ID: 902517489

View in Genome Browser
Species Human (GRCh38)
Location 1:16997140-16997162
Sequence AGTGCTGAAGACGGCACTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902517489_902517496 6 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517496 1:16997169-16997191 CTCTCTCCTGGTGGGGAACGTGG 0: 1
1: 1
2: 1
3: 15
4: 173
902517489_902517495 -1 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517495 1:16997162-16997184 TGGAATGCTCTCTCCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 215
902517489_902517498 13 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517498 1:16997176-16997198 CTGGTGGGGAACGTGGTGTGAGG 0: 1
1: 0
2: 3
3: 22
4: 324
902517489_902517493 -3 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517493 1:16997160-16997182 ACTGGAATGCTCTCTCCTGGTGG 0: 1
1: 0
2: 1
3: 19
4: 164
902517489_902517492 -6 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517492 1:16997157-16997179 AGCACTGGAATGCTCTCTCCTGG 0: 1
1: 0
2: 1
3: 23
4: 187
902517489_902517494 -2 Left 902517489 1:16997140-16997162 CCGGCAGTGCCGTCTTCAGCACT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 902517494 1:16997161-16997183 CTGGAATGCTCTCTCCTGGTGGG 0: 1
1: 0
2: 1
3: 27
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902517489 Original CRISPR AGTGCTGAAGACGGCACTGC CGG (reversed) Exonic