ID: 902533387

View in Genome Browser
Species Human (GRCh38)
Location 1:17104919-17104941
Sequence CTCGCCCAGCACCACCCTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902533387_902533389 2 Left 902533387 1:17104919-17104941 CCCGCAGGGTGGTGCTGGGCGAG 0: 1
1: 0
2: 4
3: 21
4: 292
Right 902533389 1:17104944-17104966 AAGCCAGCGCTGCTTGCCATTGG 0: 1
1: 0
2: 1
3: 8
4: 103
902533387_902533391 5 Left 902533387 1:17104919-17104941 CCCGCAGGGTGGTGCTGGGCGAG 0: 1
1: 0
2: 4
3: 21
4: 292
Right 902533391 1:17104947-17104969 CCAGCGCTGCTTGCCATTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902533387 Original CRISPR CTCGCCCAGCACCACCCTGC GGG (reversed) Exonic
900030046 1:364707-364729 CTAGCCCAGTCCCACCGTGCTGG - Intergenic
900050698 1:593771-593793 CTAGCCCAGTCCCACCGTGCTGG - Intergenic
900179263 1:1304204-1304226 CTCCCCCCGCACCTCCCTGAGGG + Intronic
900317995 1:2069003-2069025 CCCGCCAGTCACCACCCTGCCGG + Intronic
900531859 1:3157834-3157856 CTCCCCCAGCACCGCCGGGCTGG + Intronic
900589824 1:3454623-3454645 CCCGCCCAGCGCCCACCTGCGGG + Exonic
900634801 1:3657774-3657796 CTCCCCCAGCACCTCCCGCCTGG + Intronic
901044048 1:6385089-6385111 CTGGCCCTGCACCAACCTTCTGG + Intronic
901463237 1:9404225-9404247 CACGCCCATGACCACCCTCCGGG - Intergenic
901813343 1:11779882-11779904 CAGGCCCAGCACAGCCCTGCAGG - Exonic
901828971 1:11880564-11880586 CCCGCCCCGCCCCACCCAGCTGG + Intergenic
901842768 1:11964308-11964330 CCCACCCACCCCCACCCTGCAGG - Intronic
902533387 1:17104919-17104941 CTCGCCCAGCACCACCCTGCGGG - Exonic
902653318 1:17851025-17851047 CAGGGCCAGCACCACCCAGCCGG + Intergenic
903240738 1:21981049-21981071 CTCGCCCAACACCACCTGGTAGG - Exonic
903375294 1:22862048-22862070 CTCTCCCAGCTTCAGCCTGCTGG - Intronic
904056261 1:27672353-27672375 CTCTCCCAGCTCCGCCCAGCGGG + Intergenic
904295932 1:29519714-29519736 CTCGCCCTGCCCCACCATGGAGG - Intergenic
904885137 1:33731920-33731942 TTCCCCCACAACCACCCTGCTGG - Intronic
905183299 1:36179327-36179349 CACGCCCAGCACTGCCCTTCGGG - Intronic
905512130 1:38530051-38530073 CTCGGTCAGCACCTGCCTGCTGG + Intergenic
906460564 1:46032712-46032734 CACGCCCAGCACTAACCTTCAGG - Exonic
906650546 1:47509389-47509411 CTCTCCCAGCTCCTCCCTTCAGG - Intergenic
907392815 1:54169359-54169381 CTTGCCAAGCACCACACTGTTGG - Intronic
908248302 1:62245176-62245198 CTCCCCCAGGACAACCCAGCAGG + Intronic
911269817 1:95787653-95787675 TTCCCCCAGCACCGCCCTGATGG + Intergenic
912586587 1:110772243-110772265 CTCCCCCAGCATTACCCTCCAGG + Intergenic
914805151 1:150986099-150986121 ATCACCAAGCACCAACCTGCTGG - Intronic
915555422 1:156658254-156658276 CTCACCCAGCCCCATCTTGCAGG - Exonic
917193527 1:172443790-172443812 CCCTCCCAGCCCCACTCTGCGGG - Exonic
920556715 1:206909606-206909628 CACTCCCAGCTCCACCCTGTGGG + Intronic
920703580 1:208235751-208235773 CCCTCCCAGCACAATCCTGCAGG - Intronic
922812461 1:228425173-228425195 CTCGCGAAGCGCCACCGTGCCGG + Exonic
1062857370 10:785978-786000 CCCGCCCGGCTCCATCCTGCAGG - Intergenic
1067469927 10:46528648-46528670 CTCGCCCTGGACAACCCAGCAGG - Intergenic
1068895125 10:62190503-62190525 CTCGCCTGGCATCACCCTACTGG + Intronic
1069772689 10:70909687-70909709 CTCAGCCAGGCCCACCCTGCTGG + Intergenic
1071334155 10:84588011-84588033 TTCTCCCAGCACCACCCTGCAGG - Intergenic
1071562431 10:86654845-86654867 CCACCCCAGCACCACCCAGCTGG + Exonic
1072804592 10:98416674-98416696 CTGGCCCAGCACCGGCCTCCTGG + Exonic
1073043250 10:100621516-100621538 CCCGCCCAGCCCCTCCCTGGCGG + Intergenic
1075580240 10:123612038-123612060 CTCAGCCAGGACCACCCAGCTGG - Intergenic
1075711409 10:124532757-124532779 CTCACCCAGCATCACCCAGCTGG + Intronic
1076344722 10:129772604-129772626 CTCACCGGGCACCACCCAGCCGG + Intergenic
1076344743 10:129772680-129772702 CTCACCGGGCACCACCCAGCCGG + Intergenic
1076645917 10:131954126-131954148 CTGGGCCAGCACCAGGCTGCTGG + Intronic
1076671397 10:132122678-132122700 CTCCCACATCCCCACCCTGCAGG - Intronic
1076784344 10:132742295-132742317 CACGCGCAGCCCCGCCCTGCAGG + Intronic
1077037275 11:501480-501502 CTGGCCCAGCACCTCCAGGCAGG - Intronic
1077282714 11:1752911-1752933 CAGTCCCAGCACCACCCTGCAGG + Exonic
1077298451 11:1836707-1836729 CTCGGCCAGAATCACCCTCCCGG + Intronic
1077540011 11:3142254-3142276 CTCGCCCAGGGCCACACGGCAGG + Intronic
1077921089 11:6642182-6642204 CTCCCCACCCACCACCCTGCTGG + Intronic
1078729015 11:13959177-13959199 AGCTCCCAGCACCACCCAGCTGG - Intergenic
1078935229 11:15943628-15943650 CTGGCCCAGCCCCCACCTGCTGG + Intergenic
1081069880 11:38597439-38597461 CTCTGGCAGCACCACCCCGCTGG + Intergenic
1081623862 11:44635052-44635074 CTTGTCCAGGGCCACCCTGCTGG - Intergenic
1081933679 11:46889943-46889965 CACCCCCAGCGCCAACCTGCAGG - Exonic
1084091411 11:66881512-66881534 CTCGCCCTGCCTCAGCCTGCAGG - Intronic
1084268968 11:68019148-68019170 CTCTCCCTGCACTGCCCTGCAGG + Exonic
1084973109 11:72781914-72781936 CCCGCCCCGCCCCACCCCGCAGG + Intronic
1088612420 11:111590563-111590585 CTCCCCCATCACTACCCAGCTGG + Intergenic
1088848297 11:113685610-113685632 CTCCCCCAAGACCACCCAGCTGG - Intergenic
1089736221 11:120551912-120551934 CTCCCCAGGCACCACCCTCCAGG - Intronic
1090735644 11:129610322-129610344 CTTGCCCATCAGCACCCTGGCGG - Intergenic
1091779284 12:3203899-3203921 CAGGCCAAGCACCAGCCTGCAGG - Intronic
1095093648 12:38131131-38131153 CTCTCCCACCCCCACCCTACAGG - Intergenic
1095604366 12:44049409-44049431 CTCGCCCCCCACCACCCAACAGG - Intronic
1097179911 12:57165954-57165976 CACGCCCTGCCCCACCCTGTTGG + Intronic
1097299348 12:58001910-58001932 CTAGCCCTGCACCCCCCAGCAGG + Intergenic
1100611578 12:96195042-96195064 CTCGCCCAGGGCCCCGCTGCAGG + Intronic
1102012396 12:109626649-109626671 CTCTCCCTGCACCACTCTGGGGG + Intergenic
1103959547 12:124600332-124600354 CTCTCTCAGCACCACACAGCAGG - Intergenic
1103973465 12:124686950-124686972 CTTGCCCAGTCCCAGCCTGCTGG + Intergenic
1106168608 13:27270521-27270543 CTCGCCCCGCAGCAGCCAGCCGG - Exonic
1108313544 13:49218060-49218082 CTCTCCCACCACCAGGCTGCTGG - Intergenic
1111123000 13:83879135-83879157 AAAGCCCAGCACGACCCTGCTGG - Exonic
1112921984 13:104625411-104625433 CTCTCCCAGCGGGACCCTGCAGG + Intergenic
1113575996 13:111395807-111395829 CTCCCTCAGCACCAAGCTGCAGG - Intergenic
1113861379 13:113489979-113490001 CACACCCAGCAGCACCTTGCTGG + Intronic
1119141196 14:72268921-72268943 CTTGCCCAGTAACACACTGCTGG + Intronic
1119400204 14:74357874-74357896 CATGCCCAGCACCTCCCTGGGGG - Exonic
1119431478 14:74570746-74570768 CTGGCCCAGCACTTCCCTGCTGG - Intronic
1119500924 14:75126904-75126926 CTCGCCCAGCACCGACATGGCGG + Exonic
1119766801 14:77195623-77195645 CTCCCCCAGCTCAACCCTGCTGG + Intronic
1121245832 14:92460218-92460240 CTTGCCCAGACTCACCCTGCTGG - Intronic
1122071427 14:99207908-99207930 CTTGCCCAGGGCCACCCAGCTGG - Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122939026 14:104973020-104973042 CCTGCCCAGCACCCGCCTGCTGG - Intronic
1124617075 15:31249479-31249501 CTCACCCACCACACCCCTGCAGG + Intergenic
1127111236 15:55673420-55673442 CTCTCCCAGCCCCACTCTGGTGG + Exonic
1129156520 15:73721641-73721663 CTCGCCCCACACCACCAGGCAGG - Intergenic
1129168200 15:73791281-73791303 CTCTCCCATCACAACCCTCCAGG + Intergenic
1129305028 15:74653959-74653981 CGCGCCCAGCCCTACACTGCAGG - Intronic
1129461797 15:75703484-75703506 CTCGCCCACCCCCAGCCTCCAGG + Intronic
1129653702 15:77508921-77508943 CTGGCCCTGCCCAACCCTGCAGG + Intergenic
1129723056 15:77888362-77888384 CTCGCCCACCCCCAGCCTCCAGG - Intergenic
1130107709 15:80941471-80941493 CTCGCCCAGGACCACACAGCTGG - Intronic
1131712202 15:95068121-95068143 CTCTCCCAGCACCTCTCAGCTGG + Intergenic
1132252033 15:100341533-100341555 CTCGCCCGGCACCTCCACGCTGG + Intronic
1132561223 16:595139-595161 CTCCCACAACACCACCCTGCTGG - Intronic
1132668074 16:1090937-1090959 CTCGGCTGGCCCCACCCTGCAGG + Intronic
1132829239 16:1919382-1919404 AACGCCCAGCAGCAGCCTGCAGG + Intergenic
1132947055 16:2537740-2537762 CCCGCCCAGCCCCGCCCCGCAGG + Intergenic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1133331908 16:4980063-4980085 CTCGCCCAGCAGCACATGGCCGG - Intronic
1135268932 16:21052319-21052341 CTTGCCCACCCCCAACCTGCAGG + Intronic
1136367025 16:29813612-29813634 CTTCCCCATCACCAGCCTGCAGG - Exonic
1138342213 16:56297380-56297402 CTTGCCCAGCATCACACAGCTGG + Intronic
1139504938 16:67394042-67394064 CTCGCCCAGCCCCAGGATGCTGG + Intergenic
1139615456 16:68085778-68085800 CTGGCCCGGCACCCACCTGCAGG - Exonic
1139775168 16:69312025-69312047 CCATCCCAGCACCACCCTGCAGG - Intronic
1140916924 16:79502234-79502256 CTAGCCAAGCACAAGCCTGCTGG + Intergenic
1142516794 17:436729-436751 CACGCCTAGCACCACTCTGATGG - Intergenic
1143461953 17:7109470-7109492 CTCTCCAAGCACAACCCTCCAGG + Intronic
1144548158 17:16216140-16216162 CACGCTCAGCCTCACCCTGCTGG + Intronic
1146903155 17:36601270-36601292 CTAGCCCATCACCAGCCAGCAGG - Intergenic
1147324217 17:39662712-39662734 CTGGCCCAGAGCCCCCCTGCTGG + Intronic
1149531823 17:57401826-57401848 GAAGCCCAGCACCAACCTGCAGG - Intronic
1150006708 17:61474391-61474413 CTCGCCCAGGAACACACAGCTGG - Intronic
1151408038 17:73902215-73902237 CCCGCCCCGCTCCGCCCTGCTGG + Intergenic
1151558857 17:74860444-74860466 CTCACCCAGCAGCTCCTTGCAGG + Intronic
1151976510 17:77486779-77486801 CTCGAGTGGCACCACCCTGCAGG + Intronic
1152258313 17:79253025-79253047 CCCACACAGCACCACCCCGCAGG - Intronic
1152362546 17:79839364-79839386 CTCGCCCCGCACAGCCCGGCCGG + Exonic
1152583832 17:81180453-81180475 CCCGCTCACCACCACCCTGCTGG + Intergenic
1152585692 17:81188519-81188541 CGTGCCCAGCGCCATCCTGCTGG - Intergenic
1152949711 17:83221853-83221875 CTAGCCCAGTCCCACCGTGCTGG + Intergenic
1154133014 18:11752032-11752054 CTCGCTCAGCCCCGCCCAGCGGG - Intronic
1154174518 18:12076659-12076681 CTCGCCCAGCAGGCCCCGGCCGG - Intergenic
1157280541 18:46344176-46344198 CTGACTCAGCACCAGCCTGCAGG + Intronic
1158210798 18:55047668-55047690 CAAGCCCAGCACCTTCCTGCAGG - Intergenic
1159281449 18:66291229-66291251 CTAGCCCCGCACCCCCCAGCAGG - Intergenic
1159800875 18:72898053-72898075 CAAGCTCAGCAGCACCCTGCTGG - Intergenic
1159955742 18:74517160-74517182 CTCACCCAGGCCCACCCTTCTGG + Intronic
1160105924 18:75976085-75976107 CTAGCCCCCAACCACCCTGCAGG - Intergenic
1160500602 18:79399758-79399780 CTCGGCCTGCAACCCCCTGCAGG - Intronic
1160534274 18:79584053-79584075 CACGCCCAGGAGCACCCTGGGGG - Intergenic
1160856840 19:1221582-1221604 CTCCCCCAGCCCCACCCTCGGGG + Intronic
1160960499 19:1718709-1718731 CCTGCCCACCACCACCCTCCAGG + Intergenic
1161249935 19:3275241-3275263 CCAGCCCAGCCCCACCCAGCAGG + Intronic
1161379813 19:3958979-3959001 CTTGCCCAGCGCCACCAGGCTGG - Exonic
1161507530 19:4651970-4651992 CTCATCCAGCACCTCACTGCTGG - Exonic
1162018669 19:7858776-7858798 CCCCCTCAGCCCCACCCTGCTGG - Intronic
1162510155 19:11113172-11113194 CTGGCTCAGCCGCACCCTGCAGG + Intronic
1162711323 19:12597023-12597045 CCGGCCCAGCCCCACGCTGCTGG + Intronic
1163153309 19:15427378-15427400 CTCGCCCATCGACACGCTGCGGG - Exonic
1163155308 19:15436968-15436990 CTCACCCATCAACATCCTGCAGG - Exonic
1163718974 19:18889293-18889315 TTTGCCCAGGGCCACCCTGCTGG + Intronic
1164583426 19:29449554-29449576 CTGGCCCAGCCCCACGCGGCAGG - Intergenic
1164617582 19:29676105-29676127 CTGGCCTAGCACCATCCTCCTGG + Intergenic
1165779715 19:38425480-38425502 CACCCCCAGCACCACTCTGATGG - Intronic
1166042915 19:40214040-40214062 CTCGCCCAGCACCAACCCCCTGG + Exonic
1166161197 19:40954720-40954742 CCAGCCCCACACCACCCTGCAGG - Intergenic
1166387841 19:42391885-42391907 GTCTCCCAGCACCACCCAGATGG + Intergenic
1167443630 19:49524759-49524781 CTCACCCAGCTCCACCCTGAGGG - Exonic
1168076614 19:53983741-53983763 CTGCCCCAGCTCCGCCCTGCTGG - Exonic
927148195 2:20180422-20180444 CTCCACCACCACCACCATGCAGG - Intergenic
927433388 2:23046218-23046240 CTTGCCCCCCACCACCCTACAGG - Intergenic
927809127 2:26172488-26172510 CTCGCCCAGCTCCACGGAGCCGG + Intergenic
928115827 2:28544633-28544655 GTGGCCCAGCACAACACTGCTGG - Intronic
929141499 2:38670460-38670482 CACGCCCAGGAGCACCCTGGTGG + Intronic
929808796 2:45170411-45170433 CCCGCCCCGCACCTCCCTCCAGG - Intergenic
930029204 2:47048083-47048105 CTGGGCCAGCCCCACACTGCTGG + Intronic
931913198 2:66924793-66924815 CTGGCCAAGCACAGCCCTGCAGG - Intergenic
932771395 2:74502729-74502751 CGCGCCCACCGCCACCCTCCCGG + Intronic
935392081 2:102563523-102563545 CTTGCTCAGCATCACCCAGCAGG - Intergenic
935641969 2:105299484-105299506 ATCGCCCAGCCTCACCCTGGAGG + Intronic
935929566 2:108109267-108109289 CTCTCCCTGCAACACCCTGATGG + Intergenic
937915396 2:127096491-127096513 CTTGCCCAGCGCCACACAGCGGG + Intronic
937921966 2:127137294-127137316 CTCTCCCAGCACCCCTCTGTGGG - Intergenic
938319767 2:130355387-130355409 CTCGACCTGCACAAGCCTGCTGG - Intergenic
942592062 2:177556882-177556904 ATCTCCCAACACCACCATGCTGG - Intergenic
943672514 2:190678670-190678692 CTCTCCCACCCCCACCTTGCTGG - Intronic
945259589 2:207831357-207831379 CTTACCGAGCACCACGCTGCCGG + Intronic
948290139 2:236818467-236818489 CTACCCCGGCAGCACCCTGCTGG + Intergenic
948402251 2:237692424-237692446 CTCGGCCCGCTCCACCCGGCGGG - Exonic
948653307 2:239462393-239462415 CTCACCCAGCTGCTCCCTGCTGG - Intergenic
948707701 2:239805227-239805249 CTCGCTGAGCATCACCCTGTAGG - Intergenic
949022652 2:241750190-241750212 CTCACCCAGCATCCCCTTGCAGG - Exonic
949070129 2:242019447-242019469 CTCGCTCAGCTCCAGCCTGCTGG - Intergenic
1168841705 20:913961-913983 CTCCCCCAACACCTCCCTGAGGG - Intronic
1169394940 20:5220726-5220748 CTTGACCAGCCCCACCCTTCAGG + Intergenic
1172528659 20:35616353-35616375 CCCGCCCAGCACCGCCCTTTAGG - Intronic
1172614393 20:36274038-36274060 CTCGCCCAGCAACACACAGCTGG - Intergenic
1173115869 20:40242191-40242213 CACCCCCAGCACCATCCTCCAGG + Intergenic
1174101181 20:48127329-48127351 CCCGCTCAGCTCCAGCCTGCTGG + Intergenic
1174156263 20:48517402-48517424 CCCGCTCAGCTCCAGCCTGCTGG + Intergenic
1174406993 20:50309072-50309094 CTCGCCCATCACCCCCTAGCTGG - Intergenic
1174536889 20:51258310-51258332 CTCTCCAGGCACCACCCTCCAGG + Intergenic
1175527378 20:59644730-59644752 CTCTCCCTGCACCAGCCTGGTGG + Intronic
1176030749 20:63009981-63010003 CTGGCCCAAGACCACCCAGCGGG - Intergenic
1178198159 21:30372069-30372091 CTCTCCCAGCACCTGCCAGCTGG - Exonic
1178202693 21:30425768-30425790 CTCTCCCAGCACCTGCCAGCTGG - Exonic
1178203555 21:30436822-30436844 CTCTCCCAGCACCTGCCAGCTGG - Intergenic
1178948256 21:36966207-36966229 CGCGTCCAGCACCGCCCGGCTGG + Intronic
1179197482 21:39178991-39179013 ATGGCCTAGCACCACCCTGTTGG + Intronic
1179468874 21:41597398-41597420 CCCTCCCAGGCCCACCCTGCTGG - Intergenic
1179557587 21:42190303-42190325 CTGGCCAAGAACCACCCTGTAGG + Intergenic
1179973631 21:44850530-44850552 CTCTCCCCACACCACCCAGCAGG - Exonic
1180158619 21:45989440-45989462 CTCCCCCAGCTCCACCTTGGAGG + Intronic
1180162392 21:46003991-46004013 CTAGCCCAGCGCCACCTTCCTGG - Exonic
1181027245 22:20133122-20133144 CCCACCCAGCCCCAGCCTGCAGG - Intronic
1181085854 22:20439007-20439029 CTCCTCCAGCCCCACCCTTCGGG - Intronic
1181162027 22:20965069-20965091 CGGGCCCAGCACCGCCCCGCCGG - Intergenic
1182230964 22:28837234-28837256 CTCTCCCACCACCATCCCGCTGG - Intergenic
1183298168 22:37044276-37044298 CGCGCTGAGCCCCACCCTGCTGG + Intergenic
1183828444 22:40405735-40405757 CTACTTCAGCACCACCCTGCTGG + Exonic
1184254398 22:43278867-43278889 CAGGCCCAGCTCCACCCTCCTGG - Intronic
1184781635 22:46652558-46652580 CGCTCCCACCCCCACCCTGCAGG + Intronic
950669082 3:14514444-14514466 CCCGCCCGGCCCCACCGTGCTGG + Exonic
950725292 3:14913373-14913395 CTGCCCCAGCACAGCCCTGCAGG + Intronic
953888598 3:46734184-46734206 CTTCCCCTTCACCACCCTGCAGG + Exonic
954415498 3:50391351-50391373 CTGGCCCAGCTCCTCCCTGGTGG + Intronic
955368755 3:58333014-58333036 GTCGTCCAGCAGCACCTTGCCGG - Exonic
955404714 3:58618778-58618800 CTGCCCCAACACCACCCTCCAGG - Intronic
955570326 3:60298103-60298125 CTCTACGAGCACCACCCTCCAGG + Intronic
956746222 3:72312856-72312878 ATCTCCCAGCAGCACCATGCAGG - Intergenic
962007375 3:131361941-131361963 CTCGGCCAGCTCCAGCCTGCGGG - Intergenic
962009788 3:131381815-131381837 CTCGCCTAGCTCCAGCCTGCGGG - Exonic
963770140 3:149380242-149380264 CCCGCCCCGCAGCGCCCTGCCGG + Intergenic
966372116 3:179261283-179261305 CTCGGCCCGCTCCACCCGGCGGG + Intronic
968392521 4:205181-205203 CAGACCCAGCTCCACCCTGCGGG + Intergenic
968405423 4:336537-336559 CTGGCCCGGCTCCACCCCGCGGG + Intergenic
968410561 4:386476-386498 CTGGGCCAGAGCCACCCTGCGGG - Intergenic
968601768 4:1513036-1513058 CCCGCCCAGCACCGCCCAGGAGG + Intergenic
968871272 4:3243808-3243830 CTCGCCCATCACAGCCCTGCTGG - Exonic
968878489 4:3286620-3286642 CTCGCCCTGCATCCACCTGCGGG - Intergenic
968939695 4:3631418-3631440 CTCACCCTGCCCCACCCTCCAGG + Intergenic
968972270 4:3802282-3802304 CTCACCCAGCATCACCCTGCAGG + Intergenic
969688205 4:8688704-8688726 CTTGCCCGGCGCCACCCAGCTGG - Intergenic
970625004 4:17867078-17867100 CTCCCCCAGCACCACTCTGCTGG + Intronic
975023541 4:69520745-69520767 ATGGCTCAGCACCATCCTGCAGG + Intronic
977685544 4:99843121-99843143 CAGGCCCAGCCTCACCCTGCAGG + Intronic
979325176 4:119370736-119370758 CTCCCCAAGCTCCACCTTGCAGG + Intergenic
982198062 4:152936059-152936081 CTAGCCCCGCACCAGCCTTCGGG + Intergenic
983243081 4:165255760-165255782 CTCCCCAAGCTCCACCTTGCAGG + Intronic
984522195 4:180815195-180815217 CTCGCTCAGATCCATCCTGCAGG - Intergenic
985555351 5:555411-555433 GTAGCCCAGCACCCCCCTGGGGG + Intergenic
985994809 5:3591988-3592010 CCCGCCCTGCCCCACCCTCCTGG - Intergenic
986721629 5:10564463-10564485 CCCGGCCAGCAGCACCATGCCGG - Exonic
988567338 5:32329848-32329870 CTCGCCCAGGATCACAGTGCTGG + Intergenic
997202574 5:132020724-132020746 CTCACCCTGCACCTCCCTCCAGG + Intergenic
997596633 5:135111493-135111515 CTCCCCCTGCACCACCCAACAGG - Intronic
997634162 5:135392318-135392340 CTCCTCCAGTGCCACCCTGCTGG + Intronic
998376164 5:141692300-141692322 CTCGCACAGCGCCTCCCTGCTGG - Intergenic
1001407247 5:171484810-171484832 CTCACCCAAGACCACCCAGCTGG + Intergenic
1001577167 5:172771746-172771768 CTTGCCCAGAACCACACTACTGG + Intergenic
1001959474 5:175871699-175871721 CTCGGCCAGCACCGACCTGGCGG - Intronic
1002467098 5:179413017-179413039 CTCCCCCAGCACGGCCATGCTGG + Intergenic
1002743943 5:181455665-181455687 CTAGCCCAGTCCCACCGTGCTGG + Intergenic
1002790241 6:432159-432181 CCCCCACCGCACCACCCTGCGGG - Intergenic
1002854659 6:1026374-1026396 CCCTCCCAGCACCACCCGACTGG + Intergenic
1003294326 6:4810706-4810728 CTCGCCAGGCACCAATCTGCTGG - Intronic
1004503174 6:16227024-16227046 CCCGCCCCGCCCCGCCCTGCGGG + Intergenic
1005474778 6:26197098-26197120 CTCGCGCAGAGCCACCGTGCCGG + Exonic
1005850541 6:29817497-29817519 CTCAGCCAGCACCACTCTCCGGG + Intergenic
1005857388 6:29872909-29872931 CTCAGCCAGCACCACTCTCCGGG + Intergenic
1010534548 6:77011363-77011385 CGCCCCCCGCCCCACCCTGCCGG - Intergenic
1015186776 6:130426224-130426246 CTCGCCCAGCTCCAGCCTTAAGG + Intronic
1015282196 6:131445730-131445752 CTAGCCCCCCACCACCCTACAGG - Intergenic
1015923333 6:138286974-138286996 GTCCCCCTGCCCCACCCTGCTGG - Intronic
1017000190 6:149991081-149991103 CGCGCCCAGCACCAGGCTGTAGG - Intergenic
1017986235 6:159445401-159445423 CTGCCCTAGCACCACCATGCTGG + Intergenic
1018613448 6:165663474-165663496 CTCGCCCAGCAGCGCACAGCTGG - Intronic
1019248802 6:170728894-170728916 CTAGCCCAGTCCCACCGTGCTGG + Intergenic
1020873728 7:13668219-13668241 CTAGCCCCCCACCACCCAGCAGG + Intergenic
1021085926 7:16421147-16421169 CTCTCCCCGCACCCCCCGGCAGG + Exonic
1030872613 7:114775512-114775534 CCTGCCTGGCACCACCCTGCTGG - Intergenic
1032441955 7:131948727-131948749 CTAGCACAGCCACACCCTGCTGG - Intergenic
1034438970 7:151077012-151077034 CAACACCAGCACCACCCTGCAGG + Exonic
1034992280 7:155555390-155555412 CCTGCCCAGCACCCTCCTGCCGG - Intergenic
1035272662 7:157729657-157729679 CCCTCCCAGGACCTCCCTGCAGG - Intronic
1035289787 7:157830446-157830468 CACGGCCAGCCCCTCCCTGCTGG - Intronic
1035499243 8:78441-78463 CTAGCCCAGTCCCACCGTGCTGG - Intronic
1036751979 8:11449345-11449367 CCCGGCCAGCACCTCTCTGCCGG - Intronic
1038577486 8:28717435-28717457 CTCCCCCAGCACCACCGGGACGG - Exonic
1040072547 8:43200345-43200367 CTTGCCCAGCATCACCCAGCAGG - Exonic
1040316405 8:46263207-46263229 CTCGCCCAGGACAGCCCTGGGGG - Intergenic
1040887838 8:52284564-52284586 CTCTCCCAGCTCCACCCTGGTGG - Intronic
1041727450 8:61031318-61031340 CTCTGCAAGCACCACCCTGCAGG - Intergenic
1047216675 8:122881697-122881719 CTTGCCCAAGGCCACCCTGCAGG + Intronic
1049388046 8:142354116-142354138 CTCATCCACCCCCACCCTGCAGG - Intronic
1049401190 8:142428128-142428150 CACGCCCGGCACCACCTTCCAGG + Intergenic
1049660131 8:143816114-143816136 TTCTCTCAGCACCACCCTGCGGG + Intergenic
1050880907 9:10699643-10699665 CTCAGCCAGCACCACTATGCAGG - Intergenic
1051154505 9:14125655-14125677 TTCCCCCAGCACCACCATCCCGG - Exonic
1052375711 9:27715781-27715803 CTTGCTCAGCACTGCCCTGCAGG + Intergenic
1052884748 9:33633959-33633981 CCCGGCCAGCACCTCCCTTCTGG + Intergenic
1053114518 9:35489807-35489829 GTCGCCAGGCACCACCCCGCGGG + Intergenic
1054451079 9:65403912-65403934 CTCACCCCGCCCCACCCTCCAGG - Intergenic
1057171639 9:92966524-92966546 GTCCCCCAGCCCCACCCTCCAGG + Intronic
1057177639 9:93011297-93011319 CTCTTGCTGCACCACCCTGCCGG - Intronic
1058410408 9:104725087-104725109 CTCGCCCTGCACCCACCTGATGG + Intergenic
1059492034 9:114675986-114676008 CTCCCACAGCACTCCCCTGCTGG + Intergenic
1060513457 9:124250785-124250807 ATCACCCAGGACCATCCTGCAGG + Intergenic
1060974165 9:127754954-127754976 CCAGCCCAGCCCGACCCTGCCGG + Intronic
1061071153 9:128311496-128311518 CTCTCCCAGTACCTCCCTGAGGG + Intronic
1061377519 9:130235127-130235149 CTCCCCCACCAACATCCTGCAGG + Exonic
1061453482 9:130681537-130681559 GCCGCCCAGCACCGCGCTGCAGG + Exonic
1061484709 9:130914447-130914469 CTCCTCCAGGGCCACCCTGCTGG - Intronic
1062096440 9:134706297-134706319 CAGGCCCAGGACCACCGTGCAGG + Intronic
1062147424 9:134997376-134997398 CTCAGCCAGCAGCACCCTCCTGG + Intergenic
1062472751 9:136713420-136713442 CTGACCCAGGACCACCCTGCGGG - Intronic
1062524873 9:136974121-136974143 CTCTCCCAGCACCACCCTGGAGG - Intergenic
1203791623 EBV:154696-154718 ATCGTCCAGCACCCGCCTGCAGG + Intergenic
1203609758 Un_KI270748v1:86158-86180 CTAGCCCAGTCCCACCGTGCTGG + Intergenic
1185611380 X:1395423-1395445 CACAGACAGCACCACCCTGCTGG - Intergenic
1185615457 X:1419163-1419185 CTCGCCCAGCCTCTCCCTGGGGG + Intronic
1186575988 X:10766345-10766367 CACCCCCAGCCCCACCCTCCAGG - Intronic
1188738001 X:33742051-33742073 CTCGCCCTGCCCCAACCTGATGG - Intergenic
1192300272 X:69893921-69893943 CTCCCCCAGCACCAACTTTCTGG + Intronic
1193635388 X:83943894-83943916 CACCCCCAGCATCACTCTGCTGG - Intergenic
1193769452 X:85571827-85571849 GGGGCCCATCACCACCCTGCTGG + Intergenic
1194437051 X:93879685-93879707 CTCGTCCAGCAGCACCCAACAGG - Intergenic
1196780298 X:119377486-119377508 CTCATCCAGCACCACCATCCAGG + Intergenic
1198822780 X:140666535-140666557 CTCAGCCAGCACCACCATTCTGG - Intergenic
1199600930 X:149540613-149540635 TTCTCCCAGCTCCTCCCTGCTGG + Intronic