ID: 902526400

View in Genome Browser
Species Human (GRCh38)
Location 1:17060736-17060758
Sequence TGGAGAGCCCAGCTGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902526395_902526400 -2 Left 902526395 1:17060715-17060737 CCATCAATCTTAAATTGGTAGTG No data
Right 902526400 1:17060736-17060758 TGGAGAGCCCAGCTGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902526400 Original CRISPR TGGAGAGCCCAGCTGGGGAA AGG Intergenic
No off target data available for this crispr