ID: 902525109

View in Genome Browser
Species Human (GRCh38)
Location 1:17052145-17052167
Sequence CAAGATACACACTTTTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902525099_902525109 30 Left 902525099 1:17052092-17052114 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 902525109 1:17052145-17052167 CAAGATACACACTTTTAAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 160
902525101_902525109 27 Left 902525101 1:17052095-17052117 CCTTGGCCTCCCAAAGTGCTGGA 0: 4169
1: 90549
2: 211997
3: 234153
4: 151009
Right 902525109 1:17052145-17052167 CAAGATACACACTTTTAAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 160
902525105_902525109 17 Left 902525105 1:17052105-17052127 CCAAAGTGCTGGAATTACAGGCA 0: 4304
1: 100967
2: 237366
3: 242802
4: 214495
Right 902525109 1:17052145-17052167 CAAGATACACACTTTTAAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 160
902525102_902525109 21 Left 902525102 1:17052101-17052123 CCTCCCAAAGTGCTGGAATTACA 0: 11596
1: 306145
2: 263594
3: 149163
4: 135954
Right 902525109 1:17052145-17052167 CAAGATACACACTTTTAAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 160
902525107_902525109 -10 Left 902525107 1:17052132-17052154 CCACTGCACCTGGCAAGATACAC 0: 1
1: 2
2: 10
3: 168
4: 1048
Right 902525109 1:17052145-17052167 CAAGATACACACTTTTAAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 160
902525104_902525109 18 Left 902525104 1:17052104-17052126 CCCAAAGTGCTGGAATTACAGGC 0: 8353
1: 231656
2: 273926
3: 181702
4: 144141
Right 902525109 1:17052145-17052167 CAAGATACACACTTTTAAGTAGG 0: 1
1: 0
2: 0
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902525109 Original CRISPR CAAGATACACACTTTTAAGT AGG Intronic
902230286 1:15023290-15023312 CAGAATACACAGTGTTAAGTTGG + Intronic
902525109 1:17052145-17052167 CAAGATACACACTTTTAAGTAGG + Intronic
902659034 1:17888473-17888495 CAAGATCCCCACTTTACAGTTGG - Intergenic
902991028 1:20186952-20186974 CAAGATACATACATTTGAATTGG - Intronic
904178429 1:28648143-28648165 CAAGTTACACATTTTCAATTTGG + Intergenic
908071974 1:60470738-60470760 CAAGAGACACTTTTTTAATTTGG + Intergenic
909837741 1:80277825-80277847 CAAAATACAAAATTTTAAGAAGG + Intergenic
910447774 1:87316264-87316286 CAATATACACAGTTTAAATTGGG + Intergenic
911747602 1:101456773-101456795 CTAGGTACAGAATTTTAAGTTGG - Intergenic
912030499 1:105236610-105236632 CAATATACTGGCTTTTAAGTTGG - Intergenic
912078253 1:105905656-105905678 CAAGATAGCCATTTATAAGTGGG - Intergenic
912604210 1:110971852-110971874 AAATATTCCCACTTTTAAGTGGG + Intergenic
917263945 1:173199452-173199474 CAAGATACACATTTGAAAGAAGG + Intronic
921849622 1:219921002-219921024 TTAAATACACTCTTTTAAGTTGG + Intronic
924822205 1:247504194-247504216 CAACATACACAATTTTTGGTGGG - Intergenic
1063101306 10:2952505-2952527 GAAGATTTACATTTTTAAGTCGG + Intergenic
1063351235 10:5357485-5357507 AAAGAGACACATTTTTAAATAGG + Intergenic
1065851103 10:29790257-29790279 CAAGATCCACACATTTTATTTGG + Intergenic
1066258071 10:33701018-33701040 CAAGAAACTCACTTTAAAGTGGG - Intergenic
1066511301 10:36099631-36099653 CAAGGTACAGAATTCTAAGTTGG - Intergenic
1068321511 10:55424188-55424210 CAAGATACACACAATTATTTTGG + Intronic
1070709099 10:78664724-78664746 CAACAGAAACATTTTTAAGTTGG + Intergenic
1073035117 10:100558992-100559014 ATAAATACACACTTTTTAGTTGG - Exonic
1073551423 10:104405573-104405595 CAAGATATACAGTTATAAATTGG - Intronic
1080931016 11:36810919-36810941 AAGGATCCACACTTATAAGTGGG - Intergenic
1081340306 11:41919500-41919522 CAAGGTATACAATTCTAAGTTGG + Intergenic
1082226945 11:49719422-49719444 CAACATTCTCACTTATAAGTGGG - Intergenic
1082236613 11:49825317-49825339 CAATATACACCCTTTGATGTCGG + Intergenic
1082610098 11:55285124-55285146 CAATATACACCCTTTGATGTTGG + Intergenic
1086520899 11:87666614-87666636 CATGCTAAACATTTTTAAGTAGG + Intergenic
1088523606 11:110727255-110727277 CAAGGTACAGAATTCTAAGTTGG + Intergenic
1091332690 11:134742958-134742980 TTAAATACACACTTTTAAATTGG - Intergenic
1093396253 12:18686297-18686319 TAAAATTCAGACTTTTAAGTAGG - Intronic
1094484898 12:30916944-30916966 CAAGCTATACTCTTTTAACTTGG + Intergenic
1095563898 12:43597923-43597945 CAAGATGCACTCTCTTAAATTGG - Intergenic
1096161561 12:49382676-49382698 AAAAATATACACTTTTAAATAGG - Intronic
1097785740 12:63756901-63756923 CAATATAAACACTTTTTATTTGG + Intergenic
1098718105 12:73858107-73858129 CAAGAAACAGAATTTGAAGTTGG + Intergenic
1099878661 12:88439160-88439182 AAAGACACACACTTGTAAATTGG + Intergenic
1104292070 12:127479438-127479460 CAGGAGAGACACTTTTAATTTGG - Intergenic
1108066279 13:46580838-46580860 CAAATTACACAATTTTCAGTTGG + Intronic
1109921212 13:69062296-69062318 GAATATTCTCACTTTTAAGTGGG + Intergenic
1110822528 13:79933462-79933484 CATGATAAACACTCTTAAGTTGG - Intergenic
1111132371 13:83993900-83993922 CAAGACACAGAATTTTAAGTTGG - Intergenic
1111978086 13:94988494-94988516 AGATATACACACTTTTAAGGTGG + Intergenic
1112608777 13:100935080-100935102 CAGGATACACACATGTAATTGGG - Intergenic
1113584608 13:111456558-111456580 CCATATACACTCTTTTATGTTGG + Intergenic
1113732929 13:112655411-112655433 TAAGATGCACACTTTTAAGGTGG + Intronic
1117910635 14:60635439-60635461 AAACATACACAGTTTTTAGTTGG + Intergenic
1120310733 14:82824441-82824463 CAAGATAAACACTGTGAGGTAGG + Intergenic
1120564821 14:86042564-86042586 CAGCATACACACTCATAAGTGGG - Intergenic
1121065582 14:90961076-90961098 TCAGATACAAACTTTTAAGGAGG - Intronic
1123893351 15:24803198-24803220 CAATATACCCATTTTTAATTTGG + Intergenic
1125282320 15:38055992-38056014 CAAGAAACACACTTTTTGTTAGG - Intergenic
1126220855 15:46211071-46211093 CAAGATAAACCCATTTTAGTTGG + Intergenic
1126282969 15:46978318-46978340 GTATATACACACTTTTAAGTGGG + Intergenic
1126309189 15:47296615-47296637 CCAGATACACTGTTTTAACTGGG + Intronic
1128967363 15:72072669-72072691 AAATATTCTCACTTTTAAGTGGG + Intronic
1129800256 15:78408494-78408516 CAAGACACACATTTTAAAGAAGG - Intergenic
1130242130 15:82203941-82203963 TAAGATACACACCTAGAAGTGGG + Intronic
1130458246 15:84136880-84136902 TAAGATACACACCTAGAAGTGGG - Intergenic
1131823657 15:96297972-96297994 CAAGACACTAACTTTTAAGGTGG + Intergenic
1134102281 16:11460791-11460813 CAACAGACACACTTTTTAATGGG + Intronic
1140614563 16:76646121-76646143 CAAGTTGCACATTTTAAAGTTGG + Intergenic
1141023870 16:80525113-80525135 CAAGAATCATACTTTTAATTAGG - Intergenic
1146495185 17:33315763-33315785 AAAGAAACACACTTGTAAGAGGG - Intronic
1147716036 17:42509323-42509345 CAACATACACTCTTTAAACTGGG + Intronic
1149222415 17:54430292-54430314 CCAGATAAACACTTTTCTGTGGG + Intergenic
1149955997 17:61050748-61050770 TAAGAAACACACTTTAAACTTGG + Intronic
1156010543 18:32492580-32492602 GAAGATACCCATTTTTAAATGGG - Intergenic
1158590166 18:58772439-58772461 AAAGATAAACACTTTGAAGAGGG + Intergenic
1159585379 18:70278775-70278797 AAAGATACACACTTTAAGGTAGG - Intergenic
1159859689 18:73632545-73632567 CAAAATAAATACTTTTTAGTAGG + Intergenic
1162247007 19:9409575-9409597 GAAGATAAACATTTTTTAGTGGG + Intergenic
1163051184 19:14685297-14685319 TTAAATACACACTTTTAAATTGG - Intronic
1165204074 19:34169344-34169366 CCAGCTAAACACTTTTAAATTGG - Intergenic
925508358 2:4596130-4596152 CCAAAGAAACACTTTTAAGTGGG + Intergenic
926371851 2:12186519-12186541 CAAGACATACACATTTTAGTGGG + Intergenic
928040859 2:27875685-27875707 CTAAATAAATACTTTTAAGTTGG - Intronic
928369283 2:30728990-30729012 AAAGATACACATTTTTAAATGGG + Intronic
928389230 2:30896484-30896506 CAAGTTACTCACTTCTAAGATGG + Intergenic
929540679 2:42818015-42818037 CAGAAGACACACTTTTAAGAAGG - Intergenic
930368290 2:50471329-50471351 CATGTTACTCACTTATAAGTGGG - Intronic
930417491 2:51107162-51107184 CAAGTTAAACACATTTAATTTGG - Intergenic
932092733 2:68820906-68820928 CAAGATACATAGTTTTGTGTGGG - Intronic
935330190 2:101971599-101971621 CAAAACACACACATTTATGTGGG - Intergenic
937017552 2:118619531-118619553 CAAGAACCATGCTTTTAAGTGGG - Intergenic
937757121 2:125553475-125553497 GAATATACACAGTTTGAAGTGGG + Intergenic
942243923 2:173990096-173990118 CAAGCTACTCACCTTTAGGTCGG + Intergenic
943184779 2:184594012-184594034 CAAGAGACACATCTTCAAGTGGG + Intergenic
943843361 2:192607293-192607315 GAACATACAAACTTTTAACTGGG - Intergenic
944634784 2:201664927-201664949 CAAGATACAGAATGTTAAGTTGG + Intronic
946497321 2:220207710-220207732 CTATATACAAACTATTAAGTTGG - Intergenic
1173069147 20:39744684-39744706 CAAGCTACACACCCTGAAGTGGG + Intergenic
1176918816 21:14661433-14661455 AAAGATACACAATTTTAGTTAGG - Intergenic
1179135145 21:38673330-38673352 CAAGACATACAAATTTAAGTTGG + Intergenic
1180629001 22:17214373-17214395 GAAGATACACCCTTTTAGTTCGG + Intronic
1180829810 22:18899042-18899064 CAGGATACAGAATTTTAGGTTGG + Intergenic
1182827257 22:33276530-33276552 GAAGATTCATACTTTGAAGTAGG + Intronic
1185124834 22:49003892-49003914 GAATAGACACAATTTTAAGTTGG + Intergenic
1203279901 22_KI270734v1_random:124315-124337 CAGGATACAGAATTTTAGGTTGG + Intergenic
957855145 3:85865364-85865386 CAACATACACACATTTTATTTGG - Intronic
958597124 3:96241238-96241260 TAAGATACACACATTTTAGAGGG - Intergenic
958756128 3:98251302-98251324 CAAGGTTCTCACTTATAAGTGGG + Intergenic
959164220 3:102757031-102757053 AAAGAAACACAATTTTAAGAAGG - Intergenic
959331793 3:105015200-105015222 CTAGTTACACAATATTAAGTAGG - Intergenic
959334815 3:105050826-105050848 CAAATTACACACTGCTAAGTGGG + Intergenic
960662126 3:120071870-120071892 CCAGATATACTCTTTTAAGTGGG + Intronic
962049169 3:131794806-131794828 CAAGCTACACACTCATATGTGGG - Intronic
965359773 3:167724505-167724527 GAAGAAACACACTTATAAATGGG - Intronic
965417138 3:168410368-168410390 AAAGACACATACTTTTAAATGGG - Intergenic
965921421 3:173919591-173919613 CAAAATCCACACTCTTAACTAGG + Intronic
966324371 3:178737873-178737895 CAAGATATTCACTTTGAAGAGGG + Intronic
967690618 3:192469546-192469568 AAACATACACACTTTTGTGTTGG - Intronic
970812975 4:20117449-20117471 CAAGATATACACATCAAAGTTGG + Intergenic
972727594 4:41758957-41758979 CAAAGTACACACTTTTAAAAAGG + Intergenic
974773919 4:66455021-66455043 CATGATAAAAACTTTCAAGTTGG + Intergenic
976878473 4:89888305-89888327 CAAGATATAGAATTATAAGTTGG + Intronic
976947766 4:90791553-90791575 AAAGATACACACTTTTAGCCGGG + Intronic
977147972 4:93470207-93470229 CAGGATGGACACTTTTAAGTCGG + Intronic
977180152 4:93864348-93864370 GAATATTCTCACTTTTAAGTGGG + Intergenic
979587246 4:122435359-122435381 CAAGAAACACAGATTTAAATTGG - Intergenic
981034527 4:140155721-140155743 AAATATACACTCTCTTAAGTTGG - Intergenic
981801889 4:148667308-148667330 CAAGAGAAAGACTTTTAGGTTGG - Intergenic
984705209 4:182842640-182842662 CAAGATAAACATTTCTAATTTGG - Intergenic
985082155 4:186277130-186277152 GTAGATTCTCACTTTTAAGTGGG - Intronic
986941022 5:12949507-12949529 CAGAATACAGAATTTTAAGTTGG - Intergenic
988520850 5:31944613-31944635 CAACATACACACTTGGAAGCAGG - Intronic
988624522 5:32858802-32858824 CAAATTACTCACTTATAAGTGGG - Intergenic
992604856 5:78444932-78444954 AAAGTTACACAACTTTAAGTGGG + Intronic
993641354 5:90409781-90409803 CAACATAGACACTTTTGAGCTGG + Exonic
996572739 5:124949765-124949787 CAAGAGACATATTTTAAAGTTGG - Intergenic
997008407 5:129848034-129848056 CAGGATTCACTCTTTTAAGAAGG + Intergenic
997020739 5:129998265-129998287 AAAGATACCTACTTTTAAGTGGG - Intronic
998812614 5:145981441-145981463 CAAGATCCACACATTGCAGTTGG + Intronic
998905562 5:146900869-146900891 AAAATTAAACACTTTTAAGTGGG - Intronic
1004834366 6:19514824-19514846 CAAGATACACTCTTCTAGGCAGG - Intergenic
1006535347 6:34695480-34695502 CAAGAAACACTCCTTTACGTCGG + Intronic
1007433916 6:41794598-41794620 CAAGATCCACGTTTTTAAGTCGG - Exonic
1008290554 6:49710454-49710476 AAAGAGACACAGTTTTAATTGGG + Intronic
1011443738 6:87414802-87414824 CAAGATATATACTTTTACATAGG - Intronic
1015324749 6:131912233-131912255 CAGGACAAACACTTTTAATTTGG + Intergenic
1016700646 6:147050169-147050191 CTAGATACACAATTTTATGCCGG + Intergenic
1020576122 7:9930709-9930731 CAACATACACATTTTTAAGGGGG + Intergenic
1027254794 7:76424321-76424343 CAAGCTAAAAACTTTCAAGTGGG + Intronic
1029667763 7:102006936-102006958 CAAGAAATACACTTTTGTGTGGG - Intronic
1031334345 7:120508853-120508875 CCAGATACACACTTTTAGATTGG + Intronic
1031343390 7:120633885-120633907 GAATATATACAATTTTAAGTTGG + Intronic
1036053129 8:5222730-5222752 CAAGATATACATTTGTAAGTGGG + Intergenic
1037245706 8:16832310-16832332 CAAATTACACAATTTTAAATAGG + Intergenic
1038119560 8:24597438-24597460 AAAGATACACAGTTTAAACTTGG - Intergenic
1038878716 8:31582730-31582752 CTAGATATACAATTCTAAGTTGG + Intergenic
1040579185 8:48682271-48682293 CAAAATAAACATATTTAAGTGGG - Intergenic
1043009203 8:74860640-74860662 CTAGATAGACATTTTTATGTTGG + Intergenic
1043312255 8:78875518-78875540 AAAGATACACACTGGTAAATTGG - Intergenic
1043456057 8:80413133-80413155 CTATAGACACACTTTGAAGTTGG - Intergenic
1044205489 8:89488280-89488302 ATAGATACACAGTTTTAAATTGG - Intergenic
1046003826 8:108454840-108454862 CAGGATACAGAATTCTAAGTTGG + Intronic
1049186943 8:141260450-141260472 CAAGATACTCACTTTAAAACTGG - Intronic
1051195294 9:14557584-14557606 AAAGATGCACATTTTTAAGCAGG + Intergenic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1059534443 9:115068366-115068388 CAATCTACAGATTTTTAAGTTGG - Intronic
1059651374 9:116319040-116319062 CAAAATACATCCATTTAAGTTGG - Intronic
1060719116 9:125962715-125962737 CCATATACACAATTCTAAGTAGG + Intronic
1062653468 9:137590237-137590259 CACGATACCCAATTTGAAGTCGG + Exonic
1185924016 X:4126543-4126565 GAAGATAAGCAATTTTAAGTGGG - Intergenic
1186503380 X:10070480-10070502 AAAGAAACACACTATTAGGTTGG - Intronic
1187855466 X:23632638-23632660 CCATATTCTCACTTTTAAGTGGG - Intergenic
1188385824 X:29556300-29556322 CAAGAGTTACACATTTAAGTAGG + Intronic
1188688849 X:33104192-33104214 TAAGAAACAAACATTTAAGTGGG - Intronic
1192827024 X:74708079-74708101 CAAGAAACACACATTTTAGGAGG - Intergenic
1194444775 X:93974429-93974451 CAAGATATAAAATTCTAAGTTGG + Intergenic
1194641692 X:96410506-96410528 CAAGATACAAAGTTTTAATAGGG + Intergenic
1198014792 X:132599140-132599162 AGAGAAACACAATTTTAAGTGGG + Intergenic
1198163487 X:134030555-134030577 CAAGTTTCTCACTTATAAGTGGG - Intergenic
1200844776 Y:7820494-7820516 CAAAATTCACAATTTCAAGTTGG + Intergenic