ID: 902536669

View in Genome Browser
Species Human (GRCh38)
Location 1:17122904-17122926
Sequence AACTACCGTCTACTGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902536669_902536673 22 Left 902536669 1:17122904-17122926 CCAAGTTCCAGTAGACGGTAGTT No data
Right 902536673 1:17122949-17122971 TTTTAAGTTTTTGTAAACATGGG No data
902536669_902536672 21 Left 902536669 1:17122904-17122926 CCAAGTTCCAGTAGACGGTAGTT No data
Right 902536672 1:17122948-17122970 ATTTTAAGTTTTTGTAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902536669 Original CRISPR AACTACCGTCTACTGGAACT TGG (reversed) Intergenic
No off target data available for this crispr