ID: 902517489

View in Genome Browser
Species Human (GRCh38)
Location 1:16997140-16997162
Sequence AGTGCTGAAGACGGCACTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902517489_902517496 6 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517496 1:16997169-16997191 CTCTCTCCTGGTGGGGAACGTGG 0: 1
1: 1
2: 1
3: 15
4: 173
902517489_902517492 -6 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517492 1:16997157-16997179 AGCACTGGAATGCTCTCTCCTGG 0: 1
1: 0
2: 1
3: 23
4: 187
902517489_902517498 13 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517498 1:16997176-16997198 CTGGTGGGGAACGTGGTGTGAGG 0: 1
1: 0
2: 3
3: 22
4: 324
902517489_902517495 -1 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517495 1:16997162-16997184 TGGAATGCTCTCTCCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 215
902517489_902517493 -3 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517493 1:16997160-16997182 ACTGGAATGCTCTCTCCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 164
902517489_902517494 -2 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517494 1:16997161-16997183 CTGGAATGCTCTCTCCTGGTGGG 0: 1
1: 0
2: 1
3: 27
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902517489 Original CRISPR AGTGCTGAAGACGGCACTGC CGG (reversed) Exonic
900312558 1:2041226-2041248 AGGGCTGAGGACTGCCCTGCTGG + Intergenic
901924964 1:12560367-12560389 AGCTCTGCAGAAGGCACTGCTGG - Intergenic
902398653 1:16145633-16145655 GGTCCTGGAGAGGGCACTGCTGG - Intronic
902517489 1:16997140-16997162 AGTGCTGAAGACGGCACTGCCGG - Exonic
915146625 1:153799547-153799569 AGTGCACCAGACGGCAGTGCTGG + Intergenic
916074985 1:161195487-161195509 AGTGATGAAGCGGGCACTGCAGG + Exonic
920649893 1:207829276-207829298 TATGATGAAGAAGGCACTGCTGG - Intergenic
922161668 1:223082738-223082760 AGTGCTGTAGAAGGAGCTGCAGG + Intergenic
922984598 1:229856500-229856522 AGTGCTCAAAAGGGCCCTGCTGG + Intergenic
923014375 1:230114530-230114552 TGGGCTGAACCCGGCACTGCTGG + Intronic
1068204183 10:53827468-53827490 GGTGCAGGAGCCGGCACTGCTGG + Exonic
1073538441 10:104298421-104298443 AGAGCTGAAGTCGGAAGTGCAGG - Intronic
1075204028 10:120431223-120431245 AGGGCTGAAGCCCGTACTGCAGG - Intergenic
1076843720 10:133058875-133058897 ACTGCTAAAGCCGGCACTCCCGG + Intergenic
1076981152 11:205530-205552 AGTGCTGAAGGAGACACTGCAGG + Intronic
1077414775 11:2419999-2420021 AGTGGTGAAGGAGGCACAGCTGG - Intronic
1087041842 11:93808898-93808920 AGTGCTGAAGGCAGTAGTGCTGG - Intronic
1087246497 11:95844469-95844491 AGTTCTGAAGCTGGCCCTGCTGG - Intronic
1087762338 11:102114147-102114169 AGTACTGATGCAGGCACTGCAGG + Exonic
1088498800 11:110460815-110460837 AGTGCTGGATTCTGCACTGCTGG + Intronic
1089736748 11:120554947-120554969 TGTGGTGAGGACGGCACTGGAGG + Intronic
1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG + Intronic
1091923518 12:4324566-4324588 AGTGGTGAAGACGCACCTGCGGG - Intronic
1095489360 12:42717025-42717047 AGTGCTGCAGTGGCCACTGCTGG + Intergenic
1098444867 12:70556107-70556129 AGTTCTGAGGCCGGCAATGCAGG + Exonic
1100844721 12:98645790-98645812 AGTGGGGAGGGCGGCACTGCCGG - Exonic
1101976760 12:109366171-109366193 AGTTCTGAAGAAGGCACATCTGG - Intronic
1102151227 12:110689903-110689925 TGTGCAGAAGACGGCTTTGCAGG - Intronic
1103458852 12:121088110-121088132 AGTGATGAAGAAGACACTCCAGG - Intergenic
1108249560 13:48551059-48551081 GGTGCTGAGGACAGCTCTGCAGG + Intergenic
1109069563 13:57747431-57747453 AGTGCTCATGATGGCACTGATGG + Intergenic
1112394218 13:99013755-99013777 AGTGCTGGAGACGGGGCTGGAGG + Intronic
1113757440 13:112822974-112822996 GGTGCTGCTGACGGCACTGGTGG + Intronic
1121576654 14:94994394-94994416 AGTGGTGAAGAAGGTACAGCAGG - Intergenic
1122860081 14:104578618-104578640 TGTACTGAAGACGGCAGTGAGGG + Intronic
1122968686 14:105143764-105143786 GGTGGTGAAGTCGCCACTGCAGG - Intronic
1202828899 14_GL000009v2_random:4714-4736 CATACTGAAGACTGCACTGCGGG + Intergenic
1124553306 15:30702802-30702824 AGTAATGAAGACGGCAGTACTGG - Intronic
1125968169 15:43890901-43890923 GGAGCTGAAGAGGGCACAGCGGG + Intronic
1127914926 15:63447560-63447582 AGTGGTGAAGAAGGCACTCCAGG - Intergenic
1128752648 15:70160254-70160276 AGTCCTCAAGACGGCCCTGGTGG - Intergenic
1129080774 15:73038377-73038399 AGCCCTGAAGACAGCACTGCAGG + Intergenic
1129461169 15:75700705-75700727 ACTGCTGAAGACAGGGCTGCTGG + Intronic
1133199431 16:4194082-4194104 AGTCCTGAACAGGGCAGTGCAGG - Intronic
1135154841 16:20043666-20043688 CCTGCTGAAGATGGCACAGCTGG + Intronic
1136622866 16:31442057-31442079 TGTGCTGCAGCCAGCACTGCCGG + Intronic
1137232823 16:46583515-46583537 AATGCTGAAGATGGAACTGAAGG - Exonic
1140955519 16:79861453-79861475 TGTGCTGAAGACTGGACTGGTGG - Intergenic
1143284908 17:5781728-5781750 AGAGGTGGCGACGGCACTGCAGG + Intronic
1144124737 17:12192589-12192611 ACTGTTAGAGACGGCACTGCAGG + Intergenic
1144678407 17:17176491-17176513 TGAGCTGCAGACGGCACTGCGGG + Exonic
1145378976 17:22376769-22376791 GGTCCTGAAGACGGGACTCCTGG + Intergenic
1145379454 17:22379139-22379161 GGTCCTGAAGACGGAACTCCTGG + Intergenic
1145379933 17:22381509-22381531 GGTCCTGAAGACGGGACTCCTGG + Intergenic
1145380413 17:22383884-22383906 GGTCCTGAAGACGGGACTCCTGG + Intergenic
1145380891 17:22386231-22386253 GGTCCTGAAGACGGAACTCCTGG + Intergenic
1145381371 17:22388606-22388628 GGTCCTGAAGACGGGACTCCTGG + Intergenic
1145382104 17:22392380-22392402 GGTCCTGAAGACGGGACTCCTGG + Intergenic
1145382579 17:22394745-22394767 GGTCCTGAAGACGGGACTCCTGG + Intergenic
1145382859 17:22396108-22396130 GGTCCTGAAGACGGGACTCCTGG + Intergenic
1145383432 17:22398931-22398953 GGTCCTGAAGACGGGACTCCTGG + Intergenic
1145383946 17:22401399-22401421 GGTCCTGAAGACGGGACTCCTGG + Intergenic
1145384384 17:22403601-22403623 GGTCCTGAAGACGGGACTCCTGG + Intergenic
1145384703 17:22405063-22405085 GGTCCTGAAGACGGGACTCCTGG + Intergenic
1145830964 17:27915854-27915876 AGTGCTGACGACACCCCTGCTGG + Intergenic
1146788434 17:35737563-35737585 ATTGCTGGAAATGGCACTGCTGG + Intronic
1146835154 17:36104806-36104828 AGTGCTGAAGGCGGCAGAGTGGG + Intronic
1147721369 17:42541591-42541613 GTTGCTGAAGTAGGCACTGCAGG + Intronic
1148654731 17:49274778-49274800 TGTCCTGAAGACGGCAGTGAGGG - Intergenic
1148679489 17:49465569-49465591 AGTGGTGAAGGCAGGACTGCGGG - Intronic
1150209476 17:63434332-63434354 AGTCCTGAAGACGCCTCAGCAGG + Exonic
1153704225 18:7728656-7728678 AAGGCTGAAGACCGGACTGCTGG - Intronic
1154405168 18:14084137-14084159 AGTCCTGAACACAGCACTGCAGG + Intronic
1159883677 18:73884126-73884148 GGTACTGATGAAGGCACTGCAGG + Intergenic
1160872800 19:1284791-1284813 AGTGCAGGAGAGGGAACTGCAGG - Intergenic
1160903337 19:1440151-1440173 AGTGGTGAAGACGCACCTGCGGG + Exonic
1160970378 19:1765273-1765295 AGTGCTGGGGGCGGCACGGCAGG - Intronic
1161265442 19:3361397-3361419 AGTGCTGGAGGCGGGACTGCGGG - Intronic
1161943432 19:7419688-7419710 AGTGCTCAAGACGGCAGGTCTGG - Intronic
1163534908 19:17871629-17871651 AGTGCTGAAGCAGGCTGTGCAGG + Intergenic
1168271129 19:55250437-55250459 AGTGCTGGAGCCGGCTCAGCGGG - Intronic
1202643798 1_KI270706v1_random:123086-123108 CATACTGAAGACTGCACTGCGGG - Intergenic
927326743 2:21813645-21813667 CTTCCTGAAGACGGCAATGCTGG - Intergenic
929889640 2:45908295-45908317 AGTGCTGAAGAGGCAGCTGCAGG + Intronic
930700427 2:54455126-54455148 AGTGCACAGGGCGGCACTGCGGG - Intergenic
931775448 2:65536544-65536566 GGTGCTGAAGACAGAACTTCTGG - Intergenic
937908651 2:127064811-127064833 AGTGCTGGGGAAGGGACTGCGGG + Intronic
939017754 2:136921045-136921067 AGTGCAGAAGGCCGCACTCCCGG - Intronic
941986654 2:171517464-171517486 AGTGGTGAAGACGCACCTGCGGG - Intergenic
942557970 2:177190959-177190981 ACTGCTTAAGATGGCAATGCTGG - Intergenic
942620825 2:177843873-177843895 AGTGCTGAAGACGTCCATGGAGG + Intronic
948165767 2:235861339-235861361 AGTGGTCAAAACGGCACTTCTGG - Intronic
948362438 2:237432666-237432688 ACTGCTGACCACAGCACTGCAGG + Intergenic
948883514 2:240871906-240871928 AGACCTGCAGACGGGACTGCTGG - Intronic
1170439713 20:16366566-16366588 AGTGAGGAAGAAGACACTGCAGG + Intronic
1170708024 20:18763540-18763562 AGTGATGCAGTGGGCACTGCCGG + Exonic
1172407720 20:34702034-34702056 AGTTCTGAAGAAGGCATTCCAGG + Intronic
1173875537 20:46368326-46368348 AGTGCTGCAGATGGAACTACAGG + Intronic
1174546700 20:51331186-51331208 AGGACTGAAGATGGCAGTGCTGG - Intergenic
1175402913 20:58710843-58710865 AGTGCTGAGGTCTGCACGGCTGG - Intronic
1175814222 20:61875165-61875187 GGGGATGAAGACAGCACTGCAGG - Intronic
1176608081 21:8849542-8849564 CATACTGAAGACTGCACTGCGGG + Intergenic
1178100012 21:29257899-29257921 AGTGGTGAAGTCAGGACTGCAGG + Intronic
1180358173 22:11859347-11859369 CATACTGAAGACTGCACTGCGGG + Intergenic
1180380093 22:12132983-12133005 CATACTGAAGACTGCACTGCGGG - Intergenic
1180702347 22:17788475-17788497 AGGGCCGAAGGCGGCTCTGCCGG + Exonic
1182972157 22:34589100-34589122 CGTTCTGTAGAGGGCACTGCCGG + Intergenic
950649360 3:14397619-14397641 AGTACTGGAGACAGCTCTGCAGG - Intergenic
950797035 3:15518614-15518636 GGTGCTGCACATGGCACTGCTGG + Intronic
952954459 3:38548646-38548668 AGTGCTGAAGGGGGCATTGCCGG - Exonic
954093001 3:48300486-48300508 GGTGGTGAAGACGGAACTGAAGG - Intronic
961543532 3:127616964-127616986 AGTGGTGAAGATGGCTCGGCTGG - Exonic
964117459 3:153151159-153151181 AGTGATGCAGAAGTCACTGCTGG + Intergenic
966948614 3:184795951-184795973 AGTGCTGGAGAGGGCCCTGGAGG + Intergenic
967875451 3:194265525-194265547 GGTGCTGCAGGCTGCACTGCCGG - Intergenic
969999711 4:11352699-11352721 AGTGATGAAGCCGGAATTGCAGG + Intergenic
970525451 4:16927520-16927542 GGTGCTGAACACTGCACTCCAGG + Intergenic
971003908 4:22352332-22352354 AGTGCTGCAGTGGGCAGTGCAGG + Intronic
971416209 4:26432889-26432911 AGTGATGAAGACAGCAAAGCTGG - Exonic
972177229 4:36422943-36422965 AGTGCTCAAGACCACACTCCAGG - Intergenic
972793932 4:42398050-42398072 AGTGGCGATGAGGGCACTGCTGG + Exonic
978348630 4:107798179-107798201 AATGCTGAGGACTGAACTGCAGG + Intergenic
981693702 4:147537884-147537906 AGTCCTGCAGATGGGACTGCGGG + Intronic
984205497 4:176783017-176783039 TGTGCTGAAGACTACAGTGCTGG - Intronic
984883655 4:184431076-184431098 AGCTCTGAAGACGGCTCTGAGGG + Intronic
1202771167 4_GL000008v2_random:209018-209040 CATACTGAAGACTGCACTGCGGG - Intergenic
985588090 5:751242-751264 AGTGCTGAAGAAGAACCTGCCGG + Exonic
985602760 5:843709-843731 AGTGCTGAAGAAGAACCTGCCGG + Exonic
990406295 5:55494359-55494381 AGACCTGAAGATGGCACTTCAGG + Intronic
993529179 5:89003804-89003826 AGCGCTGGTGCCGGCACTGCTGG + Intergenic
994802852 5:104401051-104401073 ACTGAGGAAGACGGCATTGCCGG - Intergenic
997366845 5:133331150-133331172 AGTTCTGGAGAAGGCCCTGCCGG - Intronic
997882243 5:137601508-137601530 ATTGCTGAAGAGGGAACTGTCGG - Intergenic
997883141 5:137608453-137608475 AGTGGTGAAGAGGGCTCTGGGGG - Intergenic
1000712761 5:164601196-164601218 AGTGGTGAAGACGCACCTGCGGG - Intergenic
1003081162 6:3022964-3022986 ACTACTGAGGACAGCACTGCTGG + Intergenic
1003458086 6:6302430-6302452 TGTACTGAATACAGCACTGCAGG + Intronic
1012562312 6:100598086-100598108 AGGGCTGAGGAGGGTACTGCAGG + Intronic
1015240532 6:131018188-131018210 AGTGTTAAAGACGGCAGAGCAGG - Intronic
1015708480 6:136113822-136113844 AGAGCTGTAGACGGGGCTGCTGG - Intronic
1018462117 6:164008175-164008197 AGAATTGCAGACGGCACTGCAGG - Intergenic
1019690269 7:2406539-2406561 AGTGCTGAACAGGGCACAGGAGG + Intronic
1020278986 7:6640678-6640700 AGTGCTGGAGGCGGGCCTGCTGG + Intronic
1022405135 7:30082291-30082313 TGTGCTGATGGCGGTACTGCTGG - Exonic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1032072464 7:128816873-128816895 AGTGCTGAAGACCAAATTGCTGG - Intronic
1035737070 8:1896883-1896905 AATGCTGAGGACAGCACTGATGG + Intronic
1036170646 8:6480936-6480958 AGTGCTGATGTCGGCACCTCAGG - Intronic
1036504823 8:9345747-9345769 AGTGCAGAAAACGGGGCTGCAGG - Intergenic
1039637477 8:39181307-39181329 AGTTCTTAAGACGGCACGTCTGG - Intronic
1040031487 8:42828588-42828610 AATGCTGAAGAGAGCCCTGCAGG - Intergenic
1040102460 8:43517892-43517914 AGAGCTGGAGCTGGCACTGCAGG - Intergenic
1040578044 8:48671534-48671556 AGGTCTGAAGACTGCACAGCAGG + Intergenic
1043760724 8:84064004-84064026 ATTGCTGAAAAAGGCACTGAAGG - Intergenic
1049238339 8:141524072-141524094 AGAGCTGATGACGGCACAGGAGG - Intergenic
1049563445 8:143325000-143325022 AGTGGTGGAGAGGGGACTGCTGG - Intronic
1050905530 9:10999776-10999798 AGTGGTGAAGACAGCAGGGCTGG + Intergenic
1055594602 9:77852294-77852316 AGTGGTCAGGACGTCACTGCAGG - Intronic
1056526547 9:87447852-87447874 AGTGCCAGAGAGGGCACTGCAGG - Intergenic
1056630764 9:88291141-88291163 AGTGCTGAAGGCATCAATGCTGG - Intergenic
1056752509 9:89362798-89362820 AGTGCTGCAGACCCCACCGCAGG + Intronic
1057141943 9:92731765-92731787 AGAGCTGAAGAAGTCACTGAAGG + Intronic
1057281839 9:93718803-93718825 AGTACTGAAGGCTTCACTGCTGG + Intergenic
1060109824 9:120898855-120898877 AGTGCCAGACACGGCACTGCAGG - Intergenic
1061330095 9:129886800-129886822 AGTGCTCAAGCCGGTACTCCTGG - Intergenic
1061769322 9:132905875-132905897 AGTGCTGATGAAAGCCCTGCGGG - Exonic
1062618264 9:137407710-137407732 GGTTCTGAAGACGGCCCAGCTGG + Intronic
1203703432 Un_KI270742v1:14449-14471 CATACTGAAGACTGCACTGCGGG + Intergenic
1187983186 X:24781378-24781400 AGTGCTGAAGATGGCATCTCTGG + Intronic
1189208623 X:39263736-39263758 AGTGCTGAAGAGGGCAATTCAGG + Intergenic
1194326291 X:92521782-92521804 AGTGCTGATGAAGAAACTGCAGG - Intronic
1196344005 X:114630781-114630803 AGTGCTGTAGACAGCAGAGCTGG - Intronic
1196379108 X:115069405-115069427 AGTACTGACAAAGGCACTGCAGG + Intergenic
1200013827 X:153143177-153143199 AGTGCTGATGGAGGCACTGCAGG + Intergenic
1200025774 X:153256778-153256800 AGTGCTGATGGAGGCACTGCAGG - Intergenic
1200635010 Y:5640984-5641006 AGTGCTGATGAAGAAACTGCAGG - Intronic