ID: 902533375

View in Genome Browser
Species Human (GRCh38)
Location 1:17104869-17104891
Sequence CCGTGGTACCTTGTCACTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 55}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902533361_902533375 23 Left 902533361 1:17104823-17104845 CCTCTATCCTGGCATGGTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 101
Right 902533375 1:17104869-17104891 CCGTGGTACCTTGTCACTGCTGG 0: 1
1: 0
2: 1
3: 2
4: 55
902533367_902533375 5 Left 902533367 1:17104841-17104863 CCCGGGCCCGCAGAGGCTGGACT 0: 1
1: 0
2: 0
3: 27
4: 288
Right 902533375 1:17104869-17104891 CCGTGGTACCTTGTCACTGCTGG 0: 1
1: 0
2: 1
3: 2
4: 55
902533364_902533375 16 Left 902533364 1:17104830-17104852 CCTGGCATGGTCCCGGGCCCGCA 0: 1
1: 0
2: 2
3: 8
4: 240
Right 902533375 1:17104869-17104891 CCGTGGTACCTTGTCACTGCTGG 0: 1
1: 0
2: 1
3: 2
4: 55
902533370_902533375 -2 Left 902533370 1:17104848-17104870 CCGCAGAGGCTGGACTTCCCGCC 0: 1
1: 0
2: 3
3: 22
4: 159
Right 902533375 1:17104869-17104891 CCGTGGTACCTTGTCACTGCTGG 0: 1
1: 0
2: 1
3: 2
4: 55
902533359_902533375 28 Left 902533359 1:17104818-17104840 CCCTGCCTCTATCCTGGCATGGT 0: 1
1: 0
2: 0
3: 16
4: 208
Right 902533375 1:17104869-17104891 CCGTGGTACCTTGTCACTGCTGG 0: 1
1: 0
2: 1
3: 2
4: 55
902533360_902533375 27 Left 902533360 1:17104819-17104841 CCTGCCTCTATCCTGGCATGGTC 0: 1
1: 0
2: 4
3: 13
4: 206
Right 902533375 1:17104869-17104891 CCGTGGTACCTTGTCACTGCTGG 0: 1
1: 0
2: 1
3: 2
4: 55
902533368_902533375 4 Left 902533368 1:17104842-17104864 CCGGGCCCGCAGAGGCTGGACTT 0: 1
1: 0
2: 1
3: 13
4: 150
Right 902533375 1:17104869-17104891 CCGTGGTACCTTGTCACTGCTGG 0: 1
1: 0
2: 1
3: 2
4: 55
902533369_902533375 -1 Left 902533369 1:17104847-17104869 CCCGCAGAGGCTGGACTTCCCGC 0: 1
1: 0
2: 2
3: 14
4: 139
Right 902533375 1:17104869-17104891 CCGTGGTACCTTGTCACTGCTGG 0: 1
1: 0
2: 1
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902533375 Original CRISPR CCGTGGTACCTTGTCACTGC TGG Exonic
902533375 1:17104869-17104891 CCGTGGTACCTTGTCACTGCTGG + Exonic
903681339 1:25099291-25099313 CTGCGGTGCCTTGTCCCTGCTGG - Intergenic
904663717 1:32104014-32104036 CTGTTGTACCTTGTAACTGTTGG - Intergenic
922556489 1:226536583-226536605 TGGTGGTACCATATCACTGCTGG - Intergenic
923867266 1:237953104-237953126 CCATGTTACCTTGTGACTGAAGG + Intergenic
1066412066 10:35181460-35181482 CCTTGGTACCTGCTCACAGCAGG + Intronic
1070548109 10:77468722-77468744 CTGTAGTACTTTGTCACAGCAGG + Intronic
1090827895 11:130400754-130400776 TCGTTGAACCTTGTCACTGATGG + Intergenic
1091770809 12:3150104-3150126 TCATGCTACATTGTCACTGCTGG - Intronic
1093809521 12:23474681-23474703 CCTTGGCACACTGTCACTGCTGG + Intergenic
1105291913 13:19058732-19058754 CCGTGGCACCCTGTCTCTGTGGG - Intergenic
1111436478 13:88216351-88216373 TCGTGGTACTTTGTTACTTCAGG + Intergenic
1115876229 14:37864982-37865004 CCGTCCTACCCTGTCCCTGCAGG - Intronic
1117741193 14:58820671-58820693 CCTGGGCACCTTGGCACTGCAGG - Intergenic
1124091995 15:26614086-26614108 CCTTGGCACCCTGTCACTACTGG - Intronic
1131208602 15:90473566-90473588 CCTTGTTCCCCTGTCACTGCTGG + Intronic
1133029592 16:3004160-3004182 CCGAGGTACCAGGTCACGGCTGG + Intergenic
1145942361 17:28749316-28749338 CCGTGTCACCTTCTCCCTGCTGG + Exonic
1152537170 17:80957516-80957538 CAGGGGTACCTTGTAGCTGCTGG + Intronic
1152631412 17:81412186-81412208 CCGTGGGCCCTGGTCACTCCAGG + Intronic
1152658475 17:81530797-81530819 TCCTGGGACCCTGTCACTGCTGG - Intronic
1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG + Intronic
1163863545 19:19754844-19754866 CCGTGGAACCTGGTCAGTGAGGG - Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
939974097 2:148696266-148696288 CAGTGAGACCTTGTCACTACAGG + Intronic
942779028 2:179618796-179618818 TTGAGGTACCTTGTCACTACTGG - Intronic
947184089 2:227439436-227439458 GGGTGGTTCCTTGTTACTGCTGG - Intergenic
947240891 2:227993398-227993420 CTGTGGTTCCATGTCACTGGAGG - Intronic
1172773365 20:37394021-37394043 CCGTCGTCCCTGGACACTGCCGG + Intronic
1175154789 20:56963320-56963342 CACTGCTACCCTGTCACTGCAGG + Intergenic
1180028608 21:45185070-45185092 CCGTGCAATCTTGTCACTGCAGG - Exonic
1181026233 22:20129363-20129385 CCGAGGGGCCTTCTCACTGCTGG - Intergenic
1182528415 22:30936643-30936665 CTGTAGTACCTTGTCTCTACAGG - Exonic
954736757 3:52713945-52713967 CCATGGTACCTGGCCACTGAGGG - Intronic
968562483 4:1291625-1291647 CCGTGGTGGTTTGTCACTTCTGG + Intronic
976821566 4:89212929-89212951 CCTTGGCACTTTGTCAATGCAGG + Intergenic
981100084 4:140820224-140820246 CCATGGCACCTGGTCACTGATGG + Intergenic
982135197 4:152268579-152268601 CCATAGCACCTTCTCACTGCAGG - Intergenic
983278413 4:165648531-165648553 CAGTGGTACATGCTCACTGCAGG + Intergenic
988663021 5:33293832-33293854 GAGTGCTACCTTGTTACTGCTGG - Intergenic
990797597 5:59562009-59562031 TCTTTGTACCTTGTGACTGCTGG + Intronic
992614310 5:78534528-78534550 CTCTGGTGCCTTGTGACTGCTGG + Intronic
1006924308 6:37646076-37646098 GTGTACTACCTTGTCACTGCAGG - Intronic
1022156473 7:27665761-27665783 GGGTGGTTCCTTGTTACTGCTGG - Intergenic
1024311078 7:47969690-47969712 CCGTGGTTCCTTCTCAGTGCAGG - Intronic
1027779451 7:82503958-82503980 GGGTGCTACCTTGTTACTGCCGG - Intergenic
1034999962 7:155604556-155604578 CTGTGGTGACTTGTTACTGCAGG + Intergenic
1035891880 8:3353970-3353992 CTGTGGTACTTTGTTACAGCAGG - Intronic
1039468821 8:37801381-37801403 CCGTGGGACCTTTTCCCTGGGGG - Intronic
1052431433 9:28371619-28371641 CCATAGTACCTTGTCACTGCAGG + Intronic
1057268446 9:93633857-93633879 CCGTGGCACCCTGTCTCTGTGGG + Intronic
1059322611 9:113481323-113481345 GTGTGGTTCATTGTCACTGCTGG + Intronic
1186517493 X:10176817-10176839 CTGTGGCACCTGGCCACTGCTGG + Intronic
1189428701 X:40928587-40928609 AGGTGGGACCTTGTTACTGCTGG + Intergenic
1191889644 X:65926847-65926869 CCTTGGCTCCATGTCACTGCAGG + Intergenic
1192914325 X:75636953-75636975 CCTTGGTGCCTAATCACTGCGGG - Intergenic
1193004948 X:76606052-76606074 CAGTGGTGCCTTGTCACAGTGGG + Intergenic
1194494419 X:94594321-94594343 CCTTGGTTCCATGTCACTCCTGG - Intergenic
1196788433 X:119442186-119442208 CAGTGGTGCCTTGGCAGTGCAGG + Intronic