ID: 902526395

View in Genome Browser
Species Human (GRCh38)
Location 1:17060715-17060737
Sequence CACTACCAATTTAAGATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902526395_902526402 5 Left 902526395 1:17060715-17060737 CCATCAATCTTAAATTGGTAGTG No data
Right 902526402 1:17060743-17060765 CCCAGCTGGGGAAAGGAAAGAGG No data
902526395_902526404 30 Left 902526395 1:17060715-17060737 CCATCAATCTTAAATTGGTAGTG No data
Right 902526404 1:17060768-17060790 AAAGATAACTGTGCCTTATTAGG No data
902526395_902526397 -9 Left 902526395 1:17060715-17060737 CCATCAATCTTAAATTGGTAGTG No data
Right 902526397 1:17060729-17060751 TTGGTAGTGGAGAGCCCAGCTGG No data
902526395_902526399 -7 Left 902526395 1:17060715-17060737 CCATCAATCTTAAATTGGTAGTG No data
Right 902526399 1:17060731-17060753 GGTAGTGGAGAGCCCAGCTGGGG No data
902526395_902526398 -8 Left 902526395 1:17060715-17060737 CCATCAATCTTAAATTGGTAGTG No data
Right 902526398 1:17060730-17060752 TGGTAGTGGAGAGCCCAGCTGGG No data
902526395_902526400 -2 Left 902526395 1:17060715-17060737 CCATCAATCTTAAATTGGTAGTG No data
Right 902526400 1:17060736-17060758 TGGAGAGCCCAGCTGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902526395 Original CRISPR CACTACCAATTTAAGATTGA TGG (reversed) Intergenic
No off target data available for this crispr