 CAGTTGGCTTGGGTGGGAGTTGG + Intergenic
1001821853 5:174716558-174716580 TAGTGGGGGTGGGTGGGAGTGGG + Intergenic
1002182607 5:177438714-177438736 TAGTGGGTGTGAGTGGAAGTGGG + Intronic
1002736407 5:181391002-181391024 CAGGAGGATTGGGTAGATGTTGG + Intergenic
1002748290 6:83822-83844 CAGGAGGATTGGGTAGATGTTGG - Intergenic
1002773003 6:305221-305243 CAAGGGGCTTGGGTGCAAGTGGG - Intronic
1003528673 6:6919870-6919892 CAGAAGCACTGGGTGGAAGTAGG - Intergenic
1003763814 6:9213597-9213619 CATTGGGATTGGATGGAAAGTGG + Intergenic
1004478289 6:15994679-15994701 CAGTGGGCTTGGGAGGGAGATGG + Intergenic
1005036634 6:21561373-21561395 CAGTGGGCAGGGCTGGAAGTGGG - Intergenic
1006116665 6:31779388-31779410 CAGTGGGATGGGGCGGACATGGG + Intronic
1007733266 6:43964871-43964893 AGGTGGGAGTGGGTGGACGTGGG - Intergenic
1008318755 6:50080612-50080634 CAGAGGGTTGGGGTGGAAGGAGG - Intergenic
1008861191 6:56151789-56151811 CAGTGGGAGTGGGTAGGTGTGGG - Intronic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1010670019 6:78676080-78676102 CATTGGGATTGGTTGGAAAGTGG + Intergenic
1014229069 6:118882069-118882091 CGTTGGGATTGGGTGGAGGAAGG - Intronic
1014320056 6:119916304-119916326 CAGTGGGATAGGTAGGAATTGGG - Intergenic
1014614267 6:123582854-123582876 GAGTGGGATTGGGGGGGCGTGGG + Intronic
1014786817 6:125628720-125628742 CAGTGGTCTTGGGTGGAAAGAGG + Intergenic
1015828722 6:137344659-137344681 CAGTGGGGTTGGGGGTATGTTGG + Intergenic
1017044909 6:150338061-150338083 CAGGGGGCTTAGGTGGGAGTGGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017981514 6:159404474-159404496 CAGAGGCATGGGGTGGAGGTGGG + Intergenic
1018293648 6:162319957-162319979 CAGGGTAAGTGGGTGGAAGTAGG - Intronic
1018414867 6:163592005-163592027 CAGTGGTTTTGGGAGGAATTAGG - Intergenic
1018719688 6:166563255-166563277 CGGTGGGATGGGGTGGAGCTGGG + Intronic
1018953535 6:168393538-168393560 CAGAAGGGATGGGTGGAAGTGGG + Intergenic
1019241505 6:170666531-170666553 CAGGAGGATTGGGTAGATGTTGG + Intergenic
1022008610 7:26290122-26290144 CAGTGGGATTGGGTAAAAACTGG - Intergenic
1022526039 7:31037966-31037988 CGGTGGGGTTGGGTGGGCGTGGG + Intergenic
1022854347 7:34300688-34300710 AAGTGGGATTGGGGCGATGTGGG + Intergenic
1025790599 7:64683969-64683991 CTGTCAGATTGGATGGAAGTAGG - Intronic
1025978981 7:66392430-66392452 CAGTGGGTATGGGTGGATTTTGG + Intronic
1026737199 7:72956489-72956511 CAGTGGAGTTCGGTTGAAGTTGG + Intergenic
1027106533 7:75408579-75408601 CAGTGGAGTTCGGTTGAAGTTGG - Intronic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1030054588 7:105572194-105572216 CAGGGGGATTGGGGAGATGTTGG - Intronic
1030061168 7:105622520-105622542 AGGTGGGAGTGGGTGGTAGTTGG - Intronic
1031692905 7:124812872-124812894 CAGTGCTCTTGGGGGGAAGTTGG + Intergenic
1031915970 7:127563558-127563580 CAGTGTGATTGGCAGGGAGTTGG + Intergenic
1032653760 7:133906026-133906048 CAGTGTGGTTGGGTAGAAATGGG + Intronic
1032900141 7:136297809-136297831 CAGTTGGAGTGGGTTGAAGAGGG + Intergenic
1033138147 7:138801717-138801739 CTGTTGCATTGGGTGGAAGTTGG - Intronic
1033722057 7:144071149-144071171 CAGGGGTATTGGGAGGAGGTGGG - Intergenic
1034079486 7:148262989-148263011 GAGTGGGATTGTGGGGAAGGTGG - Intronic
1034203974 7:149299724-149299746 CAGGGAGATTGGGTGGGGGTGGG + Intergenic
1035506611 8:141565-141587 CAGGAGGATTGGGTAGATGTTGG - Intergenic
1036289295 8:7473227-7473249 CAGTGGGAGTGTGTGGCAGGTGG + Intronic
1036332186 8:7838305-7838327 CAGTGGGAGTGTGTGGCAGGTGG - Intronic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1038539119 8:28376647-28376669 TAGTGGGTTTGGGGGAAAGTTGG - Intronic
1038832244 8:31074283-31074305 CAGTTGGTTTGGGAGGAAATGGG + Intronic
1039440959 8:37595067-37595089 CAGAGGGGCTGGGTGGAAGGAGG + Intergenic
1039604739 8:38871194-38871216 AAGGGTGATTGGGTGGGAGTAGG - Intergenic
1039804208 8:40984793-40984815 CAGTGGATCTGGGAGGAAGTAGG - Intergenic
1041118232 8:54561047-54561069 CAGTGTAAATGGGTGGAAGTGGG + Intergenic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1041723593 8:60998291-60998313 TAGTGGGATAGGCAGGAAGTAGG - Intergenic
1041944264 8:63424180-63424202 CACTGGGACTGGTTGGAAGGTGG + Intergenic
1042604623 8:70533097-70533119 GAGTGGGAGTGGGTGACAGTAGG + Intergenic
1043321380 8:78990953-78990975 GAGTGGCATTGGGTGCAAGGTGG - Intergenic
1043404433 8:79916148-79916170 CAGCCAGTTTGGGTGGAAGTGGG + Intergenic
1045372077 8:101534417-101534439 CAAGGGGATGGGGTGGGAGTAGG + Intronic
1045560917 8:103261713-103261735 CAGAGGGATGGGGTGGGAGTGGG + Intergenic
1045618817 8:103951421-103951443 CATTGGGACTGCTTGGAAGTGGG + Intronic
1046011267 8:108551053-108551075 CACTGGAATTTGGTGGAAGTTGG + Intergenic
1049540614 8:143207212-143207234 GAGTGGGCTTGGGTGGAGGGTGG - Intergenic
1050039575 9:1475312-1475334 CAGTGGGATGAGGAGCAAGTGGG - Intergenic
1050403158 9:5278646-5278668 CAGGTGGATTGGTTGCAAGTAGG - Intergenic
1053361069 9:37486856-37486878 CCCTGGGAGTGGGTGGATGTGGG + Intronic
1055283161 9:74697875-74697897 AGGTGGGATGGGTTGGAAGTAGG + Intergenic
1056665126 9:88575612-88575634 AAGTGGGGTTGGGAGGAAGGTGG + Intronic
1056703907 9:88935243-88935265 CAGTGGAATTAGGAGGAAGGAGG - Intergenic
1056713365 9:89009397-89009419 CAGTAGGATTGGGAGTGAGTGGG - Intergenic
1057749945 9:97784341-97784363 TAGTGGGAATGGCTGGAAGGCGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1060024783 9:120161908-120161930 GCGTGGGATTGGGAGGAGGTGGG + Intergenic
1061248172 9:129412122-129412144 GGGTGGGATGGGGTGGGAGTGGG + Intergenic
1061257851 9:129463118-129463140 CAGTGGGGTGGGGTGGGGGTGGG + Intergenic
1061279077 9:129586730-129586752 CAGTGGAGTTGGGTAGGAGTGGG + Intergenic
1061617930 9:131792389-131792411 CAGTGGCATTCGTGGGAAGTGGG - Intergenic
1061887636 9:133600581-133600603 CAGTGGGATGGGGTGGGAGCAGG + Intergenic
1203601697 Un_KI270748v1:15765-15787 CAGGAGGATTGGGTAGATGTTGG + Intergenic
1185794579 X:2954155-2954177 CATTGGTCTTGGGTGGAACTTGG + Intronic
1186067760 X:5784692-5784714 AAGTGGGATTTAGTGGCAGTGGG - Intergenic
1186163865 X:6806070-6806092 CAGTGGGAATGGATGGAGATAGG + Intergenic
1186317191 X:8383831-8383853 CAGTGGCAGTGGCTGGATGTTGG + Intergenic
1186641084 X:11456579-11456601 CAGTGGCAAGGGGTGGAGGTGGG + Intronic
1187374674 X:18741130-18741152 AATGGGGAGTGGGTGGAAGTGGG + Intronic
1187407834 X:19020080-19020102 CAGAGGGATTGGGGAGATGTTGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187953680 X:24494862-24494884 CAGTGGGATTGGTTCAGAGTTGG + Exonic
1189351117 X:40276545-40276567 CAGTGGGGGTGGGAGGAATTAGG + Intergenic
1190432833 X:50394232-50394254 CAGTGGGGGTGGGAGGAGGTGGG + Intronic
1191930620 X:66367350-66367372 CAGTGTGTTTGGGTTGATGTAGG - Intergenic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1192246615 X:69378364-69378386 AAGTGGGATTGGGTGGACTCTGG - Intergenic
1193584692 X:83306503-83306525 CAGTTGGTTTGGGAGGAATTTGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1194133732 X:90112615-90112637 CACTATGATTGGGTGGAAGATGG + Intergenic
1195954307 X:110313133-110313155 CAGTGTGCTTGGGAGGAATTGGG - Intronic
1197904357 X:131408700-131408722 CAGAGGGATTGGTTGAAAGATGG + Intergenic
1199302955 X:146233968-146233990 CATTGGGATTGGTTGGAAAGTGG - Intergenic
1199705534 X:150421862-150421884 CAGTGGGGTTGGGTGGAGCTTGG - Intronic
1199710241 X:150463893-150463915 TAGGGGGATGGAGTGGAAGTAGG - Intronic
1199924484 X:152448581-152448603 CAGTGGGACTGGGTGGAAAGGGG - Intronic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1200479514 Y:3682727-3682749 CACTATGATTGGGTGGAAGATGG + Intergenic
1201604755 Y:15772445-15772467 GAGTGGGATTGGGGCGATGTGGG - Intergenic
1201987505 Y:19985718-19985740 CATTGGGACTGGGTGGACGGTGG - Intergenic