ID: 902543029

View in Genome Browser
Species Human (GRCh38)
Location 1:17167679-17167701
Sequence GAAAATGCAGAGAGGAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902543021_902543029 7 Left 902543021 1:17167649-17167671 CCCCCTGGAGGAGGTGTTTAGAG No data
Right 902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG No data
902543024_902543029 4 Left 902543024 1:17167652-17167674 CCTGGAGGAGGTGTTTAGAGATG No data
Right 902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG No data
902543023_902543029 5 Left 902543023 1:17167651-17167673 CCCTGGAGGAGGTGTTTAGAGAT No data
Right 902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG No data
902543022_902543029 6 Left 902543022 1:17167650-17167672 CCCCTGGAGGAGGTGTTTAGAGA No data
Right 902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902543029 Original CRISPR GAAAATGCAGAGAGGAAGAT GGG Intergenic
No off target data available for this crispr