ID: 902542173

View in Genome Browser
Species Human (GRCh38)
Location 1:17163217-17163239
Sequence CCTGCGAAGGAGGAGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902542173_902542179 0 Left 902542173 1:17163217-17163239 CCAGGCCACTCCTCCTTCGCAGG No data
Right 902542179 1:17163240-17163262 CCTGTTTTTCCATCTGCGCATGG No data
902542173_902542181 2 Left 902542173 1:17163217-17163239 CCAGGCCACTCCTCCTTCGCAGG No data
Right 902542181 1:17163242-17163264 TGTTTTTCCATCTGCGCATGGGG No data
902542173_902542182 3 Left 902542173 1:17163217-17163239 CCAGGCCACTCCTCCTTCGCAGG No data
Right 902542182 1:17163243-17163265 GTTTTTCCATCTGCGCATGGGGG No data
902542173_902542180 1 Left 902542173 1:17163217-17163239 CCAGGCCACTCCTCCTTCGCAGG No data
Right 902542180 1:17163241-17163263 CTGTTTTTCCATCTGCGCATGGG No data
902542173_902542185 14 Left 902542173 1:17163217-17163239 CCAGGCCACTCCTCCTTCGCAGG No data
Right 902542185 1:17163254-17163276 TGCGCATGGGGGAATGGCCCTGG No data
902542173_902542183 8 Left 902542173 1:17163217-17163239 CCAGGCCACTCCTCCTTCGCAGG No data
Right 902542183 1:17163248-17163270 TCCATCTGCGCATGGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902542173 Original CRISPR CCTGCGAAGGAGGAGTGGCC TGG (reversed) Intergenic
No off target data available for this crispr