ID: 902540730

View in Genome Browser
Species Human (GRCh38)
Location 1:17152652-17152674
Sequence ACTAGGCTGTGCCCCAGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902540730_902540734 -6 Left 902540730 1:17152652-17152674 CCCTAACTGGGGCACAGCCTAGT No data
Right 902540734 1:17152669-17152691 CCTAGTGGAGCTGTGAGAAGAGG No data
902540730_902540736 16 Left 902540730 1:17152652-17152674 CCCTAACTGGGGCACAGCCTAGT No data
Right 902540736 1:17152691-17152713 GGCCACCAAACTCCAGACCCTGG No data
902540730_902540739 21 Left 902540730 1:17152652-17152674 CCCTAACTGGGGCACAGCCTAGT No data
Right 902540739 1:17152696-17152718 CCAAACTCCAGACCCTGGAATGG No data
902540730_902540735 -5 Left 902540730 1:17152652-17152674 CCCTAACTGGGGCACAGCCTAGT No data
Right 902540735 1:17152670-17152692 CTAGTGGAGCTGTGAGAAGAGGG No data
902540730_902540740 24 Left 902540730 1:17152652-17152674 CCCTAACTGGGGCACAGCCTAGT No data
Right 902540740 1:17152699-17152721 AACTCCAGACCCTGGAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902540730 Original CRISPR ACTAGGCTGTGCCCCAGTTA GGG (reversed) Intergenic