ID: 902517808

View in Genome Browser
Species Human (GRCh38)
Location 1:16999083-16999105
Sequence GAAACAGCTCAGATGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902517801_902517808 24 Left 902517801 1:16999036-16999058 CCTGTGCCATCTGGAATCTTTAT 0: 1
1: 0
2: 0
3: 10
4: 175
Right 902517808 1:16999083-16999105 GAAACAGCTCAGATGCAGCCAGG 0: 1
1: 0
2: 0
3: 21
4: 255
902517807_902517808 -1 Left 902517807 1:16999061-16999083 CCTGAAGGTGGGCACTGGTATAG 0: 1
1: 0
2: 1
3: 7
4: 84
Right 902517808 1:16999083-16999105 GAAACAGCTCAGATGCAGCCAGG 0: 1
1: 0
2: 0
3: 21
4: 255
902517802_902517808 18 Left 902517802 1:16999042-16999064 CCATCTGGAATCTTTATGACCTG 0: 1
1: 0
2: 0
3: 11
4: 150
Right 902517808 1:16999083-16999105 GAAACAGCTCAGATGCAGCCAGG 0: 1
1: 0
2: 0
3: 21
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902517808 Original CRISPR GAAACAGCTCAGATGCAGCC AGG Intronic
902196636 1:14803296-14803318 GAAACAGGTCAGCTACATCCGGG - Intronic
902348180 1:15834813-15834835 GTGGCAGCTCGGATGCAGCCCGG + Intergenic
902517808 1:16999083-16999105 GAAACAGCTCAGATGCAGCCAGG + Intronic
903890447 1:26566783-26566805 GAAACAACACAGAGGGAGCCTGG - Intronic
904306857 1:29595370-29595392 GAAGGAGCACAGATGCACCCTGG - Intergenic
904319280 1:29686096-29686118 GAAGGATCTCAGATCCAGCCAGG - Intergenic
904435416 1:30491818-30491840 AAAATATCTCAGTTGCAGCCTGG + Intergenic
908104808 1:60830465-60830487 TATACAGCTCAGGTGCAGCATGG + Intergenic
908426185 1:64009711-64009733 CAAACAGCTCTGATGAATCCTGG - Intronic
909199274 1:72668895-72668917 GAAATATCTCAGATACAGCTTGG + Intergenic
911886121 1:103301836-103301858 GAAACAGCCAAGATGAAGACCGG + Intergenic
913955526 1:143287806-143287828 GAATCTGCCCTGATGCAGCCAGG + Intergenic
913981906 1:143527635-143527657 GAATCTGCCCTGATGCAGCCAGG - Intergenic
914076269 1:144354290-144354312 GAATCTGCCCTGATGCAGCCAGG - Intergenic
914102909 1:144612206-144612228 GAATCTGCCCTGATGCAGCCAGG + Intergenic
916458131 1:164992075-164992097 GAGAGAGCTCACATGCATCCAGG - Intergenic
916690425 1:167185038-167185060 GAGACTTCTCAGGTGCAGCCTGG - Intergenic
916898309 1:169191105-169191127 GAAACAGTTCACTTGCGGCCGGG - Intronic
917964912 1:180172362-180172384 GGAACAGCTGAGGTGCAGCAGGG + Intronic
918093918 1:181318844-181318866 GAAAGAGCACAGAGGAAGCCAGG + Intergenic
921187877 1:212685396-212685418 GAAGGGGCTCAGATGCAGCGAGG - Intergenic
921752406 1:218811180-218811202 GAAAAAGCTCAGAAGCAGGATGG - Intergenic
923749898 1:236737865-236737887 AAAACAGTGCAGATGCAGCGAGG - Intronic
924515155 1:244759916-244759938 GAAACTCCTGAGATGCAGGCTGG + Intergenic
1063502903 10:6570848-6570870 GAAACCCCTCAGTTCCAGCCAGG - Intronic
1065287552 10:24200728-24200750 GGAAGAGCTCAGATGCTCCCCGG - Intronic
1066384572 10:34931266-34931288 CAAACAGCTGAACTGCAGCCTGG + Intergenic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1067143020 10:43671994-43672016 GAAAGGGCTCTGGTGCAGCCAGG - Intergenic
1069602329 10:69716082-69716104 GACACAGCGAAGAGGCAGCCTGG - Intergenic
1069957552 10:72061291-72061313 GGAACAGGACAGGTGCAGCCGGG - Exonic
1070496464 10:77028400-77028422 GAGACAGCTTGGATGGAGCCAGG - Intronic
1070629983 10:78077580-78077602 CAAAGAGCTCACATTCAGCCAGG + Intergenic
1070754493 10:78983328-78983350 GAAACAGGTCAGAAGGAGGCTGG - Intergenic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1072792217 10:98326658-98326680 GCAACAGCTCTGCTGCAGGCAGG - Intergenic
1074020994 10:109582728-109582750 GAGACAGCTCAGGTGCAGAGAGG + Intergenic
1074988052 10:118674712-118674734 GAAACACCTCCCATGCAGACAGG + Intronic
1075064821 10:119282329-119282351 GAGACAGCTCTGCTGCAGTCTGG - Intronic
1075495370 10:122915038-122915060 GAAACAGGCCAGAGGCAGGCAGG + Intergenic
1075781093 10:125017729-125017751 GGAGCAGCTCAGATGCAGCATGG + Intronic
1075902275 10:126052584-126052606 CAAACAGCTCAACAGCAGCCTGG + Intronic
1076503908 10:130959171-130959193 GACAGAATTCAGATGCAGCCGGG - Intergenic
1076841531 10:133048338-133048360 GATTCAGCTCAGAGGCAGCAGGG + Intergenic
1078987949 11:16613147-16613169 AAAACAGCTGGGATGCAGACGGG + Intronic
1081815521 11:45938023-45938045 TAAACAGGGAAGATGCAGCCCGG + Intronic
1084893910 11:72251373-72251395 GTAACAGATCAGAGGGAGCCTGG - Intergenic
1085288913 11:75383388-75383410 AAAACAGCTCTGATGTAGCAAGG + Intergenic
1085678288 11:78546204-78546226 GAAACAGCTGAAGTGTAGCCAGG + Intronic
1086343386 11:85870264-85870286 GAAAGCTCTCAGCTGCAGCCAGG + Intronic
1086412776 11:86558960-86558982 GCCACAGCTAAGATGCAGCAGGG - Intronic
1087133881 11:94694860-94694882 GAAACAGCTCAGAAACAAGCCGG + Intergenic
1087615819 11:100486080-100486102 GAGACAACTCAAATGCAGCAAGG + Intergenic
1089214375 11:116827018-116827040 CAGACAACTCAGATCCAGCCAGG + Intergenic
1089830045 11:121319401-121319423 GAAACTGCTCAGCCTCAGCCAGG - Intergenic
1089863414 11:121610780-121610802 AAAACAGCCCAGCTTCAGCCTGG - Intronic
1090801580 11:130176106-130176128 GACAGAGCACAGATGCAGACTGG - Intronic
1090920129 11:131199478-131199500 GAAACAGCTCACAGGCAGCAAGG + Intergenic
1092127485 12:6085115-6085137 GAAGCTGCTCAGATGCCTCCAGG - Intronic
1096575980 12:52553090-52553112 GACAAAGCTCAGATGCAGGAGGG + Exonic
1097281019 12:57845710-57845732 GAAACTGGTCAGAGGCAGCCGGG + Intronic
1098810843 12:75089173-75089195 GAAACAGATTAGGTACAGCCTGG + Intronic
1100463039 12:94819667-94819689 GACACACCTCAGATGGATCCGGG - Intergenic
1102027557 12:109722162-109722184 GAGGCAGCTCAGAGGCAGGCAGG + Intronic
1102683745 12:114708106-114708128 GGAACATGTCAGAGGCAGCCTGG - Intergenic
1102862364 12:116347402-116347424 GAAACAGCTCAGATGCTCATGGG + Intergenic
1103075350 12:117977971-117977993 TAAAAAGCACACATGCAGCCAGG + Intergenic
1108485112 13:50915837-50915859 GAAACAGCTAAGCTGGAGGCTGG + Intronic
1108644396 13:52412131-52412153 GAAACATTTCTGATGCAGGCAGG + Intergenic
1108869308 13:54963039-54963061 GAAAAAACTCTGATGCAGCCGGG + Intergenic
1110585439 13:77185759-77185781 GAAGCAGCTTAAATGCAGCTGGG + Intronic
1113145218 13:107200381-107200403 GAAACAGGTCAAATCAAGCCAGG + Intronic
1117231453 14:53723462-53723484 GAAATAGATCAGTGGCAGCCAGG - Intergenic
1119422943 14:74518366-74518388 GAAACAGATGAGAAGCAGGCTGG - Intronic
1120754815 14:88232889-88232911 GAAACAGCTCCTAGGCAGCCAGG + Intronic
1128931682 15:71709997-71710019 GAAGCTGCTCAGATCCAGGCTGG + Intronic
1129363352 15:75038477-75038499 ATAACTGCTCAGATACAGCCTGG + Intronic
1131596505 15:93803526-93803548 GCCACAGATCAGCTGCAGCCAGG + Intergenic
1132835543 16:1951101-1951123 GAACCAGCTCAGAGGCCTCCGGG - Intronic
1134165406 16:11925601-11925623 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1134489897 16:14688841-14688863 GAAACAGCTTAGATAAGGCCAGG - Intronic
1134495278 16:14727958-14727980 GAAACAGCTTAGATAAGGCCAGG - Intronic
1134500667 16:14767084-14767106 GAAACAGCTTAGATAAGGCCAGG - Intronic
1134527205 16:14953691-14953713 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1134545196 16:15102651-15102673 GAAACAGCTTAGATAAGGCCAGG + Intronic
1134579915 16:15361965-15361987 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1134714793 16:16352233-16352255 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1134722670 16:16395595-16395617 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1134794600 16:17023493-17023515 GCGACTACTCAGATGCAGCCAGG - Intergenic
1134944758 16:18316276-18316298 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1134952022 16:18356426-18356448 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1135310365 16:21400497-21400519 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1135363309 16:21832910-21832932 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1135448481 16:22538150-22538172 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1136149945 16:28340827-28340849 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1136166179 16:28454631-28454653 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1136196792 16:28660389-28660411 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1136213132 16:28774512-28774534 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1136257862 16:29054429-29054451 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1136307107 16:29379637-29379659 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1136320631 16:29481880-29481902 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1136435204 16:30221220-30221242 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1137380903 16:47998768-47998790 GTAAGAGCAGAGATGCAGCCAGG - Intergenic
1138106231 16:54288299-54288321 GAAACTACTCAGATGCAGTCTGG - Intergenic
1138412922 16:56853876-56853898 GAAGCAGGCCAGCTGCAGCCAGG - Intergenic
1138635225 16:58332969-58332991 TAAAAAACACAGATGCAGCCGGG - Intronic
1139462589 16:67134360-67134382 GAAACAGCTCAGAGGCATCATGG - Exonic
1139855237 16:69974630-69974652 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1139884953 16:70201755-70201777 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1140367562 16:74393762-74393784 GAAACAGCTTAGATAAGGCCAGG - Intergenic
1140377364 16:74455275-74455297 GAAACAGCCCAGATGCCTCTGGG - Intronic
1141305469 16:82859260-82859282 TAAACTGATCAGATGCAGTCGGG + Intronic
1141992168 16:87616783-87616805 AGAACAGCTCAGAGGCTGCCAGG - Intronic
1142746821 17:1963523-1963545 GACACAGCCCAGAGGCAGCAGGG - Intronic
1143088953 17:4437151-4437173 GAAACAGCTCTTATGGGGCCAGG + Intronic
1144220998 17:13099691-13099713 GAAACAGCTTAGGTCCAGGCTGG + Intergenic
1144874138 17:18388391-18388413 GACACAGCACAGAGGCAGCAGGG - Intronic
1145783288 17:27577837-27577859 GAAACCCCTCAGATTCGGCCTGG - Intronic
1150225231 17:63521062-63521084 CCACCAGCTCAGTTGCAGCCGGG - Intronic
1152128534 17:78461959-78461981 GAAACATATCAACTGCAGCCTGG + Intronic
1152198171 17:78929733-78929755 CACCCAGCCCAGATGCAGCCTGG + Intergenic
1154116661 18:11617606-11617628 GAAACAGCTTAGATAAGGCCAGG + Intergenic
1155225077 18:23722289-23722311 GAAACAGCTCAGAGGGAAGCAGG - Intronic
1155962646 18:32007679-32007701 AAAACAGCTGAGTTGAAGCCAGG - Intergenic
1156177911 18:34569108-34569130 CAATGAGCTCAGATCCAGCCAGG - Intronic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1158660720 18:59385112-59385134 GATAGAGCTCAGATGCTGGCAGG + Intergenic
1162281938 19:9705768-9705790 AAAACAGCTACCATGCAGCCTGG - Intergenic
1164090763 19:21949787-21949809 AAAACTGCTCAGAGGCAGGCTGG - Intronic
1166169811 19:41019703-41019725 GAAACAGCTCACAGGCAGCAAGG + Intergenic
1166855296 19:45780232-45780254 GTGACAGTTCAGGTGCAGCCAGG + Exonic
1167042060 19:47028246-47028268 GATACAGCTCGGAACCAGCCGGG - Intronic
1167674519 19:50876038-50876060 GAAACAGCAGAGAGGAAGCCAGG - Intronic
1168118380 19:54238959-54238981 GAAACCCCCAAGATGCAGCCGGG - Exonic
1168172868 19:54600807-54600829 GAAGCCTCTGAGATGCAGCCGGG + Exonic
925879309 2:8338588-8338610 GAATGAGCTCAGATGAAGCTCGG - Intergenic
925987303 2:9226703-9226725 GAAACAGGTCACAGGGAGCCTGG + Intronic
927091178 2:19713897-19713919 GAAAGAGTTCAGATTCAGGCTGG + Intergenic
930738490 2:54803885-54803907 CAAACATCTCAGATGGTGCCCGG - Intronic
931906990 2:66853268-66853290 GAGAAAGCTCAGTTGCAACCTGG - Intergenic
934496422 2:94804825-94804847 GCTACAGCACAGATGCAGCATGG + Intergenic
936785384 2:116088165-116088187 GAAAAAGCTGGGAAGCAGCCTGG - Intergenic
937085954 2:119171945-119171967 GAATCTTCTCAGATGCAGGCAGG - Intergenic
938146079 2:128835829-128835851 GAAGCCGCTCAGCTGCAGTCTGG + Intergenic
939203260 2:139066178-139066200 AAAACAGCTCAGATCTAGGCAGG + Intergenic
940446613 2:153785110-153785132 GAAACAGCAAAGATGGAGCTTGG - Intergenic
942161007 2:173187078-173187100 GAAAAAGCCAAGCTGCAGCCAGG + Intronic
943701784 2:190995253-190995275 GAAACAGTCCAGAAGCAGCCTGG + Intronic
943758431 2:191583426-191583448 GAAATAGCATAAATGCAGCCGGG + Intergenic
946028791 2:216689209-216689231 TGCACAGCTCAGAGGCAGCCAGG + Intronic
948075710 2:235163821-235163843 GAACCAGCTCTGATGGAGGCAGG - Intergenic
948528693 2:238589352-238589374 TAAACAGCACATATGCAGACTGG - Intergenic
1169981134 20:11385177-11385199 GAAACTGCTCAGATGGGGCAAGG - Intergenic
1170857805 20:20073541-20073563 GAAACAGTGCAGATGTAGACTGG - Intronic
1170857870 20:20074132-20074154 GAGACAGCTCAAATGCCGCCTGG + Intronic
1171027127 20:21641028-21641050 GCAGGTGCTCAGATGCAGCCTGG - Intergenic
1172664834 20:36591791-36591813 GAAACAGCACAGGGGCAGCTTGG - Exonic
1172687669 20:36768670-36768692 AAAAAAGCTCAGATGTGGCCAGG - Intronic
1172708287 20:36899681-36899703 GAAACAGCTCAGAGGCAGAGAGG + Intronic
1173921071 20:46745535-46745557 GAAACAGCAGAGATGAAGCAGGG + Intergenic
1174309936 20:49644379-49644401 AGAAAAGCTCAGCTGCAGCCAGG - Intronic
1175101226 20:56580164-56580186 GACACAGCCCAGGTGCAGTCAGG - Intergenic
1175257142 20:57654394-57654416 GATACCGCTCACCTGCAGCCTGG + Intronic
1175758232 20:61543912-61543934 GAAACAGCTCAGATTCTGACTGG + Intronic
1176387267 21:6144794-6144816 TAGACAGCACGGATGCAGCCGGG - Intergenic
1179736206 21:43393454-43393476 TAGACAGCACGGATGCAGCCGGG + Intergenic
1180617078 22:17135401-17135423 GTAACAGCTCAGGTGAGGCCAGG + Intergenic
1180629592 22:17219242-17219264 GACCCAGCTCAGATGGAGACAGG + Intronic
1180987114 22:19911626-19911648 GCAGCAGCTTAGATGCAGACAGG - Intronic
1181812727 22:25413807-25413829 GGAACAGCCTAGATGCAGGCAGG + Intergenic
1183474760 22:38030082-38030104 GGAACAGTTAAGATGCAGCTGGG + Intronic
1183734076 22:39634134-39634156 CACACAGCTCAGAAGCAGCAGGG - Intronic
1183831410 22:40420218-40420240 GACACAGCTCTGAGGCTGCCTGG - Intronic
1184213565 22:43051526-43051548 GAACTAGCCCAGATGCACCCTGG + Intronic
1185221474 22:49631028-49631050 GTCCCAGCTCAGATGCACCCTGG - Intronic
949812865 3:8025929-8025951 GAAACATCTAAAATGCAGCATGG - Intergenic
950222220 3:11205174-11205196 GAGACTGGCCAGATGCAGCCTGG - Intronic
950656003 3:14436765-14436787 GAAACAGCACAGACTCAGGCAGG - Intronic
952916262 3:38246210-38246232 AAAACAGCTCAGGTAAAGCCGGG + Exonic
953860658 3:46541616-46541638 GAAACAACTGAGATACAACCTGG + Intronic
954097715 3:48342976-48342998 AATACAGCTCAGAAGAAGCCTGG + Intergenic
954123521 3:48514945-48514967 AAAACAGCACAGATTCATCCTGG + Intergenic
956190071 3:66599769-66599791 GAAAGAGCTCATTTTCAGCCGGG - Intergenic
956643716 3:71436303-71436325 GAAAATCCTAAGATGCAGCCTGG + Intronic
957369250 3:79270528-79270550 GCAACAATTCAGGTGCAGCCTGG - Intronic
963962473 3:151324339-151324361 TAACCAGCCCAGATGCTGCCAGG - Intronic
964137310 3:153359209-153359231 AAAATATCTTAGATGCAGCCTGG - Intergenic
965798798 3:172469547-172469569 TAAAAACCTCTGATGCAGCCAGG + Intergenic
965827054 3:172742037-172742059 GAGACAGCTTAGGTGCAGCAAGG + Intergenic
967852334 3:194091568-194091590 GAAACAGCTGGAATGCAGGCAGG - Intergenic
968255433 3:197265754-197265776 GAAAAAGCTTAAAAGCAGCCAGG + Intronic
968564038 4:1300198-1300220 GAAACAGCTCCGTGGCAGTCAGG - Intronic
968764574 4:2461578-2461600 GGCAGAGCTCAGACGCAGCCTGG + Intronic
969499875 4:7546224-7546246 GCAACAGCTCAGAGGCATCCAGG + Intronic
969544313 4:7814718-7814740 GAAACAGATCAGCAGCTGCCAGG + Intronic
970354878 4:15242123-15242145 GACACAGCACAGATGCGCCCTGG + Intergenic
971479813 4:27104378-27104400 GAAACAGCTCAGATAGATCATGG - Intergenic
972443590 4:39120870-39120892 GAAACAGCGCTGATACAGCAGGG + Intronic
973003737 4:44985120-44985142 GAAACAGCTATGATGAAGCAGGG - Intergenic
975733093 4:77356569-77356591 GAAAGAGCTCAGATTCATCTGGG - Intronic
976270325 4:83223987-83224009 GCAACAGCTCAGGTCCATCCTGG - Intergenic
977577288 4:98688845-98688867 CAAAGAGCTAAGATGCAGCTTGG - Intergenic
977886516 4:102258026-102258048 GCAACTTCTCAGCTGCAGCCTGG + Intronic
978660092 4:111115702-111115724 GAAAAAGCTCAGATAAATCCAGG + Intergenic
978862546 4:113468349-113468371 GATACAGCACAGAAGCATCCTGG - Intronic
978981104 4:114946571-114946593 GAGACAGCACAGATGAAGCCTGG + Intronic
980868129 4:138577788-138577810 GGAACAGCTCAGAAGAAGACAGG - Intergenic
981047093 4:140275295-140275317 GAAACATATCACATGCTGCCTGG + Intronic
982886259 4:160786796-160786818 GAAAGAATTCAGATTCAGCCAGG - Intergenic
988583652 5:32490531-32490553 CAAGCAGCTCAGATGCAGGCAGG - Intergenic
988841638 5:35089293-35089315 GAAACAGCTCTGAAGAAGACAGG - Intronic
996047940 5:118897199-118897221 GACACAGCTCAGAGGAAACCAGG + Intronic
996291958 5:121861784-121861806 TAAAGAGCTCAGATGCAACCTGG + Intergenic
998142045 5:139705537-139705559 GAAACAGCCCAGCCTCAGCCTGG - Intergenic
998208096 5:140173748-140173770 GGAACAGGACAGAGGCAGCCAGG - Intergenic
1018388003 6:163322159-163322181 GAAACAGCTCAGGAGGAACCAGG - Intergenic
1021258565 7:18425296-18425318 GATACATCTCAGATGCAAACTGG - Intronic
1024046700 7:45590147-45590169 GGAACAGCTCTGATGCAAACGGG + Intronic
1025557486 7:62327346-62327368 GAATCAGCTTTGATGCAGCCAGG + Intergenic
1028116268 7:87001460-87001482 GAAACAGCTCAGTTTCTGGCTGG + Intronic
1030864607 7:114684302-114684324 GAAACAGTTGAAATGCAGCAGGG + Intronic
1032325277 7:130922222-130922244 GAAAACGCTCAGAGGCTGCCAGG + Intergenic
1032470857 7:132177985-132178007 GAACCAGCTCAGATCCTCCCAGG + Intronic
1034164538 7:149015180-149015202 AAAACTGCAGAGATGCAGCCAGG - Intronic
1034231301 7:149530686-149530708 GCAACTGCTCAGAAGCAGGCTGG - Intergenic
1034295847 7:149971862-149971884 CCAACAGCTGAGATGCAGTCAGG - Intergenic
1034810206 7:154125042-154125064 CCAACAGCTGAGATGCAGTCAGG + Intronic
1035179850 7:157081431-157081453 GAGACCGCCCAGATGCAGACAGG - Intergenic
1035332726 7:158106915-158106937 GAAAGAGCTGAGATGCTTCCAGG - Intronic
1035778975 8:2212275-2212297 GCAGCAGCTCAGAGACAGCCTGG + Intergenic
1036004116 8:4642570-4642592 GAAACAGCACAGTTTCATCCAGG - Intronic
1037510949 8:19582009-19582031 GAGATAGCTCAGATACAGCCTGG - Intronic
1037567516 8:20130224-20130246 GACACAGCTCAGAGGCCACCAGG + Intergenic
1037953461 8:23034791-23034813 GAATCACCACAGATGCATCCTGG - Intronic
1041805004 8:61840407-61840429 GAATCAGCATTGATGCAGCCAGG + Intergenic
1044832671 8:96265532-96265554 GAAAAAGCTCATTTCCAGCCTGG + Intronic
1045061092 8:98411797-98411819 GGAACACTTCAGATCCAGCCTGG - Intronic
1047350744 8:124071323-124071345 GAAGAAGCTCAGATGCAAGCAGG + Intronic
1047636145 8:126764584-126764606 GGAACAGCTCAAAGGCAGACAGG + Intergenic
1048948559 8:139473697-139473719 GAACCAGCTCAAAGGCAGCTCGG + Intergenic
1049384435 8:142334165-142334187 GAAACAGATCAGTTACAGCTTGG - Intronic
1049466011 8:142751624-142751646 GACACAGCCCGGATGCAGCCTGG - Intronic
1049653373 8:143787039-143787061 GAAACTGCTCAGAAGCAGGATGG + Intergenic
1049673776 8:143880787-143880809 GAGACAGGGCAGATGCAGGCAGG + Intergenic
1050599249 9:7234118-7234140 GATACAGCTCAGGAACAGCCAGG + Intergenic
1051680068 9:19598026-19598048 AAAACAGCTCACATTCTGCCAGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053273408 9:36765772-36765794 GAACCATCTCAGACACAGCCTGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053872066 9:42503013-42503035 CCACCAGCTCAGAAGCAGCCAGG + Intergenic
1054735064 9:68742740-68742762 GAAACAGCAAAGATCCAGCATGG - Intronic
1055135282 9:72822200-72822222 GAAACAGCTCAAGTGCATGCTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058189293 9:101893119-101893141 GAACCAGCTCAGATTCATCAAGG + Intergenic
1059847977 9:118302800-118302822 GAAACATGTCAGATTCAGACTGG - Intergenic
1060985602 9:127817392-127817414 GAAACATTTCAGCAGCAGCCAGG - Intronic
1061285829 9:129621935-129621957 GAAGCGGCCCAGAGGCAGCCGGG - Intronic
1203581151 Un_KI270746v1:6309-6331 GAATCAGCCTTGATGCAGCCAGG - Intergenic
1188351488 X:29136420-29136442 TAAAGAGTTCAAATGCAGCCGGG - Intronic
1188626660 X:32293443-32293465 TCAACAAGTCAGATGCAGCCAGG + Intronic
1189875683 X:45433753-45433775 GTAACAGCTCAGCTGCAGTGGGG - Intergenic
1190061825 X:47216597-47216619 GGAACAACTAAGATGCAACCAGG - Intergenic
1190157503 X:48005771-48005793 GCAACAGCACAGAAGGAGCCAGG + Intronic
1190173273 X:48128656-48128678 GCAACAGCACAGAAGGAGCCAGG + Intergenic
1192160414 X:68782218-68782240 GAATCTGCACTGATGCAGCCAGG - Intergenic
1192161433 X:68791131-68791153 GAATCTGCACTGATGCAGCCAGG + Intergenic
1192208821 X:69113952-69113974 GAAAGAGCTGAGAGGCAGCTGGG - Intergenic
1192585232 X:72313869-72313891 GAAATAGCTCACACACAGCCAGG + Intergenic
1194561518 X:95427748-95427770 GAAACAGCTCAGCCTCAGCAAGG + Intergenic
1194581495 X:95677662-95677684 GATGGAGCTCAGATACAGCCAGG - Intergenic
1196155100 X:112419802-112419824 CAATCAGAACAGATGCAGCCAGG + Intergenic
1197641714 X:128975252-128975274 GGACCAGCACAGTTGCAGCCCGG + Intergenic
1197884203 X:131201055-131201077 GGAACAGCACAGAAGCAGCCTGG - Intergenic
1200137468 X:153882107-153882129 GAAACAGCTCAGACACTGCCAGG + Intronic
1201337248 Y:12894145-12894167 GCAACTGCTCAGAGGCAGGCTGG - Intergenic