ID: 902526404

View in Genome Browser
Species Human (GRCh38)
Location 1:17060768-17060790
Sequence AAAGATAACTGTGCCTTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902526401_902526404 2 Left 902526401 1:17060743-17060765 CCCAGCTGGGGAAAGGAAAGAGG No data
Right 902526404 1:17060768-17060790 AAAGATAACTGTGCCTTATTAGG No data
902526403_902526404 1 Left 902526403 1:17060744-17060766 CCAGCTGGGGAAAGGAAAGAGGT No data
Right 902526404 1:17060768-17060790 AAAGATAACTGTGCCTTATTAGG No data
902526395_902526404 30 Left 902526395 1:17060715-17060737 CCATCAATCTTAAATTGGTAGTG No data
Right 902526404 1:17060768-17060790 AAAGATAACTGTGCCTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902526404 Original CRISPR AAAGATAACTGTGCCTTATT AGG Intergenic
No off target data available for this crispr