ID: 902515164

View in Genome Browser
Species Human (GRCh38)
Location 1:16986160-16986182
Sequence GGGTCCAGTTGGTGGCTCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902515154_902515164 20 Left 902515154 1:16986117-16986139 CCTCAGGGATGTGGGAGGTGGTG 0: 1
1: 0
2: 1
3: 39
4: 377
Right 902515164 1:16986160-16986182 GGGTCCAGTTGGTGGCTCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 207
902515152_902515164 24 Left 902515152 1:16986113-16986135 CCAACCTCAGGGATGTGGGAGGT 0: 1
1: 0
2: 0
3: 22
4: 237
Right 902515164 1:16986160-16986182 GGGTCCAGTTGGTGGCTCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902515164 Original CRISPR GGGTCCAGTTGGTGGCTCAG AGG Exonic