ID: 902527978

View in Genome Browser
Species Human (GRCh38)
Location 1:17071577-17071599
Sequence GCTAACTGCTGGACTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902527971_902527978 -3 Left 902527971 1:17071557-17071579 CCAAGATCCTCCAGGCCTGGGCT 0: 1
1: 0
2: 2
3: 44
4: 357
Right 902527978 1:17071577-17071599 GCTAACTGCTGGACTGGGACTGG 0: 1
1: 0
2: 0
3: 10
4: 138
902527966_902527978 5 Left 902527966 1:17071549-17071571 CCCTTTTGCCAAGATCCTCCAGG 0: 1
1: 0
2: 0
3: 18
4: 179
Right 902527978 1:17071577-17071599 GCTAACTGCTGGACTGGGACTGG 0: 1
1: 0
2: 0
3: 10
4: 138
902527972_902527978 -10 Left 902527972 1:17071564-17071586 CCTCCAGGCCTGGGCTAACTGCT 0: 1
1: 0
2: 4
3: 52
4: 552
Right 902527978 1:17071577-17071599 GCTAACTGCTGGACTGGGACTGG 0: 1
1: 0
2: 0
3: 10
4: 138
902527964_902527978 20 Left 902527964 1:17071534-17071556 CCAGGCTGAGTGTTCCCCTTTTG 0: 1
1: 0
2: 1
3: 24
4: 190
Right 902527978 1:17071577-17071599 GCTAACTGCTGGACTGGGACTGG 0: 1
1: 0
2: 0
3: 10
4: 138
902527965_902527978 6 Left 902527965 1:17071548-17071570 CCCCTTTTGCCAAGATCCTCCAG 0: 1
1: 0
2: 0
3: 18
4: 186
Right 902527978 1:17071577-17071599 GCTAACTGCTGGACTGGGACTGG 0: 1
1: 0
2: 0
3: 10
4: 138
902527968_902527978 4 Left 902527968 1:17071550-17071572 CCTTTTGCCAAGATCCTCCAGGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 902527978 1:17071577-17071599 GCTAACTGCTGGACTGGGACTGG 0: 1
1: 0
2: 0
3: 10
4: 138
902527963_902527978 21 Left 902527963 1:17071533-17071555 CCCAGGCTGAGTGTTCCCCTTTT 0: 1
1: 0
2: 0
3: 20
4: 184
Right 902527978 1:17071577-17071599 GCTAACTGCTGGACTGGGACTGG 0: 1
1: 0
2: 0
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902527978 Original CRISPR GCTAACTGCTGGACTGGGAC TGG Intronic
900939891 1:5791943-5791965 GCTAACTGCAGGGTTGGGAGGGG + Intergenic
901188298 1:7388941-7388963 GCTTCCTGCCGGACTGGGGCAGG + Intronic
901802416 1:11715979-11716001 GCTACCTGCAGGGCTGGGATGGG - Intronic
902527978 1:17071577-17071599 GCTAACTGCTGGACTGGGACTGG + Intronic
903257745 1:22114203-22114225 GCTCAATGCTGGACAGGGAAAGG - Intergenic
903760164 1:25692112-25692134 GTTAACTGGGGGACCGGGACTGG + Intronic
903886974 1:26546343-26546365 GGTAAGTGCTGGCCTGGGGCAGG - Intronic
906953636 1:50354476-50354498 GCTAATTCCTGGCCTGGGGCGGG + Intergenic
912625738 1:111203823-111203845 GCTATCTGCTGGGCAGGGGCAGG + Intronic
912804829 1:112747310-112747332 CCTGAATGCTTGACTGGGACTGG - Intergenic
916071300 1:161171657-161171679 CCTCACTGCTGGACTGGAGCTGG - Exonic
921056987 1:211549767-211549789 CATAACTGCTGGGCTGGGAGTGG - Intergenic
921079355 1:211726242-211726264 GCTTACTGGAGGAATGGGACTGG + Intergenic
922365603 1:224860589-224860611 GCTGACTGCTGCACTGGGGATGG + Intergenic
923962035 1:239096684-239096706 GCAAACTCCTAGAGTGGGACAGG - Intergenic
1071248664 10:83792044-83792066 GCAGGCTGCTGGCCTGGGACTGG - Intergenic
1081618412 11:44604079-44604101 GAGAACTGCTGGGCTGGGAGAGG - Intronic
1081993706 11:47350809-47350831 GGGAACTGATGGCCTGGGACGGG - Intronic
1082046306 11:47731628-47731650 GCAGACTGCTGTCCTGGGACAGG - Intronic
1082786677 11:57321070-57321092 GCTGACTGCTTGATAGGGACAGG - Intronic
1087391287 11:97537885-97537907 GCCAGCTGCTGCAGTGGGACAGG - Intergenic
1089125345 11:116172703-116172725 GATAACTGCTGGACTCCTACTGG - Intergenic
1090549793 11:127807233-127807255 GATAAATGCTGGGCTGGGAGGGG + Intergenic
1092099975 12:5875018-5875040 GCTAACTCCTGCTCTAGGACAGG + Intronic
1092171301 12:6375436-6375458 GGTTGCGGCTGGACTGGGACTGG + Intronic
1093776444 12:23080637-23080659 GCTAACTGCTGAATGGGGAAAGG - Intergenic
1097685115 12:62683946-62683968 GATGTGTGCTGGACTGGGACTGG + Intronic
1101599326 12:106195294-106195316 GCTAAGTGCTACAATGGGACAGG + Intergenic
1106015692 13:25867116-25867138 GCCAGTTTCTGGACTGGGACAGG + Intronic
1108065163 13:46569869-46569891 GATGACTGCTTGACAGGGACTGG - Intronic
1110007063 13:70286159-70286181 GCTGATTCCAGGACTGGGACAGG + Intergenic
1113465433 13:110509442-110509464 GCTAAATCCTGGGCAGGGACAGG + Intronic
1114155750 14:20101047-20101069 GCTAACTTCAGGACTGGGGTGGG - Intergenic
1114179380 14:20352725-20352747 GATCATTCCTGGACTGGGACAGG + Intronic
1117607557 14:57445666-57445688 GATAACTGCTTGCCAGGGACTGG - Intergenic
1117646867 14:57862351-57862373 TCTCACTGCTGTACTGGGACAGG - Intronic
1119546997 14:75479235-75479257 GGTCAGTGCTGGACTGGGGCAGG + Intergenic
1121055100 14:90845724-90845746 GCTAAGTTCTGGGCAGGGACAGG - Intergenic
1122988317 14:105223620-105223642 GCTCACTGGTGGCCTGGGGCAGG + Intronic
1123893153 15:24801853-24801875 GCTGACTGCTGCACAGAGACAGG + Intergenic
1126471950 15:49022121-49022143 ACTAACTGCTTAACTGAGACAGG + Intronic
1128664172 15:69526236-69526258 TCTGAGGGCTGGACTGGGACAGG - Intergenic
1131335546 15:91545300-91545322 GCTCACTGATGGAGTGGGAATGG + Intergenic
1133256677 16:4521400-4521422 GCCAAGTGCAGGGCTGGGACAGG + Intronic
1134336719 16:13306588-13306610 GCTAAAGGCTTGACTGGGGCTGG + Intergenic
1137905680 16:52319692-52319714 GCTAACTGTTGGAATGGGTGGGG - Intergenic
1139213720 16:65107073-65107095 GCTTACTGACGGCCTGGGACTGG - Intronic
1139550154 16:67668398-67668420 GGTCACTAGTGGACTGGGACAGG - Exonic
1144708598 17:17385981-17386003 GCTGACTGCTGGAGGGGGGCTGG - Intergenic
1146811863 17:35910249-35910271 GCTATCTGCTGGACTGGAGAGGG + Intergenic
1148150754 17:45395438-45395460 ACTGACTGCTGGCCTGTGACTGG - Exonic
1148447497 17:47746401-47746423 GCCAAGGGCTGGACTGGGAGCGG + Intergenic
1148910184 17:50938346-50938368 GCTGATTCCAGGACTGGGACAGG - Intergenic
1151543493 17:74777217-74777239 CCTATCTGATGGACTGAGACAGG - Intronic
1152481840 17:80559441-80559463 GCTAATTCCAGGACTGGGGCAGG - Intronic
1152706616 17:81846837-81846859 GCTGCCTGCTGGACTGGATCGGG - Intronic
1157352069 18:46897283-46897305 GCTGACTGCAGGTCTGGGGCAGG + Intronic
1161002610 19:1918343-1918365 CCTCACAGCTGGGCTGGGACTGG - Intronic
1163798216 19:19349279-19349301 GATAACTGCAGGACGGGGCCTGG - Intronic
1164399747 19:27894428-27894450 GCTGACTGCTGGGCTAGGCCTGG - Intergenic
1167659867 19:50790340-50790362 GCTGAGTGCAGGGCTGGGACAGG + Intergenic
928862169 2:35872326-35872348 GATAAATGCAGGACTGAGACTGG - Intergenic
929724851 2:44414387-44414409 TCTCAGTGCTTGACTGGGACTGG + Intronic
929901353 2:46006348-46006370 GATAACTGCTGAACTGGCAAGGG + Intronic
934759911 2:96848922-96848944 GCTAACTGCGAGAATGGCACTGG - Intronic
935124711 2:100213325-100213347 GCTGATTCCAGGACTGGGACAGG - Intergenic
935552142 2:104468946-104468968 GCCTTCTGTTGGACTGGGACAGG - Intergenic
935685750 2:105681090-105681112 GGTAAGAGCTGAACTGGGACTGG - Intergenic
937039789 2:118812477-118812499 AGTAACTGATGGCCTGGGACAGG - Intergenic
937270634 2:120649259-120649281 GCTAATTTCAGGACTGGGGCAGG - Intergenic
937891989 2:126946097-126946119 GCAACCTGCAGGACTGGGACTGG - Intergenic
938812548 2:134867038-134867060 GCTCAGTGCTGGGCTGGGGCTGG - Intronic
940058316 2:149536712-149536734 GCTGACTGCATGCCTGGGACTGG + Intergenic
941275865 2:163489942-163489964 GCTACCTGAGGGACTGAGACAGG + Intergenic
941757246 2:169200408-169200430 GCTAATTCCAGGACTGGGACAGG + Intronic
941763921 2:169275461-169275483 GCTAAAGGATTGACTGGGACTGG - Intronic
942053361 2:172161663-172161685 GCTGGCTGCTGCAGTGGGACAGG + Intergenic
943590117 2:189786011-189786033 GCTACTTGCAGGGCTGGGACAGG + Intronic
944082858 2:195808828-195808850 GCTAACTGGTGGCATTGGACTGG - Exonic
945415006 2:209559798-209559820 GCTGACTCCAGGACTGGCACAGG - Intronic
948761574 2:240195338-240195360 CCTAACTGGTGTCCTGGGACTGG + Intergenic
1170557881 20:17530288-17530310 GCGAACTGCTGTCCCGGGACTGG - Intronic
1170694712 20:18647866-18647888 GAGAACTGCTGCACTGGGCCAGG + Intronic
1170816046 20:19715349-19715371 GCCACCAGCTGGACTGCGACGGG + Intronic
1174471516 20:50764695-50764717 GCGAACTGCTGGCCTGGAAATGG - Intergenic
1176167109 20:63680129-63680151 GCCAGCTGCAGAACTGGGACAGG - Intronic
1178491759 21:33057033-33057055 GGTAACTGCAGGGCTGGGGCTGG + Intergenic
1180857599 22:19058263-19058285 GCTGCCTGCTGGCCTGGCACAGG - Intronic
1182089089 22:27581836-27581858 GCCAAGTGCTGGGCGGGGACTGG - Intergenic
949941817 3:9160523-9160545 GCTAAAGGCTTAACTGGGACTGG - Intronic
950933297 3:16812404-16812426 GCTGAGTGCTGGAGTGGGAATGG - Intronic
955921433 3:63960605-63960627 GCTTGCTGATGGACTGGGAAAGG + Intronic
960942618 3:122944477-122944499 GCTAGGTGCTGGACTGAGCCTGG - Intronic
961158451 3:124700868-124700890 GCTGACTGTGGGACTGGAACTGG - Intronic
967302770 3:188031965-188031987 GGTGACTTCTGAACTGGGACAGG - Intergenic
969847587 4:9931364-9931386 GCAAACTCCTGGGCTGGGAGAGG + Intronic
971444213 4:26725031-26725053 GCTAACTGCGGGACTGGCTCAGG - Intronic
973653932 4:53026257-53026279 TCTAAATGCAGGACTTGGACTGG - Intronic
974074674 4:57157644-57157666 GCTTCCTGCTGCAGTGGGACTGG - Intergenic
975776441 4:77792612-77792634 GCTAACTGAGGGGCTGAGACAGG + Intronic
976234834 4:82885812-82885834 TTTAACTGCAGGACTGAGACTGG - Intronic
981019683 4:140012490-140012512 CCTAAGTGCTGGCCTTGGACAGG - Intronic
985014500 4:185619459-185619481 ACTAAAAGCTGGACTTGGACTGG - Intronic
985929946 5:3049395-3049417 GCTAACTGCAGGAAAGGGGCGGG + Intergenic
987506676 5:18783081-18783103 TGTAACTGCTTGACTGGGAGGGG - Intergenic
989419577 5:41221090-41221112 GAAAACTGCAGGGCTGGGACAGG - Intronic
995893912 5:116989005-116989027 GCTACCTGCTGGGCTGAGGCAGG - Intergenic
998399733 5:141842451-141842473 TCTGACTGCAGGACTGGGGCTGG + Intergenic
998556279 5:143127423-143127445 GCTAACTGATGGACTAGGGAAGG - Intronic
999119772 5:149200382-149200404 GCTTACTGCTGGCCATGGACTGG - Exonic
1003604716 6:7548743-7548765 GCTCACTGCTGGAGTGGGAATGG + Intronic
1005992624 6:30912960-30912982 GATAACAGCTGAACTGGGATGGG + Intronic
1006513961 6:34535884-34535906 GCTGACAGCGGAACTGGGACCGG - Intergenic
1007072653 6:39048630-39048652 GCTATCTCCTGGCCCGGGACCGG + Intergenic
1009230366 6:61054004-61054026 GCTATGTGATGGACAGGGACAGG + Intergenic
1010108926 6:72201885-72201907 TCTAACTCCTGGACAGGGACTGG - Intronic
1017066933 6:150537695-150537717 GCTCACTGCTTGGCTGGCACAGG - Intergenic
1019617362 7:1971120-1971142 TCTAACTGCGGGCCTGAGACGGG - Intronic
1019937575 7:4266525-4266547 GCTAAAAGCTGGCCTCGGACTGG - Exonic
1022167635 7:27785650-27785672 GCTAAGGGCTTGATTGGGACTGG + Intronic
1027190157 7:75991900-75991922 GCGACCTCCTGGACTGGGTCAGG + Intronic
1031464456 7:122091294-122091316 GCTCACAGCTGGACTGGGGATGG - Intronic
1032527420 7:132589847-132589869 GGTGACATCTGGACTGGGACTGG + Intronic
1033269725 7:139919949-139919971 GCCAGGTGCTGTACTGGGACTGG - Intronic
1034552958 7:151832825-151832847 CCTAACTGCTCGCCTGGGATAGG - Intronic
1034992046 7:155554059-155554081 GCCAACTGCTGGTTTGGGATGGG + Intergenic
1035070804 7:156143814-156143836 CCTTCCTGCTGGGCTGGGACAGG - Intergenic
1037118789 8:15258154-15258176 TCTAACTGCTTGACTGGGAAGGG - Intergenic
1037976884 8:23220156-23220178 GCTGCCTGTTGGACTGGGAAGGG - Intronic
1039928054 8:41957136-41957158 GCAAACAGCTGTACTGGAACTGG - Intronic
1045317253 8:101053804-101053826 TCTGAAGGCTGGACTGGGACAGG - Intergenic
1047649487 8:126904551-126904573 GCGAACTTCTGGAATGTGACAGG + Intergenic
1048795543 8:138146070-138146092 ACTAACTACGGGACTGGGATGGG - Intronic
1050691800 9:8235666-8235688 GCTAACTGCAGGTGTGGCACTGG - Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1057714998 9:97486084-97486106 ACACACTGCTGGACTGGGGCTGG - Intronic
1060938379 9:127528907-127528929 GCCTCCTGCTGGGCTGGGACTGG - Intronic
1061189621 9:129074631-129074653 GCTTGATGCTGGCCTGGGACTGG - Intergenic
1062031302 9:134363267-134363289 GCCACATGCTGGACTGGGAGAGG - Intronic
1185771776 X:2770325-2770347 ACTAACTGCTGAATGGGGACAGG + Intronic
1192161519 X:68791864-68791886 GCTAACTGGTGGAGTGGGGAAGG - Intergenic
1192352643 X:70370309-70370331 GCTTACTTCTGGAGGGGGACTGG + Intronic
1194147558 X:90281757-90281779 GCTAACTGCTGCAAGGGGACTGG + Intergenic
1195094902 X:101493255-101493277 GGAAGCTGCTGGACTGGGGCTGG + Exonic
1196628043 X:117900728-117900750 TGTAACTGCTGGCCTGGCACTGG + Intronic
1196652911 X:118187104-118187126 GCTGACTGCAGGTCTGGGGCAGG + Intergenic
1196909693 X:120472972-120472994 GCTGGCTCCTTGACTGGGACAGG + Intergenic
1198596324 X:138240054-138240076 GCTAACTGCTGGACATGGAGTGG + Intergenic
1200493953 Y:3858518-3858540 GCTAACTGCTGCAAGGGGACTGG + Intergenic