ID: 902546194

View in Genome Browser
Species Human (GRCh38)
Location 1:17191979-17192001
Sequence AAGAAAAAGGAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902546194_902546198 20 Left 902546194 1:17191979-17192001 CCCTCTTCCTTCTCCTTTTTCTT No data
Right 902546198 1:17192022-17192044 AGAGTCTCACTCTGCTGCCCAGG 0: 255
1: 8303
2: 36279
3: 93392
4: 172042
902546194_902546199 21 Left 902546194 1:17191979-17192001 CCCTCTTCCTTCTCCTTTTTCTT No data
Right 902546199 1:17192023-17192045 GAGTCTCACTCTGCTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902546194 Original CRISPR AAGAAAAAGGAGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr