ID: 902532436

View in Genome Browser
Species Human (GRCh38)
Location 1:17099017-17099039
Sequence CAGAATAGCCCCAAGGCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902532427_902532436 8 Left 902532427 1:17098986-17099008 CCCAGAGGCTCTGGATCCCACCT 0: 1
1: 0
2: 0
3: 23
4: 213
Right 902532436 1:17099017-17099039 CAGAATAGCCCCAAGGCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
902532430_902532436 -9 Left 902532430 1:17099003-17099025 CCACCTCAGTTCCCCAGAATAGC 0: 1
1: 0
2: 4
3: 28
4: 270
Right 902532436 1:17099017-17099039 CAGAATAGCCCCAAGGCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
902532429_902532436 -8 Left 902532429 1:17099002-17099024 CCCACCTCAGTTCCCCAGAATAG 0: 1
1: 0
2: 4
3: 40
4: 414
Right 902532436 1:17099017-17099039 CAGAATAGCCCCAAGGCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
902532425_902532436 21 Left 902532425 1:17098973-17098995 CCAGACGACATTTCCCAGAGGCT 0: 1
1: 0
2: 3
3: 15
4: 129
Right 902532436 1:17099017-17099039 CAGAATAGCCCCAAGGCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
902532423_902532436 28 Left 902532423 1:17098966-17098988 CCAGGCTCCAGACGACATTTCCC 0: 1
1: 0
2: 1
3: 10
4: 152
Right 902532436 1:17099017-17099039 CAGAATAGCCCCAAGGCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 72
902532428_902532436 7 Left 902532428 1:17098987-17099009 CCAGAGGCTCTGGATCCCACCTC 0: 1
1: 0
2: 2
3: 30
4: 241
Right 902532436 1:17099017-17099039 CAGAATAGCCCCAAGGCGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902532436 Original CRISPR CAGAATAGCCCCAAGGCGTC AGG Intronic
900301181 1:1978298-1978320 CAGCATCGCCCCAAGGCAACAGG - Intronic
900342526 1:2195574-2195596 CAGCATAGCCCCAAAGCTGCTGG - Intronic
900702595 1:4057657-4057679 CAGAAAAGCCTCAAGGGGCCTGG - Intergenic
902532436 1:17099017-17099039 CAGAATAGCCCCAAGGCGTCAGG + Intronic
903059177 1:20657557-20657579 TAGAAAAGCTCCAAGGAGTCTGG + Intronic
904289447 1:29474783-29474805 CAGAACAGCCCCAAGGACTTTGG + Intergenic
904949017 1:34220925-34220947 CTGAATTTCCCCAAGGCGTTTGG + Intergenic
912044482 1:105437250-105437272 CAGCCCAGCCCCAAGGCCTCAGG - Intergenic
919822648 1:201482728-201482750 CAGCACAGCCCCAACGCATCAGG + Intergenic
920569623 1:207006913-207006935 CACAATGACCCCAAGGTGTCTGG + Intronic
923328153 1:232898659-232898681 CAGCCTAGCCCCCAGGCTTCAGG - Intergenic
1065806110 10:29394903-29394925 CAGCCTAGCCCCCAGGCTTCAGG - Intergenic
1066177695 10:32926462-32926484 CAGAATAGCACCAAGCCATGAGG - Intronic
1073325422 10:102642223-102642245 CGGAACAGCCCCAACGCGACAGG + Intergenic
1074435821 10:113433329-113433351 CAGAATTGCCCCAAAGCTTCTGG - Intergenic
1080406920 11:31987631-31987653 CAGACTGGCCCCGAGGCGGCGGG - Intronic
1081529947 11:43951389-43951411 TAGAATAGCCCCAAGGTAGCTGG + Intergenic
1083413324 11:62508709-62508731 CTGAATTGCCCCGTGGCGTCAGG - Intronic
1110584517 13:77172702-77172724 CAGAATGACTCCAAGGTGTCTGG + Intronic
1112098422 13:96160667-96160689 CAGAATAGCCCCAAGCTATAAGG - Intronic
1114193344 14:20457252-20457274 CACAAGAGCGCCAAGGCTTCGGG + Exonic
1116313755 14:43360239-43360261 CAGACTAGCCCCCATGCTTCAGG + Intergenic
1120592308 14:86390547-86390569 CAGCCTGGCCCCAAGGCTTCTGG - Intergenic
1125762121 15:42103918-42103940 CAGAATACCCCCAAGGGCTTGGG - Intergenic
1127001681 15:54515934-54515956 CAGAATAGAGCCAAGGAATCTGG + Intronic
1134365034 16:13569195-13569217 CAGATAAGCCCCCAGGCTTCAGG - Intergenic
1136319287 16:29472134-29472156 CTGAATAGGCCAAAGGCATCTGG - Intergenic
1136433858 16:30211478-30211500 CTGAATAGGCCAAAGGCATCTGG - Intergenic
1142964228 17:3571011-3571033 CAGAAAAACCCCAAGGAGGCCGG - Intronic
1148157810 17:45433257-45433279 CAGAAGACCCCCAAGGCGGAGGG - Intronic
1148701174 17:49587901-49587923 CAGAAGAGAGCCAAGGCTTCTGG + Intergenic
1150389482 17:64781955-64781977 CAGAAGACCCCCAAGGCGGAGGG - Intergenic
1150567225 17:66352308-66352330 CAGAAAAGCCTCCAGGCCTCAGG - Intronic
1154501284 18:14999135-14999157 CAGAGGAGCCCCAAGGCTTCCGG - Intergenic
1156363872 18:36408080-36408102 CAGTGTAGCCCCAAGGGCTCTGG - Intronic
1158398545 18:57099059-57099081 CAGAATATACCCAAAGAGTCTGG - Intergenic
1161742066 19:6027471-6027493 CAGAATGGCCCCAAGACATGGGG - Intronic
1163487665 19:17598235-17598257 CAGAGCAGCCCCAAGGCTGCTGG + Intergenic
1164814535 19:31185210-31185232 CAGGATAGCCCAAAGGAGTCTGG - Intergenic
925263383 2:2547242-2547264 CAGGAAAGCTCCAAGGCATCAGG + Intergenic
927971363 2:27307801-27307823 CAGAGGAGCCCCGAGGCGGCCGG - Exonic
929510792 2:42564449-42564471 CAGAAGAGCCCCAAGGAGAAAGG - Intronic
938500449 2:131829303-131829325 CAGAGGAGCCCCAAGGCTTCCGG - Intergenic
940172690 2:150845794-150845816 CAGAGTAGCCCTGAGGGGTCTGG + Intergenic
941131053 2:161650967-161650989 CAGTACAGCCCCCAGGCTTCAGG - Intronic
941998870 2:171626863-171626885 CAGACTGGCCCCCAGGCTTCAGG - Intergenic
942585066 2:177466418-177466440 CAGCCCAGCCCCCAGGCGTCAGG + Intronic
943593667 2:189829730-189829752 AAGAATAACCCTAAGGCTTCTGG - Intronic
1170709003 20:18773320-18773342 CAGAAAAGCTCCAATACGTCTGG - Intergenic
1177037425 21:16060943-16060965 CAGCTTAGCCCCCAGGCTTCAGG + Intergenic
1180193657 21:46181318-46181340 CAGCATGGCCCCCAGGCGCCAGG + Intronic
950104758 3:10381037-10381059 CGGAATAGCCCCATGGCTGCAGG + Intronic
952882245 3:37992010-37992032 CAGCATCGCCCCCAGGGGTCCGG - Intronic
954398291 3:50304635-50304657 CACAATAGACCCAAGGCCTAGGG - Intronic
963675899 3:148311201-148311223 CAGAATAGCACCAAGAATTCTGG + Intergenic
971938742 4:33188300-33188322 TAGAATAGCTCCAAGGAGACCGG + Intergenic
984325192 4:178242023-178242045 CAGCACAGCCCCCAGGCTTCAGG - Intergenic
988498500 5:31764779-31764801 CAGAATTGCCCAAAGGGGCCGGG + Intronic
994891307 5:105639763-105639785 CAGCCTGGCCCCAAGGCCTCAGG - Intergenic
999306142 5:150520962-150520984 CAGAAGTGCCCCAGGGCGTCAGG - Exonic
1000996863 5:167968212-167968234 CAGAATGGCCCCAAATTGTCTGG - Intronic
1002443646 5:179276855-179276877 CAGAATAACCCCAGGGCCTCAGG - Intronic
1013420232 6:109960532-109960554 CAGAAGATCCTCAAGGGGTCAGG + Intergenic
1016905118 6:149140829-149140851 CAGTAAAGACCCAAGGCTTCAGG + Intergenic
1019331993 7:464819-464841 CAGGGCAGCCCCAAGGCGCCAGG - Intergenic
1023790452 7:43749716-43749738 CAGCCTAGCCCCCAGGCTTCAGG + Intergenic
1032416661 7:131740708-131740730 CAGAATAGTCACTAGGGGTCAGG + Intergenic
1035320275 7:158024631-158024653 CAGATCAGCCCCATGGGGTCAGG - Intronic
1037783359 8:21886421-21886443 CAGTATTTCCCCAAGGAGTCAGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1043082543 8:75784590-75784612 CAGCCTAGCCCCCAGGCCTCAGG + Intergenic
1044417640 8:91954161-91954183 CAGAAGAGCCCTAAGTGGTCAGG + Intergenic
1044689650 8:94864134-94864156 CAGAATAGTCACAATGTGTCAGG + Intronic
1047732132 8:127736497-127736519 CAGAATAGCCTCCCCGCGTCGGG - Exonic
1048015320 8:130491605-130491627 CAGAATAGCCCGGAGGCAGCTGG + Intergenic
1057510826 9:95678447-95678469 CAGAATTGCCCCCAGGCTTCAGG + Intergenic
1058487592 9:105457985-105458007 CTGCAGAGCCCCAAGGGGTCGGG + Intronic
1058545798 9:106059548-106059570 CAGCCTGGCCCCAAGGCTTCAGG + Intergenic
1062499249 9:136845265-136845287 CAGAGGAGCCCCAAGGCTTCCGG + Exonic
1193892520 X:87068079-87068101 CTCCATAGCCCCAAGGCATCTGG + Intergenic
1199401458 X:147404231-147404253 CAGAATTGCCTAAAGGCGTTTGG - Intergenic