ID: 902545301

View in Genome Browser
Species Human (GRCh38)
Location 1:17186124-17186146
Sequence GCTATGCCTCCCCATCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902545297_902545301 9 Left 902545297 1:17186092-17186114 CCCATCAGACTAGATGATCTGTG No data
Right 902545301 1:17186124-17186146 GCTATGCCTCCCCATCAGATTGG No data
902545298_902545301 8 Left 902545298 1:17186093-17186115 CCATCAGACTAGATGATCTGTGT No data
Right 902545301 1:17186124-17186146 GCTATGCCTCCCCATCAGATTGG No data
902545295_902545301 11 Left 902545295 1:17186090-17186112 CCCCCATCAGACTAGATGATCTG No data
Right 902545301 1:17186124-17186146 GCTATGCCTCCCCATCAGATTGG No data
902545296_902545301 10 Left 902545296 1:17186091-17186113 CCCCATCAGACTAGATGATCTGT No data
Right 902545301 1:17186124-17186146 GCTATGCCTCCCCATCAGATTGG No data
902545294_902545301 28 Left 902545294 1:17186073-17186095 CCATGGGAGCTGTGTTTCCCCCA No data
Right 902545301 1:17186124-17186146 GCTATGCCTCCCCATCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902545301 Original CRISPR GCTATGCCTCCCCATCAGAT TGG Intergenic
No off target data available for this crispr