ID: 902520495

View in Genome Browser
Species Human (GRCh38)
Location 1:17012990-17013012
Sequence AACGATCCCTATTGTGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902520489_902520495 2 Left 902520489 1:17012965-17012987 CCCTAGTCAAGGAAAGGAAAACT 0: 1
1: 0
2: 1
3: 25
4: 406
Right 902520495 1:17012990-17013012 AACGATCCCTATTGTGGAAGGGG 0: 1
1: 0
2: 0
3: 2
4: 75
902520490_902520495 1 Left 902520490 1:17012966-17012988 CCTAGTCAAGGAAAGGAAAACTC 0: 1
1: 0
2: 2
3: 24
4: 356
Right 902520495 1:17012990-17013012 AACGATCCCTATTGTGGAAGGGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902520495 Original CRISPR AACGATCCCTATTGTGGAAG GGG Intergenic
902520495 1:17012990-17013012 AACGATCCCTATTGTGGAAGGGG + Intergenic
903253325 1:22073057-22073079 AACGATCTGTATGGAGGAAGGGG - Intronic
907681869 1:56571899-56571921 GACGATCCCTTTTATAGAAGAGG - Intronic
912725201 1:112053068-112053090 GACAATCTATATTGTGGAAGAGG + Intergenic
1063167407 10:3476305-3476327 AACGATTCCAAGCGTGGAAGGGG - Intergenic
1063170803 10:3508437-3508459 AACGTTTCCTATTATGTAAGAGG + Intergenic
1071360625 10:84842842-84842864 AATGATCCCTCTTCTGGTAGAGG + Intergenic
1075158126 10:119997685-119997707 AACCATCCCTGCTGTGGAACAGG - Intergenic
1076089962 10:127676038-127676060 AACAATGGCTAATGTGGAAGTGG - Intergenic
1077824277 11:5787928-5787950 AATGAACCCTATTGTGTATGGGG - Exonic
1079136375 11:17778056-17778078 CACAAGCCCTTTTGTGGAAGAGG - Intronic
1081688904 11:45062202-45062224 AAAGCTCCCTATTCTGGAAAAGG - Intergenic
1082303053 11:50534326-50534348 ATCGAGGCCTATTGTGGAAAAGG - Intergenic
1092671353 12:10865360-10865382 AACAATTAATATTGTGGAAGTGG + Intronic
1095254151 12:40014329-40014351 AACTATCCCTTTTGTAAAAGAGG + Intronic
1098070112 12:66664912-66664934 AAAAATTCCTATTGAGGAAGGGG - Intronic
1101959293 12:109236609-109236631 ACCGATCCCTGTTGTAGAACAGG + Intronic
1104280221 12:127369920-127369942 AACGATTCCTAGCTTGGAAGTGG - Intergenic
1110347641 13:74466465-74466487 AAGGATTCCTTTTGTGGAATGGG + Intergenic
1112647244 13:101348477-101348499 AACTATCCTCATTTTGGAAGTGG - Intronic
1116318900 14:43434328-43434350 AACGCTCCCTATTCTGGAAATGG - Intergenic
1120940801 14:89947290-89947312 AAGGAGACCTATTGTGTAAGGGG - Intronic
1121058993 14:90885911-90885933 AAAGATCCCTTTTCTGGAAAAGG + Intronic
1128410492 15:67392133-67392155 AACTATCCCTATTTTGGAGATGG - Intronic
1137502849 16:49024649-49024671 ACCAACCCCTATTGTGGAGGAGG - Intergenic
1140786018 16:78342870-78342892 AATGATCCCTTTTGTGCTAGAGG + Intronic
1155854631 18:30817410-30817432 AAAGATCTCCAATGTGGAAGAGG + Intergenic
1167420558 19:49400288-49400310 AAGGTTGCCTATTGTGTAAGTGG - Intronic
926614105 2:14977846-14977868 AACAATCCCTATTGAAGAATTGG - Intergenic
937621247 2:123990114-123990136 AACCATCACAATTGTGGAGGTGG + Intergenic
943437803 2:187888320-187888342 AAGGATCTCTCTTATGGAAGAGG + Intergenic
943891363 2:193290557-193290579 AAGTATCCCAACTGTGGAAGTGG - Intergenic
947998058 2:234545021-234545043 AAGGATCCCCAGTGTGGAAGCGG + Intergenic
1170089527 20:12575460-12575482 CAAGATCCCTGTTGTGGATGTGG + Intergenic
1171353032 20:24519596-24519618 CAGGATCCATTTTGTGGAAGAGG - Intronic
1171739275 20:28842590-28842612 TATGAGCCCTATGGTGGAAGAGG + Intergenic
1171757998 20:29133843-29133865 TATGAGCCCTATGGTGGAAGAGG + Intergenic
1175596781 20:60240986-60241008 AACGATCCTTTTTGTTCAAGGGG + Intergenic
1179555743 21:42174473-42174495 AACGATCCCTCTTGGGAAAAGGG + Intergenic
953391987 3:42539311-42539333 AACACTCCCTATTGTGCAGGTGG - Intergenic
956759924 3:72432090-72432112 AAAGATTTCTATTTTGGAAGAGG - Intronic
960409808 3:117309155-117309177 AACGATTTCTATTTTGGAAATGG + Intergenic
961746310 3:129065529-129065551 TACGGTGCCTATTATGGAAGTGG + Intergenic
964544256 3:157816061-157816083 AACGTGTCCCATTGTGGAAGGGG - Intergenic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
972110832 4:35557220-35557242 AACAAACTCTACTGTGGAAGTGG - Intergenic
977451601 4:97205936-97205958 AACTATTCTTATTTTGGAAGGGG + Intronic
978008264 4:103646325-103646347 AAAAATTCCTACTGTGGAAGTGG - Intronic
979756006 4:124339860-124339882 AACGTTCCACAGTGTGGAAGGGG - Intergenic
981367983 4:143925492-143925514 CAGGGTCCCTAATGTGGAAGAGG - Intergenic
981377780 4:144035771-144035793 CAGGGTCCCTAATGTGGAAGAGG - Intergenic
985038935 4:185869067-185869089 AACTCTGCCTAGTGTGGAAGAGG + Intronic
989833923 5:45959597-45959619 AATGAGGCCTATTGTGGAAAAGG + Intergenic
989838217 5:46023111-46023133 ACCGATGCCTATGGTGGAAAAGG + Intergenic
989945335 5:50219875-50219897 AATGAGACCTATTGTGGAAAAGG - Intergenic
990391533 5:55326620-55326642 AACCATCCTTAGTCTGGAAGGGG - Intronic
992016085 5:72576644-72576666 AACTATGGCCATTGTGGAAGAGG - Intergenic
1003321787 6:5058416-5058438 AACGATGGCTGGTGTGGAAGTGG - Intergenic
1005208103 6:23428275-23428297 AAGAATCCATATTGTGGAAATGG - Intergenic
1007235610 6:40389686-40389708 AACTATAGCCATTGTGGAAGTGG - Intergenic
1008207781 6:48684509-48684531 AAGGATCCATATTGTGAAAATGG + Intergenic
1008443351 6:51558315-51558337 AACAATCCATATTTTGGCAGTGG + Intergenic
1026774955 7:73225725-73225747 AATGTTCCCTATTGAGGCAGGGG + Intergenic
1027015810 7:74779096-74779118 AATGTTCCCTATTGAGGCAGGGG + Exonic
1027072219 7:75166841-75166863 AATGTTCCCTATTGAGGCAGGGG - Intergenic
1028213263 7:88101251-88101273 AAGGGTCCCACTTGTGGAAGAGG + Intronic
1028932987 7:96434579-96434601 AACAATTCCTCTTGTGGAGGTGG - Intergenic
1031572705 7:123378633-123378655 GACCATCGCTATTGTGGAAATGG - Intergenic
1031884990 7:127237036-127237058 AAGGATCCCCAAAGTGGAAGTGG + Intronic
1032551677 7:132790451-132790473 AAGGATTCCTATGATGGAAGAGG + Intronic
1042436978 8:68777228-68777250 AGCTATCCCTCTTGTGGAGGTGG - Intronic
1051262785 9:15281047-15281069 ATCAGTCCCTATTCTGGAAGAGG + Intronic
1052129250 9:24821755-24821777 ATGCATTCCTATTGTGGAAGAGG - Intergenic
1056332036 9:85528975-85528997 AACGATCCCTGGAGAGGAAGAGG + Intergenic
1203384189 Un_KI270438v1:4964-4986 TTAGATTCCTATTGTGGAAGAGG + Intergenic
1203409958 Un_KI270587v1:2859-2881 TATGAGCCCTATGGTGGAAGAGG - Intergenic
1192999097 X:76544227-76544249 AACAATCACTATTGTGAAAATGG - Intergenic
1199998450 X:153042739-153042761 ACCCATCCACATTGTGGAAGAGG + Intergenic