ID: 902518997

View in Genome Browser
Species Human (GRCh38)
Location 1:17005257-17005279
Sequence GGGACCTGCCTAATGTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902518991_902518997 17 Left 902518991 1:17005217-17005239 CCCAATGCTCAGATGGGAAAGCT 0: 1
1: 0
2: 0
3: 28
4: 362
Right 902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG 0: 1
1: 0
2: 3
3: 28
4: 185
902518992_902518997 16 Left 902518992 1:17005218-17005240 CCAATGCTCAGATGGGAAAGCTG 0: 1
1: 0
2: 1
3: 48
4: 425
Right 902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG 0: 1
1: 0
2: 3
3: 28
4: 185
902518986_902518997 29 Left 902518986 1:17005205-17005227 CCGTCCCTTCTGCCCAATGCTCA 0: 1
1: 0
2: 1
3: 38
4: 361
Right 902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG 0: 1
1: 0
2: 3
3: 28
4: 185
902518987_902518997 25 Left 902518987 1:17005209-17005231 CCCTTCTGCCCAATGCTCAGATG 0: 1
1: 0
2: 0
3: 19
4: 186
Right 902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG 0: 1
1: 0
2: 3
3: 28
4: 185
902518985_902518997 30 Left 902518985 1:17005204-17005226 CCCGTCCCTTCTGCCCAATGCTC 0: 1
1: 0
2: 1
3: 28
4: 329
Right 902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG 0: 1
1: 0
2: 3
3: 28
4: 185
902518988_902518997 24 Left 902518988 1:17005210-17005232 CCTTCTGCCCAATGCTCAGATGG 0: 1
1: 0
2: 0
3: 11
4: 162
Right 902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG 0: 1
1: 0
2: 3
3: 28
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902518997 Original CRISPR GGGACCTGCCTAATGTCCCA TGG Intronic
901148959 1:7087642-7087664 GTGACTTGCCTAAGGTCACATGG - Intronic
902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG + Intronic
904916546 1:33974576-33974598 GTAACCTGCTTGATGTCCCAGGG + Intronic
905355482 1:37380857-37380879 GGGACCTGCCAAGTGTGGCACGG + Intergenic
905562687 1:38940082-38940104 GGGATTTGCCTAAGGTCACATGG - Intronic
905658681 1:39703010-39703032 GTGACCTGCCTGAAGTCACATGG - Intronic
905690626 1:39940260-39940282 GTGACCTGCCTAAAGTCACATGG + Intergenic
905790408 1:40786327-40786349 AGGACCTGCCTCCTGTCCCCTGG + Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906662072 1:47590168-47590190 TGGGCCTGCCTAATGTCACGTGG + Intergenic
907309472 1:53531043-53531065 GTGACCTGCCCAAGGTCACAGGG + Intronic
907412229 1:54290749-54290771 GGGACCTGCGTCCTGTGCCATGG - Intronic
907785687 1:57610443-57610465 GGGACTTGCCCAATGTCACCTGG + Intronic
908654238 1:66371256-66371278 GAGACCTATATAATGTCCCATGG + Intronic
912664884 1:111570039-111570061 GGAACCTTCTTAATGTCCCAGGG + Intronic
913112342 1:115667571-115667593 GGGACCTGCTCAAGGTCACAGGG + Intronic
913236034 1:116784273-116784295 GGAACCTGCCTCAGGTCCCTGGG - Intergenic
915146589 1:153799302-153799324 ATGACCTGCCCAAAGTCCCATGG - Intergenic
915536276 1:156537760-156537782 GGGACCTGAGTAATGACCCCAGG + Intronic
915612218 1:157003578-157003600 AGGACTTGCCTGAGGTCCCAGGG + Intronic
917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG + Exonic
1063050287 10:2439670-2439692 GGGAACTGCTTGGTGTCCCATGG - Intergenic
1067668172 10:48296283-48296305 GGAACCCCCCAAATGTCCCAGGG + Intergenic
1072290165 10:93957618-93957640 GTGACTTGCCTATAGTCCCAGGG - Intergenic
1073503085 10:103959871-103959893 GTGACTTGCCCAATGTCACAGGG + Intergenic
1075689791 10:124387260-124387282 GGTACCTTCCTGCTGTCCCATGG + Intergenic
1077458050 11:2692704-2692726 GGGACCTGCCTACCCTCCCAGGG - Intronic
1078157656 11:8812667-8812689 GGGACTTGCCCAATGGCACATGG - Intronic
1078937635 11:15965524-15965546 GGGACCTCCCTCTTGCCCCATGG - Intergenic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1081848819 11:46260689-46260711 GTGCCCTTCCTAATGTCCTAGGG + Intergenic
1083267530 11:61553677-61553699 TGGAGCTGCCTAATGTCACCTGG - Intronic
1083445525 11:62705994-62706016 GCGACTTGCCTAAGGTCGCACGG + Intronic
1083609383 11:63997929-63997951 GGGACTTGCCCAGGGTCCCAGGG + Exonic
1083637127 11:64126783-64126805 AGGTCCTGCCTGATGTCCAAGGG + Intronic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1083870759 11:65487066-65487088 GTGACCTGCTGAAGGTCCCAGGG + Intergenic
1083987821 11:66228235-66228257 GGGTCCTGCCTCTGGTCCCACGG - Intronic
1085196302 11:74673966-74673988 TTGACCTGTTTAATGTCCCAGGG + Intergenic
1085312339 11:75524142-75524164 GGGACCTGCTCAAGGTCTCAAGG - Intronic
1088183992 11:107143130-107143152 GGGCTCTGCCTAAGGTTCCAGGG + Intergenic
1088505227 11:110520975-110520997 AGGACCTGCCCAAGGTCACACGG + Intergenic
1088931645 11:114357398-114357420 AGGGCCTGCCTAATGTCCTCTGG + Intergenic
1089342752 11:117770498-117770520 GAGACCTGCCTAATGTCCCGTGG - Intronic
1091311143 11:134576087-134576109 AGGACCTGCTTAAGGTCTCATGG - Intergenic
1099198298 12:79645935-79645957 GGGACATGCCTAAAGTTACATGG - Intronic
1102024072 12:109703568-109703590 GGGACCTGCCCAAGGTCACGTGG + Intergenic
1103063474 12:117877668-117877690 GGAACTTGCCTAAGGTCACATGG + Intronic
1103518040 12:121520217-121520239 GGGACCTGTCTTATGTGCCTAGG + Intronic
1104585436 12:130044773-130044795 TAGACCTGCCTTTTGTCCCAAGG - Intergenic
1104918385 12:132278096-132278118 GGCCCCTGCCTACTGTCCCCGGG - Intronic
1104975127 12:132548795-132548817 GGGCCCTGCCAGATGTGCCAGGG + Intronic
1106374522 13:29172187-29172209 GAGACCTGTCCAATGTCACATGG - Intronic
1106691132 13:32117922-32117944 GGGAGCTGCCCAAAGTCACATGG - Intronic
1106698231 13:32201253-32201275 GTGACCTGGCTAATGTCACCTGG + Intronic
1111394763 13:87650755-87650777 AGAACTTGCCTAATGTCACATGG + Intergenic
1112234685 13:97624767-97624789 GAAACCTGCCTTAAGTCCCAAGG - Intergenic
1113922080 13:113918854-113918876 GGCGGCTGCCTAAGGTCCCAAGG + Intergenic
1114568173 14:23647531-23647553 GGGACCTGCCTGAGATCCCCTGG + Intergenic
1115436552 14:33381566-33381588 GGGATTTGCTTAAGGTCCCATGG + Intronic
1118124273 14:62882425-62882447 GAGACTTGGCTAAAGTCCCATGG - Intronic
1120604345 14:86554777-86554799 GGGACATTTCAAATGTCCCAAGG + Intergenic
1121670725 14:95709070-95709092 GGCAGCTGCCTGATCTCCCATGG + Intergenic
1121933799 14:97997776-97997798 GGGACCTGCCTCATGTTTCAGGG - Intergenic
1122695794 14:103551455-103551477 CGGACCTGCCTCCTGTCCCTCGG + Intergenic
1124577317 15:30921298-30921320 GGGACCTGCCAAGTCTCACAAGG - Intronic
1126699680 15:51356661-51356683 GTGACCTGCCGAAGGTCACACGG - Intronic
1127960931 15:63890229-63890251 GGGATCAGCCTAATGACCAAAGG + Intergenic
1129468405 15:75737264-75737286 GGGACTTGCCTAAAGCCCCAGGG + Intergenic
1129727163 15:77907233-77907255 GGGACTTGCCTAAAGCCCCAGGG - Intergenic
1130270488 15:82443814-82443836 GGGACTTGCCTAAAGCCCCAGGG + Intergenic
1130275480 15:82474012-82474034 GGGACTTGCCTAAAGCCCCAGGG - Intergenic
1130462832 15:84171133-84171155 GGGACTTGCCTAAAGCCCCAGGG + Intergenic
1130467840 15:84201407-84201429 GGGACTTGCCTAAAGCCCCAGGG - Intergenic
1130485846 15:84398101-84398123 GGGACTTGCTTAAAGCCCCAGGG + Intergenic
1130489842 15:84423654-84423676 GGGACTTGCCTAAAGCCCCAGGG - Intergenic
1130496425 15:84472135-84472157 GGGACTTGCCTAAAGCCCCAGGG + Intergenic
1130501433 15:84502404-84502426 GGGACTTGCCTAAAGCCCCAGGG - Intergenic
1130590132 15:85206005-85206027 GGGACTTGCCTAAAGCCCCAGGG - Intergenic
1131083202 15:89554271-89554293 GGGACCTGCCTTTTGTCCTTGGG + Intergenic
1133384026 16:5354408-5354430 GTGACTTGCCTAAGGTCACATGG - Intergenic
1133730856 16:8577441-8577463 GGGACTTACCTAAGGTCACATGG - Intronic
1141296391 16:82773506-82773528 GAGACCTACCTAATGTTCAAAGG - Intronic
1142900530 17:3008620-3008642 GGGACTTGCCTATAGTTCCATGG - Intronic
1143509145 17:7385925-7385947 GTGACTTGCCTAAAGTCACATGG + Intronic
1144424956 17:15132985-15133007 GAGACATCCCTAAAGTCCCATGG - Intergenic
1148032638 17:44632098-44632120 GTGACTTGCCTAAAGTCCCTGGG - Intergenic
1149995975 17:61406060-61406082 GGGACTTGCCAAAGGTCACACGG - Intronic
1150631737 17:66884923-66884945 GGGGCCTGCCTCATCTCCCTTGG - Intronic
1151573996 17:74942137-74942159 GGCAAATACCTAATGTCCCAGGG + Intronic
1152029664 17:77834243-77834265 GGGATCAGTCTAATGCCCCAGGG + Intergenic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1152905762 17:82970149-82970171 GGGCTCTTCCTGATGTCCCAGGG - Intronic
1153838679 18:8987049-8987071 GTTACCTGTCTAAAGTCCCATGG + Intergenic
1158491231 18:57911321-57911343 GGGAACTGCCTGAAGTCCCATGG - Intergenic
1161040945 19:2110498-2110520 TGGACCTGGCTAGAGTCCCAAGG - Intronic
1161617970 19:5282817-5282839 GGGACCTGCCTTTGGTCACACGG + Intronic
1161996005 19:7711858-7711880 GGCACATGCCTATAGTCCCAAGG - Intergenic
1163703047 19:18796035-18796057 GGCACCTGCCAAAGGTCACACGG - Intergenic
1163895473 19:20054489-20054511 GGCACGTGCCTATAGTCCCAGGG + Intergenic
1164035305 19:21449147-21449169 GGGAACTGCCCCATGTGCCAAGG - Intronic
1165717195 19:38053998-38054020 GGGACCTGTCCAAGGTCACACGG + Intronic
1166997827 19:46728176-46728198 GTGACCTGCCCACTGCCCCACGG - Intronic
1167237231 19:48322285-48322307 GGGACCCCCCTAATATCCCCAGG + Intronic
1168148479 19:54432447-54432469 GGGACCTTCCCAAGGTCACACGG + Intronic
926001816 2:9339352-9339374 GGAACCTGCCCAGTGTCACAGGG - Intronic
926542305 2:14196556-14196578 GGGACCTGCCCAGTGTCCAGGGG - Intergenic
927684336 2:25160444-25160466 GAGACTTGCCTAAGGTCCCATGG + Intergenic
927915656 2:26934447-26934469 GGGACCTGCCCAAGCTCACAGGG - Intronic
929456817 2:42072088-42072110 TGAACCTGTGTAATGTCCCATGG - Intergenic
931566994 2:63624999-63625021 GGAACCAGCCTTGTGTCCCAGGG - Intronic
933183953 2:79258325-79258347 GGGAACTGCCCAAGGTCGCATGG - Intronic
933773842 2:85760018-85760040 TGGACCTGCCTAAGGTCACATGG + Intronic
934603898 2:95679840-95679862 GGGACCTGCCCAAAGTCACAGGG - Intergenic
935747851 2:106204809-106204831 AGGACCTGACTCATGTCACATGG - Intergenic
936122274 2:109757280-109757302 AGGACCTGACTCATGTCACATGG + Intergenic
936222419 2:110614194-110614216 AGGACCTGACTCATGTCACATGG - Intergenic
936537282 2:113322069-113322091 GGGACCTGCCCAAAGTCACAGGG - Intergenic
936670123 2:114646963-114646985 GGGCCTTGACTAAAGTCCCATGG + Intronic
937771336 2:125723675-125723697 CAGACCAGCCTACTGTCCCAAGG + Intergenic
938125501 2:128667975-128667997 GAGACCTGCCTTATGTCCTAAGG + Intergenic
938669745 2:133575194-133575216 GGCTCCTGCCTAATAGCCCAGGG - Intergenic
939759458 2:146156113-146156135 GGCACCTGACTCATGTACCAAGG - Intergenic
941653731 2:168121219-168121241 AGGACCTGCCCAAAGTCACATGG - Intronic
942504465 2:176626930-176626952 GTGACCTGCTTAACGTGCCAGGG + Intergenic
947346768 2:229199659-229199681 GGAAGCTGCTTAATGTTCCATGG + Intronic
948378877 2:237539775-237539797 GTGACCTGCCGAAGGTCACATGG + Intronic
1172880734 20:38198403-38198425 GGGACTTGCCTAGAGTCCCACGG - Intergenic
1172973502 20:38890042-38890064 GTGACCTGCCTGAGGTCACATGG + Intronic
1173659095 20:44720622-44720644 GGGACATGCTTCATGTCACACGG + Intronic
1174039033 20:47686212-47686234 GGGACCTGCCCGCTGTCTCACGG - Intronic
1174177492 20:48654129-48654151 GGGACTTGCCGAAGGTTCCAGGG - Intronic
1175818869 20:61897780-61897802 GGGACCTGCCTGAGGCCCCCTGG - Intronic
1181164534 22:20976328-20976350 GTGCCCTGCCTAGTGTCCGATGG - Intronic
1181312019 22:21950047-21950069 GGAACTTGCCCAAAGTCCCAGGG + Intronic
1181748752 22:24974246-24974268 GAGACCTGCCCAATGTCACAAGG - Intronic
1181936912 22:26445601-26445623 GGGACTTGCCCAAGGTCCCGAGG - Intronic
1181966115 22:26657712-26657734 GGGAACAGCCTAATTCCCCAAGG + Intergenic
1182432309 22:30306989-30307011 GGGACTTGCCTAATGTAGAAAGG - Intronic
1184241928 22:43215629-43215651 GGGACCTGACTCAGGGCCCAGGG - Intronic
1185388506 22:50547222-50547244 GGGACCTCCCTGCTGACCCAGGG - Intergenic
949928357 3:9059379-9059401 GGGAGCTCCCAAATGGCCCAAGG - Intronic
952161787 3:30701091-30701113 GGCACCTGCCTACTGTTCCATGG - Intergenic
953235239 3:41100806-41100828 GGAACCTGCCTAAGGCCACATGG + Intergenic
954466051 3:50655504-50655526 TGGACCTGCCTAATGGCACTGGG - Intergenic
954610959 3:51944287-51944309 GGCACCTCCCAACTGTCCCAGGG + Intronic
954811045 3:53248220-53248242 GTGACTTGCCTAAAGTCACACGG + Intronic
956498472 3:69854820-69854842 TAGACCTGTCAAATGTCCCATGG + Intronic
959566150 3:107834783-107834805 AGGACCTGCCTGAGATCCCACGG - Intergenic
960906031 3:122602401-122602423 GGTATCTGCCTGATCTCCCAGGG - Intronic
961201082 3:125046060-125046082 GATAGCTGCCTAATGTCCCTAGG - Intronic
961241448 3:125415451-125415473 ATGACCTACCTAAAGTCCCAGGG + Intergenic
961379875 3:126490056-126490078 GTGACCTGCCCAAGGTCTCATGG - Intronic
961637895 3:128344525-128344547 GTGACCTGCCCAAGGTCACAGGG + Intronic
964048613 3:152362702-152362724 GGGTATTGCCAAATGTCCCATGG + Intronic
968335964 3:197913853-197913875 GGTTCTTGGCTAATGTCCCAGGG + Intronic
968428340 4:537618-537640 GGGACCCGCCTAAGGAGCCAGGG + Intronic
970367821 4:15378252-15378274 GTGACTTGTCTAGTGTCCCATGG - Intronic
973809618 4:54557344-54557366 GGGACTTGCCTAGGGTTCCATGG + Intergenic
985209662 4:187579089-187579111 GGTTCTTGGCTAATGTCCCACGG - Intergenic
985548733 5:522862-522884 TGGACCTCCCTGATGCCCCAGGG + Intronic
987182720 5:15384797-15384819 GGGAGCTGCCTGAGGTCCCCTGG - Intergenic
988222194 5:28362147-28362169 GGGGCCTGCCTTTAGTCCCAGGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
992727066 5:79618251-79618273 GGGTCTTGCCTTGTGTCCCAGGG + Intronic
997199635 5:132002121-132002143 GGGTCCTGCCTGCTGTCCCAGGG - Intronic
997395184 5:133553996-133554018 GTGACGTGCCTGAGGTCCCAGGG - Intronic
997752373 5:136358675-136358697 GGGACCTGCTCAAGGTCTCAAGG - Intronic
998135467 5:139671928-139671950 GCCACCTGCCTAAGGTCACAAGG - Intronic
999182354 5:149678725-149678747 GTGACTTGCCTAATGTCCCATGG - Intergenic
999928869 5:156408853-156408875 GGGACTTGCCTAAAGTCACCAGG - Intronic
1000426739 5:161100012-161100034 GGGAACTGTCTAATGTCACTTGG - Intergenic
1001467659 5:171982858-171982880 GGGTCCTGCCTTATACCCCAGGG + Intronic
1005870988 6:29974537-29974559 GGGAACAGCATAAGGTCCCAAGG + Intergenic
1006162979 6:32048671-32048693 GGGTCCTGCCTCCTGACCCATGG - Intronic
1006991493 6:38218511-38218533 TGGACCTGCCAGATGTCCCCTGG + Intronic
1009289808 6:61868451-61868473 GGGTCCTGCTTAATGTCCCAGGG + Intronic
1009770591 6:68138938-68138960 TGGACATGCCTAATCTCCCTTGG - Intergenic
1009788408 6:68367685-68367707 GGGCCCTGCATAAAGTTCCATGG - Intergenic
1013295195 6:108752578-108752600 GGGACAGGCCTACTGGCCCATGG - Intergenic
1013400767 6:109794318-109794340 GGGAACAGCCTAAAATCCCACGG - Intronic
1020035866 7:4962797-4962819 GGGACCTTCCCAAGGTCACAGGG + Intergenic
1020963360 7:14834303-14834325 ATGACTTGGCTAATGTCCCAAGG + Intronic
1022636423 7:32140615-32140637 GGGACCTGCAGAATGTCTGATGG - Intronic
1023865535 7:44236498-44236520 GCCACCTCCCTGATGTCCCAAGG + Intronic
1029814779 7:103081967-103081989 AGGATCTGCCTAAAGTCACAGGG - Intronic
1030621555 7:111796085-111796107 GGGACCTCCCAGATGCCCCAGGG - Intronic
1034505507 7:151486689-151486711 GGCTCCTGCCTAATATCCCTGGG - Intronic
1034840706 7:154392837-154392859 GGGCCCTCCCCAAAGTCCCATGG + Intronic
1036760926 8:11508083-11508105 GGAACCTGCCCACTGGCCCAGGG + Intronic
1037490213 8:19390688-19390710 GGAACCTGCCCTCTGTCCCATGG + Intronic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1039787257 8:40844862-40844884 GTGACTTGCATAATGTCACATGG + Intronic
1043924140 8:86017637-86017659 GCCACCTGCCTCATGTCCAAGGG - Intronic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1048360271 8:133691681-133691703 GGGACCTACCTAAAGTCTCATGG - Intergenic
1049612004 8:143560201-143560223 GGGACTTTCCTGATGCCCCAAGG - Intronic
1049795150 8:144493789-144493811 GGAACCTGCCCAGAGTCCCATGG + Intronic
1052960419 9:34291390-34291412 GGGACTTGCCTAAGGTCATATGG - Intronic
1057779154 9:98035664-98035686 AGGGCCTGCCTCAGGTCCCATGG - Intergenic
1057800954 9:98191460-98191482 GGGACCTGACCACTGCCCCAGGG + Intronic
1057802961 9:98201096-98201118 GGGACCTGCCCAAGGTCTCTGGG + Intronic
1059291429 9:113228113-113228135 GTGATTTGCCTAATGTCACATGG + Intronic
1060810478 9:126609256-126609278 AGGACCTTCCTGAGGTCCCATGG + Intergenic
1060964773 9:127706453-127706475 AGGACCTGCCCGCTGTCCCACGG + Intronic
1061392810 9:130327228-130327250 GGGAGCTGCCCCATGGCCCAGGG + Intronic
1061608370 9:131729135-131729157 GAGACCTGCCTCATGGCCCCTGG - Intronic
1185966335 X:4608059-4608081 TGGAATTGCCAAATGTCCCATGG - Intergenic
1189173283 X:38930169-38930191 GTGACCTGCCTAATATAGCAGGG - Intergenic
1193185126 X:78502473-78502495 GAGACTTGCCCCATGTCCCATGG - Intergenic
1197174595 X:123471853-123471875 GGGATCAGCCTCATGTGCCAAGG - Intronic
1197714050 X:129693529-129693551 GTGACCTGCCTAAGGTCACACGG - Intergenic
1199769270 X:150963903-150963925 GGCTCCTGCCTCATGGCCCAGGG - Intergenic
1202368345 Y:24181721-24181743 GGGACTTGCTTAAAGCCCCAGGG + Intergenic
1202372351 Y:24207464-24207486 GGGACTTGCCTAAAGCCCCAGGG - Intergenic
1202498434 Y:25462656-25462678 GGGACTTGCCTAAAGCCCCAGGG + Intergenic
1202502440 Y:25488396-25488418 GGGACTTGCTTAAAGCCCCAGGG - Intergenic