ID: 902519764

View in Genome Browser
Species Human (GRCh38)
Location 1:17009620-17009642
Sequence TAGGAGGATCAGCATGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902519764_902519770 0 Left 902519764 1:17009620-17009642 CCGGCCTCATGCTGATCCTCCTA 0: 1
1: 0
2: 0
3: 27
4: 265
Right 902519770 1:17009643-17009665 CCTCAGCCTCCCAAAGTGCTGGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
902519764_902519768 -1 Left 902519764 1:17009620-17009642 CCGGCCTCATGCTGATCCTCCTA 0: 1
1: 0
2: 0
3: 27
4: 265
Right 902519768 1:17009642-17009664 ACCTCAGCCTCCCAAAGTGCTGG 0: 29290
1: 126310
2: 222091
3: 221515
4: 248765
902519764_902519772 8 Left 902519764 1:17009620-17009642 CCGGCCTCATGCTGATCCTCCTA 0: 1
1: 0
2: 0
3: 27
4: 265
Right 902519772 1:17009651-17009673 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
902519764_902519775 27 Left 902519764 1:17009620-17009642 CCGGCCTCATGCTGATCCTCCTA 0: 1
1: 0
2: 0
3: 27
4: 265
Right 902519775 1:17009670-17009692 CAGGTGTGAGCCACCACACCCGG 0: 4448
1: 21565
2: 68153
3: 144733
4: 196449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902519764 Original CRISPR TAGGAGGATCAGCATGAGGC CGG (reversed) Intronic
900018678 1:171833-171855 GAGGGGGAACAGCATGAGCCAGG + Intergenic
900048936 1:530428-530450 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900071167 1:772252-772274 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900114420 1:1022406-1022428 CAGGGTGATCCGCATGAGGCTGG - Exonic
900207178 1:1436535-1436557 TCAGAGGAGCAGCCTGAGGCTGG - Intronic
901119411 1:6878522-6878544 TGAGAGGATCTGCATGAGGCAGG - Intronic
901396078 1:8982810-8982832 TAGAAATATGAGCATGAGGCTGG + Intergenic
902519764 1:17009620-17009642 TAGGAGGATCAGCATGAGGCCGG - Intronic
904358825 1:29959488-29959510 AAGGAGGACCAGCAGCAGGCAGG + Intergenic
904382932 1:30123853-30123875 GATGTGGCTCAGCATGAGGCAGG - Intergenic
904654571 1:32034679-32034701 TAGAATGTTCAACATGAGGCAGG + Intronic
904692402 1:32303362-32303384 TAGGAGGATCATTTTGAGTCTGG + Intronic
904912491 1:33945717-33945739 TTGGAGGAAGAGCATTAGGCTGG + Intronic
909599475 1:77446933-77446955 TATGAGGATCAGCTGGAGCCGGG + Intronic
909941073 1:81612357-81612379 TAGGAGGATTAGCAAGATCCAGG - Intronic
913114585 1:115684677-115684699 CAGGAGCATCAGCATCACGCAGG - Intronic
913178040 1:116292902-116292924 TGGGAGGATCAACATGATGCTGG - Intergenic
916953483 1:169807134-169807156 TAGGGAGAGCAGCATGAGACAGG - Intronic
917494020 1:175523958-175523980 TAGGAGGAGCAGCATGGGCAAGG - Intronic
917528324 1:175809800-175809822 TAGAATGATCAATATGAGGCTGG - Intergenic
918669883 1:187201733-187201755 GAGGAAGATCAGGATGAAGCAGG - Intergenic
920345687 1:205304375-205304397 CAGGAGGCTCCGCATGAGGGTGG - Exonic
921021006 1:211235621-211235643 TTGGAGGATCACAATGAGGTTGG + Intergenic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
922819415 1:228473802-228473824 TAGAAGATTCAGCTTGAGGCTGG - Intergenic
923606926 1:235452640-235452662 TAGGAGGATCAACTTGAGCCTGG - Intronic
924144987 1:241064493-241064515 TGGGAGGATCTGCTTGAGCCAGG + Intronic
924246374 1:242089505-242089527 TAGGAAGCTTAGCATGAGGTGGG - Exonic
924348712 1:243095267-243095289 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1064508398 10:16061413-16061435 TGGGAGGGTGAGCATGAGGATGG + Intergenic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1065475646 10:26135450-26135472 AAGGAGAATCAACATAAGGCAGG + Intronic
1065745076 10:28832832-28832854 TGGGAGGATCAGCTTGAGCCTGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1066727648 10:38409636-38409658 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1070048697 10:72865632-72865654 TGGGAGGATCTGCTTGAGTCTGG - Intronic
1070806003 10:79271075-79271097 TAGGCGGCTCAGAAGGAGGCAGG + Intronic
1071770316 10:88722068-88722090 TGGGTGGATCAGCAGGAGTCAGG + Intergenic
1072107881 10:92291271-92291293 GAGGAGGAGGAGCCTGAGGCGGG - Exonic
1072205958 10:93205475-93205497 TAGGAGGATCTGAATCATGCTGG + Intergenic
1072555503 10:96511635-96511657 TTGGAGGATAACCCTGAGGCAGG - Intronic
1073404514 10:103285521-103285543 TAGGAGGATCACCTGGAGTCGGG - Intronic
1073998329 10:109341424-109341446 TAGGAGGAGAAGAATGGGGCGGG + Intergenic
1074449374 10:113546764-113546786 TATGAGGCTGAGCATGAGTCTGG - Intergenic
1075111096 10:119585194-119585216 TAGGAGGATGAGGCAGAGGCAGG + Intronic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1076975280 11:167029-167051 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1078469210 11:11573593-11573615 CAGCTGGATCAGCAAGAGGCTGG + Intronic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1079110515 11:17602660-17602682 GAGGAGGAGGAGCATGAGGAGGG - Intronic
1080612925 11:33920619-33920641 GAAGAGGAGCAGCATGAGGTTGG + Intergenic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082858186 11:57828228-57828250 TAGGGAGAACAGGATGAGGCAGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083038580 11:59664683-59664705 TAGGAGGTTGAGGCTGAGGCTGG - Intronic
1085057563 11:73415419-73415441 CAGGAGGATCTTCATGAGGCTGG + Intronic
1089461815 11:118658298-118658320 CAGGAGGCTGAGCAGGAGGCTGG + Exonic
1089751677 11:120655830-120655852 TAGGAGGAGGAGCAGGTGGCGGG + Intronic
1089990845 11:122858316-122858338 CAGGAGGATCAACTTGAGCCTGG - Intronic
1090779068 11:129990697-129990719 TGGGAGGATCACTTTGAGGCCGG - Intronic
1091947596 12:4562238-4562260 CGGGAGGAGCTGCATGAGGCCGG - Intronic
1092595482 12:9999684-9999706 TTGAAGGATCCACATGAGGCAGG + Intronic
1092947973 12:13474663-13474685 TAGGAGGGTGAGCAGCAGGCTGG - Intergenic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1094189965 12:27687990-27688012 TAGGAGGATCCGTCTGAGCCTGG + Intronic
1096141056 12:49242895-49242917 TGGGAGGATCAGCTTGAGCCTGG - Intronic
1097188160 12:57206666-57206688 TAGGAGGCGCAGCAGGTGGCAGG - Exonic
1098958948 12:76718372-76718394 AAAGAGGATGAGGATGAGGCAGG + Intergenic
1099568945 12:84288917-84288939 TAGCAGGAACAGCATGACCCTGG - Intergenic
1100619098 12:96254840-96254862 TTGAAGGATCAGCCTGTGGCAGG + Intronic
1100694399 12:97075852-97075874 TCGGAGGATCACCAAGAGGTGGG - Intergenic
1100818417 12:98407890-98407912 TAGGAGGATCTGCTTGAGCCTGG + Intergenic
1100870690 12:98907423-98907445 GAGCAGGACCAGCATGAGACAGG - Intronic
1101578454 12:106019759-106019781 TAGGAGGAAGAGCAGGAAGCAGG - Intergenic
1101586718 12:106091497-106091519 TAGAAGGGTCAGCATGAGGAAGG + Intronic
1104186037 12:126432584-126432606 GAGGGGGATCAGCTTGAGCCTGG - Intergenic
1105457133 13:20551417-20551439 TAGGAGGATGAGTAAGAGGAAGG + Intergenic
1106731706 13:32547998-32548020 TAGGAGGATTTGCTTGAGCCTGG + Intergenic
1107337470 13:39370352-39370374 TAGAAGGTCCAGCATGAGCCTGG - Intronic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1113873733 13:113581626-113581648 TGGGAGGACAAGCAGGAGGCAGG - Intergenic
1114257600 14:21016720-21016742 TAGGAAGAGGAGCATGATGCAGG + Intergenic
1114430915 14:22659732-22659754 TAGGAGGATCTGCTTGAGCCAGG + Intergenic
1114557656 14:23571175-23571197 TATGAGGCTGAGGATGAGGCTGG - Exonic
1114647889 14:24265705-24265727 GAGGAGGACCAGCCTGGGGCAGG + Exonic
1117396343 14:55313994-55314016 TAGGAGGATCACTTTGAGCCAGG - Intronic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118165077 14:63328222-63328244 TTGGAGGATCAGGATCAGGGCGG - Intergenic
1120274504 14:82354486-82354508 TTGGAGGATGAGCTTGAGGATGG - Intergenic
1121435550 14:93916915-93916937 TGGGAGGAAGAGCGTGAGGCAGG - Intergenic
1125466729 15:39960604-39960626 TATGAGGAACAGGATGGGGCGGG + Intronic
1125719290 15:41837525-41837547 TATGAGGACCAGCATGGAGCTGG + Exonic
1125751851 15:42034572-42034594 TAAGAGGATGAGAATGAGACTGG - Intronic
1128480663 15:68035166-68035188 TAGGAGGATCTGCTTGAGCCTGG - Intergenic
1128676857 15:69615978-69616000 TAGGAGGAGCTGGGTGAGGCGGG + Intergenic
1129314438 15:74732688-74732710 GAGGAGGAAGAGAATGAGGCAGG - Intergenic
1129638676 15:77351376-77351398 AAGTATGATCAGAATGAGGCAGG + Intronic
1130414000 15:83672938-83672960 TGGGAGGTCCAGCATGTGGCAGG + Intronic
1130960421 15:88655244-88655266 TAGGAGACTCAGCAGGTGGCTGG - Intronic
1132032520 15:98450322-98450344 TAGAAGGAGCAGCATGAGCCAGG + Intronic
1132063872 15:98714551-98714573 TGGGAGGATCCGCCTGAGCCTGG + Intronic
1133958228 16:10466021-10466043 TAGGAGAACAGGCATGAGGCAGG - Intronic
1134441362 16:14301573-14301595 AAGTAGGAGCAGCATCAGGCAGG - Intergenic
1138053286 16:53805539-53805561 TAGGAGGATCCACTTGAGCCTGG - Intronic
1138480348 16:57298641-57298663 CAGGAGGCTGAGGATGAGGCAGG + Intergenic
1139436998 16:66942076-66942098 CAGGTGGATCAGGAAGAGGCAGG - Intronic
1140063929 16:71593995-71594017 TAGGAGGTTCAGGATGAGCCTGG + Intergenic
1140992770 16:80230451-80230473 AATGAGAATCAGCATCAGGCTGG - Intergenic
1141724392 16:85777559-85777581 TAGGAGGCTGAGCAGGAGGATGG - Intronic
1142444980 16:90130630-90130652 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1142462530 17:104836-104858 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1142520124 17:498647-498669 TGGGAAGATCAGCATGGGCCAGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1144048110 17:11471353-11471375 AGGGAGGACCAGCAGGAGGCTGG - Intronic
1145882151 17:28360185-28360207 CAGGAGGATCACCTTGAGGCTGG - Intronic
1145999695 17:29123666-29123688 TAGGAGGATCACCACGTGGCTGG + Intronic
1146914838 17:36671966-36671988 GAGGAGGATCTGCAGGGGGCAGG - Intergenic
1146963059 17:37001224-37001246 TGGGAGGATCTGCTTGAGGTTGG + Intronic
1146976374 17:37116310-37116332 TAGGAGAGACAGCATGAGACTGG + Intronic
1148028289 17:44603215-44603237 GAGGGGGATCTGGATGAGGCTGG + Intergenic
1148921307 17:51037194-51037216 CAGGAGGATCAACTTGAGCCTGG - Intronic
1149655721 17:58308743-58308765 TCGGAGGATGAGCAGGAGGCGGG - Exonic
1150440518 17:65187699-65187721 TAAGAGGGTCCGCGTGAGGCCGG + Intronic
1156173192 18:34511138-34511160 TACTAGGATCAGCATGAGTAAGG + Intronic
1157285936 18:46377476-46377498 TAGGAGGGGCAGCAAGTGGCTGG + Intronic
1160652237 19:237212-237234 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1162023185 19:7877822-7877844 CAGGAGGATCCCCTTGAGGCCGG + Intergenic
1162147291 19:8620633-8620655 GAGGAAGATGAGGATGAGGCAGG + Intergenic
1162720743 19:12661051-12661073 TAAGAAGTCCAGCATGAGGCCGG - Intronic
1163505811 19:17705496-17705518 TTGGAGGATCAGAGTGAGTCCGG - Intergenic
1167384393 19:49155546-49155568 GAGGAGGAGGAGCAGGAGGCAGG - Intergenic
1168209749 19:54881767-54881789 GAGGAGGATGAGGCTGAGGCAGG + Intronic
1168290262 19:55354124-55354146 TAGGAGGAGCAGTGTGAGGGAGG - Exonic
925142307 2:1558715-1558737 TAAGAAGATCAGAAGGAGGCAGG - Intergenic
925315799 2:2922188-2922210 CTGGAGGGTCAGCATGAGGCTGG - Intergenic
926103715 2:10137315-10137337 TGGGCGGACCAGCATGGGGCTGG - Intergenic
927330632 2:21859342-21859364 AAGGAGGATCTGTAAGAGGCTGG + Intergenic
927902593 2:26831547-26831569 CAGGAAGTTCAGCATGAGACAGG + Intergenic
928826436 2:35427024-35427046 TAGGAGGAGAAGGAGGAGGCAGG + Intergenic
929022445 2:37566892-37566914 CAGCAGGATCTGGATGAGGCAGG + Intergenic
929589042 2:43133444-43133466 TGGGTGGACCAGCCTGAGGCTGG + Intergenic
930029025 2:47047162-47047184 CAAGAGGATCAGGAAGAGGCAGG - Intronic
930697292 2:54424948-54424970 TCGGTGGATCAGCATGTGGGTGG - Intergenic
932432495 2:71684371-71684393 TGGGAGGAGGAGCTTGAGGCAGG - Intronic
932573452 2:72950360-72950382 AACCAGGATCAGCATGAGGTGGG - Intronic
932607343 2:73174336-73174358 TAGGTGGAACAGCGCGAGGCAGG - Intergenic
932759066 2:74427786-74427808 GAGGAGGAGCAGCTTGAGACAGG + Intronic
935103777 2:100020786-100020808 TAGGAGGCTCTGCAGGGGGCTGG - Intronic
935483076 2:103617377-103617399 TGGGAGGATCTGCTTGAGTCTGG - Intergenic
935504672 2:103885405-103885427 AAGGAAGATGAGCAGGAGGCTGG + Intergenic
937077969 2:119120863-119120885 TAGGAGGATCAGGAAGAGTTTGG + Intergenic
938845238 2:135201558-135201580 TAGGAGAATCAGCTTGAACCCGG + Intronic
944461351 2:199954192-199954214 TCGGAGGATCTGCTTGAGCCCGG - Intronic
947667316 2:231914442-231914464 TTGGAGGAACACCATGGGGCGGG - Intergenic
947821028 2:233069965-233069987 TAGGAAGGTTAGAATGAGGCGGG - Intronic
947910211 2:233795783-233795805 TGGGTGGATCAGCAGGAAGCTGG + Intronic
948220810 2:236268291-236268313 TGGGAGGATTAGAATGAGCCCGG - Intergenic
1170008658 20:11696621-11696643 TAGGAGGATGAGATTGAAGCTGG - Intergenic
1170614826 20:17940057-17940079 CAGGAGGAACAGCATCAGGTGGG - Intergenic
1170989315 20:21287515-21287537 TCTGAGGATAAGCATGAGGTTGG + Intergenic
1171148711 20:22808328-22808350 TAGAAGCATCAGTTTGAGGCTGG + Intergenic
1172414024 20:34749779-34749801 TAGCAGGATCACCATGCTGCTGG + Exonic
1173040567 20:39458570-39458592 AAGGAGGAGCAGCATGAGAGGGG + Intergenic
1173602862 20:44308492-44308514 TGGGAGAAACAGCATGAGTCTGG - Intronic
1174237360 20:49104886-49104908 CAGGAAGATCAGCCTGAGCCTGG + Intergenic
1178081900 21:29074668-29074690 TTGGAGGATCTGCTTGAGCCTGG + Intergenic
1178775332 21:35544774-35544796 AGGGAGGATCAGCAAGAGGCAGG - Intronic
1179992651 21:44956690-44956712 AAGGAAAATCAGCATGAGACCGG - Intronic
1181257482 22:21573219-21573241 TAGTAGGGTGAGGATGAGGCTGG + Intronic
1183677935 22:39310204-39310226 TGGGAGGATCCGCTTGAGCCTGG - Intergenic
949705893 3:6816456-6816478 TGGGAGCATCAGCTTGGGGCTGG + Intronic
949966556 3:9361725-9361747 TGGGAGGGTCAGCATCAGGCTGG - Intronic
950198325 3:11025474-11025496 CAGGATGATCAGCATGATGTAGG - Exonic
950784622 3:15423788-15423810 TGGGAGGATCTGCTTGAGCCAGG + Intronic
953465694 3:43117439-43117461 TAGGAGGGGCAGCATGATCCTGG - Intergenic
953707850 3:45244779-45244801 TAAGTGGATCAGCATGGTGCTGG + Intergenic
954903889 3:54043367-54043389 TAAGAGGATAAGAGTGAGGCTGG + Intergenic
955453207 3:59092810-59092832 TAGAAGGATAATCATGAGACTGG - Intergenic
956063278 3:65370172-65370194 TAGGAGCATCACCATGAACCCGG + Intronic
956197344 3:66666113-66666135 TAGGAGGAAAAGCAAGAGGGTGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961485698 3:127214168-127214190 CAGGTGGATCAGCTTGAGCCAGG + Intergenic
963897868 3:150705241-150705263 CGGGAGGATCAGCTTGAGCCGGG - Intergenic
964071106 3:152634359-152634381 TTGAAAGATCAGCATCAGGCCGG - Intergenic
964773660 3:160252479-160252501 AAGGAGGGACAGCTTGAGGCAGG + Intronic
965899126 3:173617068-173617090 TAGAAGGATCAGCATGTGCAAGG - Intronic
966219502 3:177536274-177536296 TAGGAGGACAAAGATGAGGCTGG - Intergenic
967713188 3:192733035-192733057 CAACAGGATCACCATGAGGCAGG + Intronic
967859321 3:194139732-194139754 TGGGAGGAGAAGGATGAGGCGGG + Intergenic
968365596 3:198182760-198182782 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
969677110 4:8620249-8620271 TAGCATGATCAGGATGAGGGAGG - Intergenic
969678063 4:8625888-8625910 TAGCATGATCAGGATGAGGGAGG - Intergenic
969679018 4:8631525-8631547 TAGCATGATCAGGATGAGGGAGG - Intergenic
970506543 4:16736075-16736097 TAGGAGGAAAAGCACCAGGCGGG - Intronic
970521234 4:16885986-16886008 CAAGAGGATCACCATGAGCCAGG + Intronic
971300489 4:25438136-25438158 TAGCAGGAACAGCATGTGGCTGG - Intergenic
972969763 4:44558969-44558991 TTGGAAGATCAGAATGAGGTCGG + Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974935809 4:68408717-68408739 CAGGAGGCTCAGGCTGAGGCAGG - Intergenic
975126555 4:70788826-70788848 GATGCAGATCAGCATGAGGCAGG + Exonic
977798089 4:101192492-101192514 TGGGAGGATGAGACTGAGGCTGG - Intronic
978159034 4:105524334-105524356 TGGGAGGATCAGCCTGAGCCTGG + Intergenic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
978989145 4:115056257-115056279 TAGGAGGATCAACCTGAGCCTGG + Intronic
979254630 4:118597927-118597949 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
979334331 4:119448104-119448126 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
980403626 4:132326607-132326629 TAGGAGGATCAGCAAGATTAAGG + Intergenic
980907074 4:138958661-138958683 TAGGAAGATCAGTTTGAGGGTGG + Intergenic
981045727 4:140263379-140263401 AAGAAGGGTGAGCATGAGGCCGG + Intronic
981455126 4:144944846-144944868 ATGGAGGATCATCATGAGGCAGG - Intergenic
982501662 4:156164706-156164728 TAGGAAGATCAGAATTAGGGAGG + Intergenic
982769379 4:159381915-159381937 GAGGAGGAGGAGGATGAGGCAGG + Intergenic
984552732 4:181180333-181180355 TAGAAGGATCAGCATGAACAAGG - Intergenic
985546568 5:512873-512895 TAGGTGGGTCAGGATGAGACTGG - Intronic
986535938 5:8787148-8787170 TAGCAGGATCAGCAAGTGACAGG - Intergenic
986614995 5:9606825-9606847 GAGAAGGATCAGCCTGAGGAAGG + Intergenic
989634626 5:43521054-43521076 GAGGAGGAACAGCATGAAGATGG + Intergenic
991033184 5:62103237-62103259 TGGGAGGATCATGATGAAGCTGG + Intergenic
992299894 5:75367262-75367284 TAGGAAGATGAGCAAGAGACAGG - Intergenic
994471355 5:100212010-100212032 TACGAGAATATGCATGAGGCTGG + Intergenic
994947640 5:106416312-106416334 GATGCAGATCAGCATGAGGCAGG - Intergenic
997342740 5:133158425-133158447 TAGGAGGATTCGCTTGAGCCTGG - Intergenic
998889797 5:146734146-146734168 TGGGAGGATCTGCTTGAGCCAGG - Intronic
999417226 5:151409090-151409112 TGGGAGGATCACCCTGAGCCTGG - Intergenic
999639792 5:153661048-153661070 GAGGAGCAGCAGCATGGGGCTGG - Intronic
1000313445 5:160066524-160066546 TGGGTGGATCATCTTGAGGCCGG - Intronic
1001907762 5:175487198-175487220 CAGGAGGTCCAGCATAAGGCTGG - Intronic
1002062458 5:176633903-176633925 TAGAAAGATCAGTAGGAGGCTGG + Intronic
1005712521 6:28515641-28515663 TAGGAAGGTGAGCATGGGGCAGG - Exonic
1006094073 6:31644900-31644922 GAGCAGGATCAGCATGATGAGGG - Intronic
1006269620 6:32953749-32953771 TAGGAGGAACATAATCAGGCAGG + Intronic
1006500516 6:34456023-34456045 AAGGAGTATCCACATGAGGCAGG + Intergenic
1007222945 6:40293469-40293491 CAGCAGGAACAGCATCAGGCTGG - Intergenic
1007883890 6:45203706-45203728 CAGAAGGCTCTGCATGAGGCTGG - Intronic
1008557329 6:52686006-52686028 TCTCAGGATCATCATGAGGCTGG - Exonic
1008925013 6:56882958-56882980 CAGGAGGATCAGCTTGAACCTGG - Intronic
1009187910 6:60595925-60595947 GAGGAGGATATCCATGAGGCAGG - Intergenic
1011166666 6:84455179-84455201 TGGGAGGATCAGCTTGGGCCTGG + Intergenic
1011430961 6:87286195-87286217 TTAGATGATCATCATGAGGCAGG - Intronic
1014069267 6:117162162-117162184 TAGGACAATGACCATGAGGCAGG - Intergenic
1015878938 6:137851742-137851764 TAGGAGGATGAGGAGTAGGCAGG - Intergenic
1015935364 6:138403018-138403040 TGGGAGGATCGGCTTGAGCCTGG - Intergenic
1016324060 6:142879772-142879794 TGGGAGGGTCAGAAGGAGGCTGG - Intronic
1017019783 6:150130866-150130888 TGGGAGGAGCAGGAAGAGGCTGG + Intergenic
1017909726 6:158782473-158782495 TTCAAGGAACAGCATGAGGCTGG + Intronic
1018204184 6:161421483-161421505 AAGCAGGACCAGCATGAGGGTGG + Intronic
1018746786 6:166768525-166768547 TAGGAGTTTCAGCAGGAGACTGG + Intronic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1020212476 7:6166858-6166880 GAGGAGGAACAGCTGGAGGCTGG - Intronic
1023181678 7:37491313-37491335 TAGGAGGCTGAGGCTGAGGCAGG - Intergenic
1025835049 7:65086051-65086073 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1025904822 7:65775530-65775552 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1027202951 7:76074340-76074362 TACAGGGACCAGCATGAGGCAGG + Intergenic
1027903430 7:84148733-84148755 GAGGAGGATCAGGAAGAGGAGGG - Intronic
1028642771 7:93061928-93061950 TAGGAGAATCATCATGAATCTGG - Intergenic
1030301417 7:107977906-107977928 TAGGAGTATCAGGGTGAAGCTGG + Intronic
1031423730 7:121580976-121580998 TGGGAGGATCACCTTGAGACTGG - Intergenic
1032723271 7:134568236-134568258 TATGAGAATCAACATGAGGTGGG + Exonic
1033037150 7:137885391-137885413 TGGGAAGCTCACCATGAGGCAGG + Exonic
1033096287 7:138434175-138434197 TAGCACGATCAGTGTGAGGCAGG + Intergenic
1035781596 8:2232379-2232401 TAGGGGGGTCAGCATGCGGAGGG + Intergenic
1038136063 8:24787029-24787051 TGGGAGGATGAGGCTGAGGCAGG - Intergenic
1043466502 8:80513233-80513255 TGGGAGGATCCGCCTGAGTCCGG - Intronic
1044132987 8:88549401-88549423 TATTAGGAGCAGCAGGAGGCAGG - Intergenic
1045127829 8:99113309-99113331 TAGGAGGTTCAGTATCAGCCTGG - Intronic
1051969287 9:22867254-22867276 CAGGAGGATGAGCAAGAGGGAGG + Intergenic
1052737299 9:32355376-32355398 TATGAGTTTCAGCATGTGGCTGG + Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1053357184 9:37456041-37456063 TGGGAGGATCACCTTGAGCCTGG - Intronic
1055584398 9:77742961-77742983 TAGAAAGATCAGCAGGAGGCTGG + Intronic
1057542593 9:95989330-95989352 TAGGAGCTTCAGGATGGGGCTGG - Intronic
1060896686 9:127223437-127223459 GAGAAGGAGCAGGATGAGGCTGG + Intergenic
1061139184 9:128753857-128753879 GAGGTGGATCCGCGTGAGGCGGG + Exonic
1062095596 9:134701634-134701656 CAGGAGCCTCAGCACGAGGCTGG - Intronic
1062581016 9:137229271-137229293 TGGGAGGCTCCGCAGGAGGCTGG + Exonic
1062749965 9:138245627-138245649 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1185830102 X:3293293-3293315 GAGGAGGAGGAGGATGAGGCAGG + Intergenic
1186694616 X:12017031-12017053 TAGGTCAATCAGCATGAAGCAGG - Intergenic
1187258965 X:17667745-17667767 TAGGAGGATAACCATGGAGCAGG + Intronic
1187327827 X:18308164-18308186 CAGGAGGATCTGCTTGAGCCTGG + Intronic
1188536204 X:31199859-31199881 TAGGACCTTCAGAATGAGGCTGG - Intronic
1189592866 X:42534140-42534162 CAGTAGGATCAGGGTGAGGCAGG + Intergenic
1190787502 X:53665902-53665924 TGGGAGGATAAGCCTGAGGTGGG + Intronic
1194827339 X:98579011-98579033 TAGGAGGCTAAGCATGAAGAAGG + Intergenic
1195469811 X:105219283-105219305 TATGAGTATGAGTATGAGGCAGG + Exonic
1196302797 X:114065709-114065731 CAGCAGGATCAGCAAGGGGCAGG + Intergenic
1197435249 X:126420094-126420116 CAGGAGGATCACCTGGAGGCAGG - Intergenic
1201668806 Y:16491688-16491710 GAGGAGGATCAGGATTTGGCCGG + Intergenic