ID: 902546519

View in Genome Browser
Species Human (GRCh38)
Location 1:17193842-17193864
Sequence CAGAAAAGAGAGCAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1102
Summary {0: 1, 1: 0, 2: 10, 3: 110, 4: 981}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902546514_902546519 -7 Left 902546514 1:17193826-17193848 CCAGAGGTGTTCTTCCCAGAAAA 0: 1
1: 0
2: 2
3: 18
4: 194
Right 902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG 0: 1
1: 0
2: 10
3: 110
4: 981
902546513_902546519 -6 Left 902546513 1:17193825-17193847 CCCAGAGGTGTTCTTCCCAGAAA 0: 1
1: 0
2: 2
3: 18
4: 253
Right 902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG 0: 1
1: 0
2: 10
3: 110
4: 981
902546508_902546519 22 Left 902546508 1:17193797-17193819 CCTAGAAGAGAGGGCGAGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 141
Right 902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG 0: 1
1: 0
2: 10
3: 110
4: 981

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902546519 Original CRISPR CAGAAAAGAGAGCAGGAGGC AGG Intergenic
900202085 1:1412895-1412917 CAGACAAGGGAGCAGTAAGCAGG + Intergenic
900228103 1:1542264-1542286 CAGAAACCAGCGCAGCAGGCAGG + Intronic
900345456 1:2208308-2208330 AAGAAAAGAGACCAGAAGGCGGG - Intronic
900395698 1:2452426-2452448 CAGGAGGGAGAGCAGGAGGCAGG - Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900780084 1:4612270-4612292 CAGAAAAGGGGAGAGGAGGCGGG - Intergenic
901035143 1:6331887-6331909 CAGAAGAGACGGCAGGAAGCAGG + Intronic
901235944 1:7667665-7667687 CAGAAAGGACAGAAGGAGTCAGG - Intronic
901647336 1:10723722-10723744 GAGAAAAGAGAGTGGGAGACAGG - Intronic
901689276 1:10962011-10962033 CAGAACTGAGAGGAGGAGGTTGG - Intronic
901717980 1:11172137-11172159 CAGGAAAGAGGGCAACAGGCTGG + Intronic
901720775 1:11195465-11195487 GAGAAAGGAGTGAAGGAGGCAGG + Exonic
901754746 1:11434736-11434758 GGGAGAAGAGAGCAGGTGGCTGG + Intergenic
902286975 1:15413240-15413262 CAGTCACTAGAGCAGGAGGCAGG + Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902770150 1:18640995-18641017 AAGAAGAGAGAGGGGGAGGCGGG + Intronic
902781622 1:18708719-18708741 CAGAAAGGAGAACACAAGGCTGG + Intronic
902793914 1:18787950-18787972 AGGAAAAGAGAGAGGGAGGCAGG + Intergenic
902859878 1:19237508-19237530 CCACAAAGTGAGCAGGAGGCCGG + Intronic
902918271 1:19651666-19651688 AAGAAAAGAGGGAGGGAGGCAGG - Intronic
903298935 1:22364258-22364280 AAGAGAAGAGAGGTGGAGGCAGG - Intergenic
903639384 1:24848259-24848281 CAGGAAGGAGGGAAGGAGGCCGG - Intergenic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
904031855 1:27538103-27538125 CAAAAAAGAGTGCATGAGGCCGG + Intronic
904045103 1:27603965-27603987 CAGCGGAGAGAGCAGAAGGCAGG - Intronic
904109332 1:28113112-28113134 CAGAATAGAGAACTGGAGGCGGG + Intergenic
904535497 1:31196804-31196826 CAGAAAAGAGTGCTGCTGGCAGG - Intronic
904720931 1:32508058-32508080 CAGAAGAAAGAACAGTAGGCTGG - Intronic
904895815 1:33817279-33817301 GAAAAAAGAGAGAAGAAGGCAGG + Intronic
905040365 1:34951776-34951798 CAGAATAGAGAGGAAGAGACAGG - Intergenic
905145879 1:35886366-35886388 TAGGAAAGACAGCAGGAAGCAGG - Intronic
905809714 1:40903003-40903025 TAGAAAAGAGAGCAAGTGCCTGG - Intergenic
906044433 1:42817109-42817131 GAGGGAAGAGGGCAGGAGGCGGG - Exonic
906307373 1:44728192-44728214 AAGAAAAGAGAACAGGAAGAGGG - Intergenic
906482048 1:46205567-46205589 CAGAGAAGAGAGCCAGAGACTGG - Intronic
906517040 1:46445704-46445726 CAGACCAGAGATCATGAGGCCGG - Intergenic
906566213 1:46803044-46803066 CAGAATGGAGAGGATGAGGCTGG + Intronic
906592104 1:47034905-47034927 AAGAAATGAGAACAGGAGGGAGG - Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
907616294 1:55930196-55930218 CAGAAAGGAGAGCTGGAGATGGG + Intergenic
908551196 1:65210363-65210385 AAGAAAGGAGAACAGGAGGATGG - Intronic
908798324 1:67853438-67853460 AAGAAAAGAGAGAGGGAGGGAGG - Intergenic
908903573 1:68983174-68983196 GAGAAAAGGGGGCAGGAGACAGG + Intergenic
909793275 1:79701558-79701580 CGGAGCAGAGAGCAGGAGGACGG + Intergenic
909798471 1:79774664-79774686 CAGGAAAGAGAGGAGGGGGGAGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910354219 1:86336826-86336848 CAGAAAACAGAAGTGGAGGCAGG + Intergenic
911911928 1:103648327-103648349 CAGACAAGGGAGCAGTAAGCAGG + Intergenic
911916526 1:103703621-103703643 CAGACAAGGGAGCAGTAAGCAGG - Intronic
911919343 1:103742465-103742487 CAGACAAGGGAGCAGTAAGCAGG + Intronic
912436119 1:109662133-109662155 CAGAAAAGAGATCAAGAAGTTGG - Intronic
912519247 1:110234048-110234070 CAGAAAGGAGAGGCAGAGGCAGG - Intronic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912807887 1:112772592-112772614 TAGAAAATAGGGCGGGAGGCTGG - Intergenic
913225040 1:116691700-116691722 CAGAAAAGAGAGAATGTGGGTGG - Intergenic
913599092 1:120405737-120405759 GAGAAAACAGAGCAAGAAGCTGG - Intergenic
914088286 1:144473883-144473905 GAGAAAACAGAGCAAGAAGCTGG + Intergenic
914310325 1:146460327-146460349 GAGAAAACAGAGCAAGAAGCTGG - Intergenic
914591784 1:149112815-149112837 GAGAAAACAGAGCAAGAAGCTGG + Intergenic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
915294102 1:154908037-154908059 CAAAAGAGAGAACAGAAGGCAGG + Intergenic
915507245 1:156365811-156365833 GAGCCAAGAGAGCAGGAGGTTGG + Intronic
915562735 1:156696877-156696899 AGGAAAAGCCAGCAGGAGGCTGG - Intergenic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915624449 1:157106249-157106271 CAAAACAGAGAGCACCAGGCTGG - Intergenic
915803366 1:158818195-158818217 CAGAAAAGAAATCATGAGTCTGG - Intergenic
916045631 1:160998167-160998189 AAGAAAAGAAAACTGGAGGCTGG - Exonic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916163060 1:161938920-161938942 CAGAAAAGTGAGCTGGTGACTGG - Intronic
916229852 1:162530952-162530974 GAGACAAGAGGGCAGGAGACAGG - Intergenic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916788460 1:168104022-168104044 CTGAAAGGAGAGCAGGGGGAAGG - Intronic
916808481 1:168283563-168283585 GAGAAAAGAGAGAAGGAAGAAGG - Intronic
917502564 1:175599165-175599187 GAGGAAGGAGAGCAGGAGGGAGG + Intronic
917512702 1:175681441-175681463 CAGCAAAGAGAGCAGGAGCGAGG + Intronic
917534568 1:175864823-175864845 CAGAAAGGGGAGCAGGAGAGTGG + Intergenic
918463826 1:184801682-184801704 CACAGTAGAGAGCAGGAGACAGG - Intronic
918469983 1:184861800-184861822 AAGAAGAGAGAGAAGGAGGGAGG + Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918971694 1:191428033-191428055 CACAAAAGAGAGCAAGAGAGAGG - Intergenic
919515317 1:198515012-198515034 GAGGAAAGAGAGTAGGTGGCCGG + Intergenic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919875688 1:201865502-201865524 TAGAAAAGACAGCTGCAGGCCGG - Intronic
919920671 1:202164797-202164819 CAGAGGAGAGAGCAAGGGGCAGG - Intergenic
919972127 1:202587863-202587885 GAAAAAAGACACCAGGAGGCAGG + Exonic
920098660 1:203502882-203502904 AAGCAAAGAGTGTAGGAGGCTGG - Intronic
920401998 1:205681736-205681758 CAGGAAAGAGGTCAGGAGTCAGG + Intergenic
920450570 1:206058229-206058251 CAGACAAGGGAGCAGTAAGCAGG - Intronic
920582536 1:207125226-207125248 CAGAAAAGTGGGCAGGGGCCAGG + Intronic
920700342 1:208213577-208213599 CAGAAAAGAGAGGAAGAAGGGGG - Intronic
920821307 1:209383975-209383997 CAGAAATTACAGGAGGAGGCTGG - Intergenic
920862131 1:209718737-209718759 AAGAATTGAAAGCAGGAGGCCGG + Intronic
921179794 1:212623328-212623350 GAGAAAAGAGAGTTGGAAGCAGG + Intergenic
921276876 1:213529365-213529387 GAGCAAGGAGAGCAGGATGCAGG + Intergenic
921359783 1:214320040-214320062 CAGAAAAGAAAGAAGGAAGGAGG + Intronic
921725536 1:218519417-218519439 GAGAAAAGAGAGCTGCAAGCAGG + Intergenic
921906601 1:220501997-220502019 CAGGAACAAGAGCAAGAGGCAGG - Intergenic
922006016 1:221531464-221531486 GAGAGAAGAGAGCAGGGGGAGGG - Intergenic
922232138 1:223696661-223696683 CAGAGAAGAGAGCAGGTGCCGGG - Intergenic
922428293 1:225520868-225520890 AAGAAAAGAAAGGAGGAAGCGGG + Intronic
922574897 1:226654982-226655004 GAGAAGGGAGAGCAGGAGGAGGG + Intronic
922716997 1:227882959-227882981 CAGAGAAGAGGGGAGAAGGCAGG + Intergenic
923077443 1:230622807-230622829 AAGATAAGAGAGTAGGTGGCAGG - Intergenic
923305668 1:232686076-232686098 CAGAAAAGTCAGCATGTGGCTGG - Intergenic
923332967 1:232942622-232942644 AAGAAGAGAGGGAAGGAGGCAGG + Intergenic
923457191 1:234174716-234174738 AAGAAATGTGAGCAGGAGGCTGG + Intronic
923549734 1:234954036-234954058 CAGAAAGGAGGGAAGGAGGACGG + Intergenic
923850678 1:237790875-237790897 CAGACAGGTGAGCAGGGGGCAGG - Intronic
923879490 1:238087832-238087854 TTGAAACCAGAGCAGGAGGCTGG + Intergenic
924264360 1:242266818-242266840 TAGAAAAGAGAGAAGCTGGCCGG + Intronic
924553882 1:245102723-245102745 TACAAAACAGAGTAGGAGGCAGG + Intronic
924586238 1:245363490-245363512 AAGAAAAGAGAAAAGGAGGCCGG - Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
924826905 1:247549260-247549282 GAGAACAGAGATAAGGAGGCTGG + Intronic
1062835152 10:630695-630717 CAGGAAACAGACCAGGTGGCAGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063470319 10:6279551-6279573 CAGCAAACACAGCAGGAAGCAGG - Intergenic
1063924271 10:10962072-10962094 AAGAAAAGAGAGAGGGAGGGAGG + Intergenic
1063963786 10:11328858-11328880 CAGAAAACAGAAAAGGGGGCTGG - Intronic
1064812930 10:19222160-19222182 AAGAAAAGAGAGAGGGAGGGAGG - Intronic
1065334157 10:24638159-24638181 AAGGAAAGTGAGCAAGAGGCCGG - Intronic
1065679293 10:28212617-28212639 CACAGAAGAGAAGAGGAGGCAGG + Intronic
1065709559 10:28502401-28502423 CAGAAAGGAGAAAAGCAGGCGGG + Intergenic
1065866424 10:29919076-29919098 CAGAAGAGAGGGGAGGAGGGAGG - Intergenic
1066253951 10:33660842-33660864 CAGAGAAGAGAGCAGGGGAGGGG - Intergenic
1067133040 10:43583576-43583598 CAGAAGAGAAAGCAGGAGAATGG + Intergenic
1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG + Intronic
1068403300 10:56557812-56557834 CAGGAAAGAGAACATGAAGCCGG + Intergenic
1068737795 10:60433680-60433702 CAGAGAAGGGAGCAGGAACCAGG + Intronic
1068776338 10:60872294-60872316 CAGAAAAGTGAGCAAAAGGAGGG + Intronic
1069060968 10:63894139-63894161 AAGGAAAGAGAGGAGGAGGAAGG - Intergenic
1069722617 10:70559497-70559519 GAGAATAGACAGCAGGGGGCGGG + Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070491296 10:76979321-76979343 CAGAAAAGAGAGCTGGGGTCAGG + Intronic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1071241602 10:83712231-83712253 AAGAAAAGAAGGAAGGAGGCAGG + Intergenic
1071293778 10:84204800-84204822 CAGCCAAGAGAGCATGGGGCAGG + Intronic
1071516503 10:86301148-86301170 CAGAAAAGAGACAATGAGGCCGG + Intronic
1071556055 10:86602314-86602336 CAGGCAAGAGAGCAGAGGGCAGG - Intergenic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072163948 10:92793782-92793804 CAGAGAAGAGACAAGGAGCCAGG - Intergenic
1072453520 10:95557877-95557899 CAGACGAGAAAGTAGGAGGCTGG - Intronic
1072605164 10:96975218-96975240 CAGAAAAAAAAGTAGGAAGCTGG + Intronic
1072688801 10:97556119-97556141 CAGACAAGGGAGCAGTAAGCAGG + Intronic
1072946613 10:99816260-99816282 CAAAAAACAGAGATGGAGGCCGG - Intronic
1073004700 10:100314422-100314444 GAGAAGAGAGAGAAGGAAGCAGG + Intronic
1073185932 10:101615031-101615053 AAGAAAAGAGCCCAGGAGGAGGG - Intronic
1073246794 10:102096515-102096537 CAGAAAAGAGAGAAAGGGCCGGG - Intergenic
1073293564 10:102425179-102425201 CAGAAGAGAGAGCATGGAGCTGG - Exonic
1074025504 10:109629593-109629615 TTCAAAATAGAGCAGGAGGCTGG - Intergenic
1074122211 10:110501189-110501211 CAGTCAAGAGAGAATGAGGCAGG - Intronic
1074345787 10:112684733-112684755 CATAAAAGAGATGAGCAGGCCGG - Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074552194 10:114454572-114454594 CAGAAAAGAGAGCAAAGGGGTGG + Intronic
1075199449 10:120390014-120390036 CAGACAAGAGAGCAGGTGAAAGG + Intergenic
1075359125 10:121813809-121813831 CAGATGAGAGAGCAGGGAGCTGG - Intronic
1075377904 10:121994413-121994435 AAGCACAGAGAGCTGGAGGCTGG + Intronic
1075414095 10:122249697-122249719 CAGCACAGAGAGCAGCAGCCCGG - Intronic
1076009301 10:126974579-126974601 CAGCAAAGAGGGGATGAGGCTGG - Intronic
1076013089 10:127006258-127006280 CAGGCAGGAGAGCAGAAGGCAGG - Intronic
1076057857 10:127390044-127390066 CAGGACCGAGAGCAGAAGGCAGG - Intronic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076692676 10:132231722-132231744 CAGAAAAGAGAAGATGACGCAGG + Intronic
1077226047 11:1439583-1439605 CAGGAAAGAGCCCAGGAGGTGGG + Intronic
1077384493 11:2262628-2262650 CAGAACAGGGACCCGGAGGCAGG + Intergenic
1078444744 11:11395693-11395715 AAGAAAAGAGAGAAGGAAGGAGG + Intronic
1078581558 11:12543065-12543087 CAGAAAAGAAAGCCAGGGGCTGG - Intergenic
1078914296 11:15763806-15763828 AAGAAGAGAGAGAAGGAGGGAGG + Intergenic
1079072901 11:17363563-17363585 AAGAAAAGAGAGAAAGAGGAAGG - Intronic
1079092966 11:17493615-17493637 CAGAAAGCAGAGCTGAAGGCAGG - Intergenic
1079158310 11:17969489-17969511 CAGAAAAGCTAGTAGTAGGCTGG + Intronic
1079212817 11:18478316-18478338 CAGCAAACATGGCAGGAGGCTGG + Intronic
1079292436 11:19200477-19200499 AAGGAAAGAGAGAAGGAGGGAGG - Intronic
1079345142 11:19645293-19645315 TAGAAGTGAAAGCAGGAGGCAGG - Intronic
1079514219 11:21248046-21248068 TACAAAAAAGAGCAGGAGGCCGG + Intronic
1079932949 11:26587596-26587618 CTGAAAAGAAAGCAGGAAGATGG - Intronic
1080905951 11:36544857-36544879 CAGAAAAGAGAGAACGAGGGGGG - Intronic
1080997610 11:37623067-37623089 CAGAAGGGAGAGCAGGCAGCAGG - Intergenic
1081914432 11:46721644-46721666 CAGAACACAGTGCAGGAGGGAGG - Intronic
1081962915 11:47151462-47151484 AAGAAAAGAGAGGTGAAGGCTGG + Intronic
1081968923 11:47185539-47185561 CAGCCAGGAGATCAGGAGGCTGG + Intronic
1081997578 11:47375227-47375249 GAGAACAGAGAGGAGGAGGTGGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083090308 11:60192541-60192563 CAAACAAGAGAGCAGTAAGCAGG - Intergenic
1083146973 11:60767278-60767300 CAGAGCAGAAAACAGGAGGCAGG + Intronic
1083190870 11:61051421-61051443 CAGCACAGAGAGCAGGGGCCTGG + Intergenic
1083687643 11:64386308-64386330 CAGCAAAGAGAGCCCGGGGCTGG - Intergenic
1084023781 11:66435204-66435226 CAGAGAAGAGAGCAGGAGTTGGG - Exonic
1084365201 11:68693119-68693141 CAGGACTGAGTGCAGGAGGCTGG - Intergenic
1084572634 11:69968762-69968784 CACGAAAGAGAGGTGGAGGCTGG - Intergenic
1084584338 11:70048584-70048606 TAGAAAAGAGAGAGGGAGGTGGG - Intergenic
1084696835 11:70760882-70760904 GAGAAGAGCCAGCAGGAGGCGGG + Intronic
1084746762 11:71175411-71175433 CTGTAAAGAGAGCAGGAGGAAGG + Intronic
1084783639 11:71428944-71428966 TAGATAAGTGAGGAGGAGGCGGG - Intronic
1085395510 11:76205296-76205318 CAGATAAGACAGCAGGGGGCAGG - Intronic
1085479664 11:76810696-76810718 CAGGAAGGAGGCCAGGAGGCAGG + Intergenic
1085555056 11:77412008-77412030 AAGAAAGGAGGGAAGGAGGCGGG + Intronic
1086123839 11:83329040-83329062 CAGAAGACAGATCAGGATGCTGG + Intergenic
1086598658 11:88606149-88606171 CAGCACAGAGAGTAGGAGGTAGG + Intronic
1086607436 11:88712668-88712690 CAGAAAATAGACTAGGAGTCAGG + Intronic
1087066218 11:94030422-94030444 CATAAAAGAGAGCCAGAGGTTGG + Intronic
1087261510 11:96017589-96017611 AAGAAAACAGGGCTGGAGGCGGG + Intronic
1087766037 11:102155140-102155162 CAGAAAAGAGGGCAGGACAGTGG - Intronic
1088181534 11:107118213-107118235 CAGGAAAGAGAGCAAGAGAAGGG - Intergenic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088572067 11:111231880-111231902 TAGAAAAGAGAGAACGGGGCAGG - Intergenic
1088828579 11:113516141-113516163 GAGAAGAGAGAGCAGGAGGGAGG - Intergenic
1088910348 11:114186321-114186343 GAGAAAAGAGAGCAAGAGTGAGG + Intronic
1089120424 11:116130628-116130650 CAGTAGAGAAAGGAGGAGGCAGG - Intergenic
1089196342 11:116695971-116695993 AAGAAAGGAGAGAAGGAGGAAGG - Intergenic
1089198239 11:116707770-116707792 CTGAAAGGAGAGCAGGGAGCAGG + Intergenic
1089304394 11:117517540-117517562 CAGAGGAGAGGGCAGGAGGGTGG + Intronic
1089466191 11:118688042-118688064 CAGAAGGCTGAGCAGGAGGCTGG + Intergenic
1089612533 11:119677481-119677503 GAGAAAGGAGAGGAGGAGGGAGG + Intronic
1089640662 11:119845328-119845350 CAGGAAAGAAGGCAAGAGGCAGG + Intergenic
1089697162 11:120222982-120223004 CAAATAAGAGAAGAGGAGGCAGG - Intronic
1089763529 11:120746484-120746506 CAGAAAAGGGGGCTGGAGGAAGG - Intronic
1089858554 11:121568828-121568850 ATCAAAAGAGAGGAGGAGGCTGG - Intronic
1090004005 11:122984355-122984377 AAGAAAAGAGAGATGGAGGGAGG + Intergenic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090330386 11:125926841-125926863 CAGAAATGAGAAGGGGAGGCTGG - Intergenic
1090460312 11:126885720-126885742 CAGAGCAGAGGGCAGCAGGCTGG + Intronic
1091284942 11:134403291-134403313 CAGGGATGAGAGCAGGAGGCTGG + Intronic
1091564855 12:1640758-1640780 CAGCAAAGAAAAGAGGAGGCTGG - Intronic
1091705433 12:2690243-2690265 CAGAAAGGAGAGAGGCAGGCTGG + Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091901960 12:4151522-4151544 AAGAAAAGAGGGAAGGAGGGAGG - Intergenic
1091912868 12:4245811-4245833 CAGCAAAGAGAGGCCGAGGCTGG - Intergenic
1092163391 12:6328275-6328297 CCCCAAACAGAGCAGGAGGCAGG - Exonic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092409646 12:8243440-8243462 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1092473573 12:8799642-8799664 AAGAAAAGAGAATAGGAGACAGG + Intergenic
1092890995 12:12969111-12969133 CCCAAAAGGGAGCAAGAGGCAGG + Intergenic
1092973940 12:13725826-13725848 CAGAAATCAGAGCAGGACACAGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093593684 12:20937672-20937694 CAAACAAGGGAGCAGTAGGCAGG + Intergenic
1093685665 12:22050958-22050980 CAAAAGAGAGGGTAGGAGGCAGG - Intronic
1093969358 12:25360840-25360862 CAGAAAAGGGAGCAAGAAACTGG - Intergenic
1093988739 12:25567044-25567066 CAGAAAAGAGAGTACTAGGGTGG + Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096389107 12:51215691-51215713 CAGAAGAGAGAGTGGGATGCAGG - Intronic
1096743706 12:53712360-53712382 GAGGGAGGAGAGCAGGAGGCTGG - Intronic
1096847719 12:54417347-54417369 TAGAAAAGAGGGAAGGAGGAAGG - Intronic
1097012675 12:55964600-55964622 AAGAAAAGAGATAAGGAGGCCGG - Intronic
1097158016 12:57026795-57026817 CAGAAAAGAGAGGCAGAGACAGG + Intronic
1098012641 12:66071181-66071203 CAGATGAGAGAGCCGAAGGCTGG + Intergenic
1098085766 12:66841246-66841268 AAGAAAAGAGAGAAGGAGAAAGG - Intergenic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098729163 12:74011161-74011183 TAGACAAGAGAGAAGGAGCCTGG + Intergenic
1098819244 12:75208253-75208275 AAGAAAGGAAAGCGGGAGGCAGG - Intronic
1098962407 12:76752713-76752735 CAGCAAAGAGAGCAGGATTCAGG + Intergenic
1100186609 12:92145983-92146005 GGGAAAAGAGTTCAGGAGGCGGG + Intergenic
1100235960 12:92661130-92661152 AAAAAAAAAGAGCAGGAAGCAGG + Intergenic
1100815053 12:98378806-98378828 TAGACATGAGAACAGGAGGCAGG - Intergenic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102548563 12:113674274-113674296 CAGAAAAGAGAGAGGAAGGAAGG - Intergenic
1102627996 12:114251630-114251652 CAGAAAAGTGAGCAGGATTAAGG + Intergenic
1102646090 12:114404990-114405012 GAGATCAGAGAGCAGGAGACAGG - Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1103180441 12:118906827-118906849 CTGAAAAGAGAATAGCAGGCAGG - Intergenic
1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG + Exonic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1103614475 12:122143342-122143364 CAGACAAGAGGGCAGGCAGCTGG - Exonic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1104172519 12:126295900-126295922 AAGGAAAGAGAGAAGGAGGGAGG + Intergenic
1104384862 12:128341927-128341949 GAGAGAAGACAGCAGGAAGCAGG - Intronic
1105064311 12:133183336-133183358 GAGAAAGGAGAGGAGGTGGCTGG + Intronic
1105240665 13:18606954-18606976 AAGAAAAGAGAGAGGGAGGGAGG + Intergenic
1106174797 13:27321014-27321036 CAGGGCTGAGAGCAGGAGGCTGG + Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106538357 13:30667893-30667915 AAGAAAAAAGACCAGGAGGAAGG + Intergenic
1106622334 13:31382706-31382728 TACAAAAGAGGGCAAGAGGCCGG - Intergenic
1107769582 13:43775680-43775702 AAGCAGAGAGAGCAGGAAGCTGG - Intronic
1108319210 13:49271277-49271299 GGGAAAAAAGAGCAGGAGGAAGG + Intronic
1108773422 13:53733531-53733553 GAGAAAAGAGAGATGGAGGGAGG + Intergenic
1109062711 13:57638375-57638397 TAGGAAAGAGAGGAGGAGGCTGG + Intronic
1109226932 13:59708291-59708313 AAGGAAAGAGAGGATGAGGCTGG - Intronic
1109232046 13:59769360-59769382 CAGAAAAGAGATCAAGAAGTTGG - Intronic
1109858517 13:68166341-68166363 CAGAAATGAAAGCAGGAAGATGG + Intergenic
1110144849 13:72178187-72178209 CATAAAAGAAAGCTGGGGGCTGG - Intergenic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1110395318 13:75023331-75023353 CAGAATAGAGAGCAGAGAGCTGG - Intergenic
1110438810 13:75504974-75504996 AAAAAAAGAGAGAAAGAGGCCGG - Intergenic
1110757115 13:79188465-79188487 CAGCAGAGAGAGCAGGTGTCTGG + Intergenic
1111342610 13:86907463-86907485 CAGAGAAGACATCAGCAGGCAGG - Intergenic
1112086026 13:96033625-96033647 CAGAGAAGAGGCCAGGAAGCAGG - Intronic
1112470242 13:99681880-99681902 CAGAAAAGATGCAAGGAGGCAGG - Intronic
1112737051 13:102431879-102431901 AAGAAATGAGAGAAGGAGGGAGG - Intergenic
1112753817 13:102608715-102608737 AAGAAAGGAGAACAGGAGGAAGG - Intronic
1113473917 13:110566356-110566378 AAGAAAAGGGAGGAGGAGACGGG + Intergenic
1113632264 13:111896444-111896466 CAGCTCCGAGAGCAGGAGGCTGG + Intergenic
1113800437 13:113083573-113083595 CAGAAAACAGCCCAGGAGCCTGG + Intronic
1113841467 13:113363914-113363936 CAAAACCGAGAGAAGGAGGCCGG + Intronic
1114221233 14:20699331-20699353 TAGAAAAGAAAGCAAGGGGCAGG - Intronic
1114528516 14:23380909-23380931 GAGAACAGGAAGCAGGAGGCAGG - Intergenic
1114540126 14:23449172-23449194 TGGAAAAGAAAGGAGGAGGCGGG - Intergenic
1114689331 14:24565655-24565677 CAAAAAAGAAAGCAAGAAGCTGG + Intergenic
1114719448 14:24864927-24864949 CAGTAGAGAGAGAAGGTGGCGGG - Intronic
1114744416 14:25132563-25132585 CAGGAAAGTGAATAGGAGGCTGG + Intergenic
1115097065 14:29650012-29650034 CAGGAAAGGGAGCTGGAAGCAGG - Intronic
1115103695 14:29734334-29734356 CATATAAAAAAGCAGGAGGCTGG - Intronic
1115163717 14:30424593-30424615 CAGAGAAGAGAAAATGAGGCAGG + Intergenic
1115618585 14:35119743-35119765 TAGGAAAGAAAGGAGGAGGCTGG + Intronic
1115641261 14:35337019-35337041 GAAACAGGAGAGCAGGAGGCCGG - Intergenic
1116401953 14:44518115-44518137 CAGAAAATAGAAGAGGAGGGAGG - Intergenic
1116543378 14:46129894-46129916 AAGCAAAGAGATCAGGAGGGTGG + Intergenic
1117125862 14:52625185-52625207 TAGAAAATAGAGGAGGGGGCTGG + Intronic
1117535267 14:56697015-56697037 GAGACAAGTGGGCAGGAGGCAGG + Intronic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117834680 14:59791418-59791440 CAGAAAGGAGAGCAGCATGCAGG - Intronic
1118247502 14:64125589-64125611 CAGAGAAGATAGTAGGAGACAGG + Intronic
1118608627 14:67522264-67522286 CAGAAATGAGAGCAGTAGAGTGG - Intronic
1119236110 14:73020680-73020702 AAGAAAAAAGAGCAGGAGCCAGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119584317 14:75818132-75818154 CAGAAAAGAAAGAATGGGGCCGG - Intronic
1119603437 14:75993714-75993736 CAGATAGCAGAGCAGGAAGCTGG - Intronic
1119783021 14:77290954-77290976 AAGAAATGAGAGCAGCAGCCAGG + Intronic
1119937248 14:78603202-78603224 CAGGAAAGAGAGCAGCAGGTGGG - Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121164455 14:91778348-91778370 GAGCAAAGAAAGCAGCAGGCAGG + Intronic
1121416943 14:93786345-93786367 CAGAGAAGAGAGCAGAAGATGGG + Intronic
1121731298 14:96189061-96189083 AAGAAGAGATAGCAGGAGCCAGG + Intergenic
1121917633 14:97850749-97850771 CAGTTAGGAGAGCAGGAGTCTGG + Intergenic
1122027509 14:98888384-98888406 AAGAAAGGAGAGGAGGAGGAGGG - Intergenic
1122327641 14:100891938-100891960 CAGTAATGAGAGGAGGTGGCTGG + Intergenic
1122406375 14:101503513-101503535 GAGAGAAAAGAGCAAGAGGCCGG - Intergenic
1122549509 14:102542361-102542383 GGGAACAGACAGCAGGAGGCAGG + Intergenic
1122574252 14:102731824-102731846 GAGAAAAGGGAGCTGGAGCCAGG - Intergenic
1122743227 14:103883576-103883598 CATGACAGACAGCAGGAGGCCGG - Intergenic
1122743236 14:103883611-103883633 CATGACAGACAGCAGGAGGCCGG - Intergenic
1122743245 14:103883646-103883668 CATGACAGACAGCAGGAGGCCGG - Intergenic
1122743254 14:103883681-103883703 CATGACAGACAGCAGGAGGCCGG - Intergenic
1122743262 14:103883716-103883738 CATGACAGACAGCAGGAGGCCGG - Intergenic
1122774214 14:104110119-104110141 CAAAAAGGAGAGTCGGAGGCAGG + Intronic
1122816072 14:104314734-104314756 CACAGAAGAGAGCAGGAGCCAGG - Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123050763 14:105540910-105540932 CAGTCACGAGAGCAGAAGGCAGG - Intergenic
1123159551 14:106264655-106264677 CAGAAAAGTGTGCAGGAGGCCGG - Intergenic
1123190591 14:106565637-106565659 CAGAAAAGCGCGCAGGAGGCCGG - Intergenic
1123875644 15:24621524-24621546 CAGAGAACAAAGCTGGAGGCTGG - Intergenic
1124070443 15:26388037-26388059 CTGAAAACAGAGCAGGAGGTTGG - Intergenic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124843024 15:33262526-33262548 CAGAGGAGATAGCAAGAGGCAGG - Intergenic
1125969139 15:43897912-43897934 CAGGAAAGAGAGAATGAGGGGGG - Intronic
1125983129 15:44022267-44022289 TACAAAAGAGGGCAGGCGGCTGG + Intronic
1126004626 15:44244385-44244407 CAGAAAAGTGACCTGTAGGCTGG - Intergenic
1126273171 15:46845653-46845675 CAGAAAAGACAGGAGGATGTGGG - Intergenic
1126841434 15:52721179-52721201 CTGATAAGAGAGAGGGAGGCAGG - Intergenic
1127279349 15:57475700-57475722 CAGAAAAGACAGTCTGAGGCTGG - Intronic
1127394839 15:58536291-58536313 ACGAAAAGAGAGGAGGAGGTGGG + Intronic
1127844952 15:62861792-62861814 CAGGAAAGAGCGGAGGAGTCAGG - Intergenic
1129267274 15:74400489-74400511 CAGCAAAGAGAGCAGGAGCTTGG + Intergenic
1129555232 15:76501472-76501494 AAGAAAAGAGGACAGGAAGCTGG + Intronic
1129570920 15:76682727-76682749 CAGAAAACAAAGCAGAGGGCTGG + Intronic
1129620525 15:77140202-77140224 CAAAAAATAGAACAGGAGGAAGG + Intronic
1129771017 15:78203702-78203724 AAGAGCAGAGAGCGGGAGGCTGG + Intronic
1129970570 15:79774540-79774562 CAGAGAAGAGGAGAGGAGGCAGG + Intergenic
1130209532 15:81910503-81910525 CCGAGAAGAGAGCAGAAGGGAGG + Intergenic
1130363065 15:83208080-83208102 AACAAAAGAGAGCAGGCGGCGGG - Intergenic
1130398246 15:83523740-83523762 AAGAAGAGAGAGAAGGAGGGAGG - Intronic
1130519974 15:84654748-84654770 CAGAGAAGAGAGGAAGCGGCCGG + Intergenic
1130621909 15:85472209-85472231 CAAAAAACAAAGCAGGAAGCTGG + Intronic
1130819456 15:87479090-87479112 CAGAACAGAGCACAGGAGGGAGG - Intergenic
1130827702 15:87566269-87566291 GAGAAAAGAGATTAGGAGGGAGG + Intergenic
1130832724 15:87617873-87617895 CATAGCAGAGAACAGGAGGCAGG - Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1132977095 16:2716332-2716354 CAGAAAGGAGAGGAGGAGGAAGG - Intronic
1133043766 16:3074887-3074909 CAGAAAAGAAAGTTGGGGGCCGG + Intronic
1133350618 16:5098221-5098243 CAGAGAAGAGCTCAGGAGGCGGG + Intergenic
1133385924 16:5370449-5370471 AAAAAAAAAGAGGAGGAGGCTGG - Intergenic
1133665287 16:7961479-7961501 TAGAAAAGAAAGCAAGAGGCTGG + Intergenic
1133969782 16:10559273-10559295 CAGATACTAGGGCAGGAGGCTGG - Intronic
1135352462 16:21740578-21740600 AAAAGCAGAGAGCAGGAGGCAGG - Intronic
1135450950 16:22556700-22556722 AAAAGCAGAGAGCAGGAGGCAGG - Intergenic
1135541193 16:23331614-23331636 TATAAAAGTGACCAGGAGGCCGG - Intronic
1135942134 16:26831057-26831079 CAGCAAGAAGTGCAGGAGGCAGG + Intergenic
1136504235 16:30692526-30692548 GATGGAAGAGAGCAGGAGGCAGG + Intergenic
1136873218 16:33827021-33827043 CTGAAGAGAGAGCAGGACCCAGG - Intergenic
1137507376 16:49065878-49065900 TAGAAAAAAGAGCAGGTGGAAGG - Intergenic
1137527813 16:49251492-49251514 TATAAAAGAGGGCAAGAGGCAGG - Intergenic
1137658853 16:50185725-50185747 AAGAAAAGAGAGAGGGAGGAAGG - Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138867185 16:60836160-60836182 GAGAAAAGAGAGCCATAGGCAGG + Intergenic
1139374201 16:66486704-66486726 AAGAAAAGAGGGGAGGAGGCTGG + Intronic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139470676 16:67176559-67176581 CTCAACAGAGAGCTGGAGGCAGG + Exonic
1139665254 16:68450599-68450621 TTGAAAGAAGAGCAGGAGGCCGG - Intergenic
1139822627 16:69732392-69732414 TACAATAGAGAGGAGGAGGCCGG - Intergenic
1140123380 16:72101757-72101779 CAGTGAAGAGACCAGGAGGAAGG - Intronic
1140357666 16:74320002-74320024 CAGAGAAGAGTGCAGGAGAAAGG - Intergenic
1140578364 16:76199389-76199411 AAGAAAAGAGCACAGAAGGCAGG - Intergenic
1140765752 16:78155215-78155237 AAGAAAGGAGAGAAGGAGGAAGG + Intronic
1141130820 16:81435297-81435319 CAAAGAAGAGAGAAGAAGGCAGG - Intergenic
1141259418 16:82439160-82439182 GAAAGAAGAGAGAAGGAGGCCGG - Intergenic
1141290632 16:82715380-82715402 CAGAAACCAGAGCATGGGGCGGG - Intronic
1141608015 16:85166453-85166475 CACAAATCAGAGGAGGAGGCCGG - Intergenic
1141656901 16:85421394-85421416 CAGAAAAGAGCACAGCAAGCAGG + Intergenic
1142299757 16:89249627-89249649 CCAAAAAGAAAGCACGAGGCCGG + Intergenic
1142309580 16:89304782-89304804 CCTAAAAGTGAGCAGGAGGCAGG - Intronic
1142334812 16:89481049-89481071 CAGAAAAGAAAGCAGGAATGGGG - Intronic
1142353776 16:89591679-89591701 AAGAAAAGAAAGCAGCAGGCTGG - Intronic
1203098954 16_KI270728v1_random:1289034-1289056 CTGAAGAGAGAGCAGGACCCAGG + Intergenic
1142492819 17:289664-289686 GAGGAAGTAGAGCAGGAGGCAGG - Intronic
1142582302 17:949696-949718 CAGCAGGGAGAGGAGGAGGCAGG - Intronic
1142631180 17:1227974-1227996 CAGAAAAGAGAGCAGATGCGAGG + Intronic
1142883184 17:2896732-2896754 TAGGAAAAAGGGCAGGAGGCGGG - Intronic
1142889496 17:2933620-2933642 CAGGAAAGTGAGCAGGGGGCTGG - Intronic
1143012807 17:3875577-3875599 CAGGAAAGAGGTCAGGAGGCCGG - Intronic
1143032255 17:3974286-3974308 GAGGCAAGAGGGCAGGAGGCGGG - Intergenic
1143062266 17:4211944-4211966 GAGAAGAGAGAGCTGAAGGCAGG + Intronic
1143159356 17:4859007-4859029 CAGGAAACAGGGCAGGAGGTGGG - Intronic
1143224203 17:5286844-5286866 AAGAAAACAGAGCAGGAGAAAGG + Intronic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143458940 17:7087721-7087743 AAGAAAAGAAAGGGGGAGGCTGG - Intergenic
1143890873 17:10101490-10101512 CACAAGAGTGACCAGGAGGCAGG + Intronic
1143920784 17:10329594-10329616 TGGAATAGAGAGCAAGAGGCAGG - Intronic
1143972240 17:10804030-10804052 CAGAGAAGGCAGCAGCAGGCAGG - Intergenic
1144258083 17:13489725-13489747 TTGAAAAGAAAGGAGGAGGCTGG + Intergenic
1144422846 17:15113855-15113877 CAGGGAAGAGATGAGGAGGCTGG + Intergenic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1144796419 17:17894406-17894428 CAGACAAGGGAGGAGCAGGCAGG - Intronic
1144886302 17:18464923-18464945 CAGAGAAGAGATGAGGAAGCAGG - Intergenic
1144925245 17:18801551-18801573 CAGCCAAGAGAGCAAGAGCCTGG - Intronic
1144965485 17:19074873-19074895 GAGAAGAGAGGGCAGGTGGCAGG - Intergenic
1144969108 17:19096061-19096083 CCTGAAAGAGGGCAGGAGGCTGG - Intronic
1144978808 17:19156005-19156027 CCTGAAAGAGGGCAGGAGGCTGG + Intronic
1144982482 17:19177310-19177332 GAGAAGAGAGGGCAGGTGGCAGG + Intergenic
1144985741 17:19200929-19200951 GAGAAGAGAGGGCAGGTGGCAGG - Intergenic
1144989414 17:19222227-19222249 CCTGAAAGAGGGCAGGAGGCTGG - Intronic
1145145903 17:20479388-20479410 CAGAGAAGAGATGAGGAAGCAGG + Intergenic
1145247644 17:21280079-21280101 CAGCACAGAGAAGAGGAGGCTGG + Intergenic
1145814741 17:27787619-27787641 GAGACAGGAGAGCAGGAGGAAGG + Intronic
1146162257 17:30566284-30566306 CAGGAATGTGAGCAGGAAGCTGG + Intergenic
1146630848 17:34468272-34468294 GAGAAAAGAGAGAAGGCGACAGG - Intergenic
1146635384 17:34500340-34500362 GAGAAAACAGAGCAGGATGAGGG - Intergenic
1146674174 17:34761434-34761456 GAGAAAATAGTTCAGGAGGCAGG - Intergenic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1146918291 17:36692056-36692078 TGGGAAAGAGAGCAGGAGGAAGG - Intergenic
1147153155 17:38530087-38530109 AAGGAAAGAGAGCAGGGAGCGGG + Exonic
1147578654 17:41616698-41616720 CAGGAATGTGAGCAGGAAGCTGG + Intergenic
1147684343 17:42277613-42277635 CAGAGAAGGAAGCAGGAAGCAGG + Intergenic
1147976128 17:44249156-44249178 TAGAAAAGAGAGGAGGTGGCTGG - Exonic
1148051348 17:44771552-44771574 CAGAACAGTGAGCAGAACGCTGG - Intronic
1148206394 17:45783010-45783032 CTGAGAAGAGGGCAGGAGGGAGG + Intergenic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148593384 17:48833258-48833280 AAGAAAAGTAAGCAGAAGGCCGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149180012 17:53924670-53924692 CTGAAAGAAGAGCAGCAGGCTGG - Intergenic
1149336332 17:55640099-55640121 GAGAAAAGACAGCAGGAGAAAGG - Intergenic
1149712623 17:58756536-58756558 CAGAAAAGAGAGCAGTTTGAGGG - Intronic
1150008711 17:61486104-61486126 AAGAAAAGAGCGCAGCAGGTGGG - Intergenic
1150368337 17:64611848-64611870 CAGAGAGGTGAGCAGGAGCCAGG - Intronic
1150464623 17:65381558-65381580 CAGAAAAGAGAAAATGAGGCAGG + Intergenic
1151416365 17:73968573-73968595 GAGCAGAGAGAGCAGGAGGCAGG + Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151466570 17:74289561-74289583 GAGGGAAGAGAGCAGAAGGCTGG - Intronic
1151817958 17:76480790-76480812 CAGAAGACACAGCAGCAGGCAGG - Intronic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152071168 17:78134455-78134477 CAGGTAGGAGAGCAGGCGGCAGG - Exonic
1152074037 17:78147815-78147837 CTAAAAAGAGAGCAGGCAGCTGG + Intronic
1152106889 17:78335437-78335459 CAGAGAAGAGGGCAGGAGGGAGG - Intergenic
1152150094 17:78593858-78593880 TAGAAAAGAGATCAGAAGTCTGG + Intergenic
1152291446 17:79442190-79442212 CAGAAGAGAGAGGAGGAGGGAGG + Intronic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152403706 17:80084603-80084625 CAGTCACGAGTGCAGGAGGCTGG - Intronic
1152614351 17:81331005-81331027 AAGAAAGGAGAGGAGGGGGCGGG + Intergenic
1152720344 17:81920614-81920636 AGGAACTGAGAGCAGGAGGCAGG + Exonic
1152724588 17:81938998-81939020 AAAAAAGGAGAGAAGGAGGCTGG + Intronic
1152752441 17:82069829-82069851 CCCAAAAGAGAACTGGAGGCTGG + Intergenic
1153912213 18:9714246-9714268 CACAGATGGGAGCAGGAGGCGGG + Intronic
1154172926 18:12063780-12063802 TAGAGAAGGGAGCAGGTGGCCGG + Intergenic
1154448215 18:14452135-14452157 AAGAAAAGAGAGAGGGAGGGAGG - Intergenic
1154507039 18:15051919-15051941 GATACAAGAGAGCAGGAGGATGG - Intergenic
1154975432 18:21452819-21452841 CAGAAAAAAGAACAGGAGAAAGG + Intronic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1155567106 18:27147444-27147466 CAGAAAAGAAACCAGGAGTCGGG + Intronic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1155961549 18:31999662-31999684 AAGAAAAGACAGGAAGAGGCCGG - Intergenic
1156149799 18:34227348-34227370 AAGAAAAGAGAGGAAGAGGAAGG + Intergenic
1156401269 18:36742458-36742480 CAGAAAGGAGAGTAAGAGGAGGG + Intronic
1156458848 18:37310048-37310070 GGGAAAAGAGAGGAGGTGGCAGG - Intronic
1156945937 18:42831628-42831650 AAGAAGAGAGAACTGGAGGCAGG + Intronic
1157584701 18:48793637-48793659 AAGAAAAGAGAGGAGGAGAAGGG - Intronic
1157888335 18:51390120-51390142 GAGAGAAGAAGGCAGGAGGCTGG - Intergenic
1158189768 18:54813568-54813590 CAGAAGGCAGAGCAGGAGCCAGG - Intronic
1158243644 18:55406095-55406117 CAGCACAGCCAGCAGGAGGCTGG + Intronic
1158416941 18:57256965-57256987 AGGGAAAGGGAGCAGGAGGCTGG + Intergenic
1158447882 18:57536867-57536889 CAAAAAACAGAGGAGGAGCCGGG + Intergenic
1158606458 18:58900493-58900515 CAGCAAAGAAAGCAGGGAGCAGG - Intronic
1158855719 18:61541921-61541943 GAGAACAGAGAGCAGGAGAGCGG + Intronic
1159814006 18:73051583-73051605 GAGAAAAGAGAGGAGGGAGCAGG + Intergenic
1159858338 18:73615903-73615925 CAGACAGGAGAGGAAGAGGCTGG + Intergenic
1160392263 18:78543123-78543145 GGGAAACCAGAGCAGGAGGCTGG + Intergenic
1160685483 19:434627-434649 CAGAAAGAAGAGCTGGAGGTAGG + Intronic
1160991379 19:1861697-1861719 CAGAACAGAGAGGGGGCGGCCGG + Intronic
1161021419 19:2013382-2013404 CAGAAAGGAGGGCTGGGGGCTGG + Intronic
1161370550 19:3908693-3908715 GAGAAAAGGGAGGAGGAGGGGGG - Intronic
1162001062 19:7745314-7745336 CAGAACAGAAGGCAGGAGACTGG + Intronic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162715928 19:12633481-12633503 CAGGAAAATGAGCAGGAAGCAGG - Intronic
1162871199 19:13588041-13588063 AAGAAAAGAAAGAAAGAGGCCGG + Intronic
1163266178 19:16223870-16223892 CACAAAAGAAAGCAAGCGGCTGG - Intronic
1163316283 19:16542530-16542552 CGGAAGTGAGAGCGGGAGGCAGG + Exonic
1163934193 19:20426756-20426778 CAGACAAGGGAGCAGTAAGCAGG + Intergenic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1165564334 19:36711321-36711343 CAGAAACGAGAGCTTGAGGCTGG - Exonic
1165913012 19:39240983-39241005 AAAAAAAGAGAGCAAGAGGAGGG + Intergenic
1166420595 19:42633223-42633245 TAGAAAAGAGACAGGGAGGCAGG - Intronic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167113257 19:47474117-47474139 CAGAACGGAGCACAGGAGGCCGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167254370 19:48418512-48418534 CAGACAGGAGCTCAGGAGGCTGG + Intronic
1168072386 19:53960297-53960319 CAGAAAAGAGAGGAAGGGGCCGG + Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
1168703302 19:58454154-58454176 CCCAACAGAGAGCAGGAGTCAGG - Intronic
925302827 2:2829107-2829129 TAGCAGAGAGAGCAGCAGGCAGG + Intergenic
925592396 2:5523267-5523289 GAGAAAAGAGAGAAGTAGGAAGG + Intergenic
926258718 2:11236350-11236372 CAGAAAAGAGCAGAGGAGGTAGG + Intronic
926306577 2:11641400-11641422 AACAGAAGAGAGAAGGAGGCAGG + Exonic
926458641 2:13100218-13100240 AAAAAAAGAGAACATGAGGCAGG - Intergenic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926753942 2:16221222-16221244 AAGAAAAAAGAGCACAAGGCTGG + Intergenic
927174501 2:20396123-20396145 CAGCACAGAGAGCAGAATGCTGG + Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927543980 2:23937005-23937027 CAGAAAAGAAATGATGAGGCCGG - Intronic
927549381 2:23983970-23983992 CATAAAAGAGAACAATAGGCTGG - Intronic
927584105 2:24282964-24282986 GAGAAAAGAAAGGAGGAGGCAGG - Intronic
927691269 2:25209847-25209869 CAGAAAAGAGGGAAGGAGCTGGG + Intergenic
927708094 2:25309328-25309350 AAGGAAGGAGGGCAGGAGGCAGG + Intronic
929345923 2:40884656-40884678 CAGGCAAGAGAGCATGAGGCAGG - Intergenic
929448952 2:42023914-42023936 CAGAAAAGAAAGAATGAGGAAGG + Intergenic
929489889 2:42386637-42386659 TAGAAGAGAGTGCTGGAGGCTGG - Intronic
929928745 2:46235947-46235969 GAGAAAGGAGAGCAGGGAGCAGG + Intergenic
930014038 2:46958467-46958489 AAGAGGAGAGAGCAGGAGACAGG - Intronic
930082313 2:47461885-47461907 AAGAAAAGAGAGACAGAGGCTGG - Intronic
930153929 2:48086113-48086135 CAGGCAAGAGAGCAGGTGGAGGG + Intergenic
930261698 2:49154391-49154413 CAGCAAAGAGACCAGGAGCAGGG + Exonic
930601863 2:53453051-53453073 CAGAAAGGAGAGCAGCAGGATGG + Intergenic
930714084 2:54576348-54576370 CAGAAAGAAGAGCTGAAGGCCGG - Intronic
931305488 2:61024391-61024413 CAGAAAAGAGAGTAAGATACAGG - Intronic
931763863 2:65437706-65437728 CAGAAGAGAAAGCAGGGGTCAGG + Intergenic
932102663 2:68914823-68914845 CAGATTAGAAAGCAGGAGGAGGG - Intergenic
932196501 2:69788539-69788561 CAAAAAAGAAAGAAAGAGGCTGG + Intronic
933674759 2:85044812-85044834 CAGAAATAAAAGCAAGAGGCTGG - Intronic
933873390 2:86593053-86593075 CAGAAAAGCGAGCAGTGAGCTGG - Intronic
933874498 2:86605147-86605169 CAGAGAAGAAAGCTGGGGGCTGG + Exonic
933945203 2:87280011-87280033 CACAAAAGACAGCAGGCCGCAGG + Intergenic
933971213 2:87471251-87471273 CAGAAATGTGAGCAGGCAGCTGG + Intergenic
934042940 2:88145037-88145059 CAGAACAGAGGTCAGGAGCCCGG + Intergenic
934046492 2:88176988-88177010 AAGACAAGGGAGTAGGAGGCAGG - Intronic
934647525 2:96067898-96067920 GACAAAACAGTGCAGGAGGCAGG + Intergenic
934729785 2:96649345-96649367 CAGAAAAGGATGCAGGAGGGTGG - Intergenic
934774557 2:96928849-96928871 CAAACAAGAGAACAGGTGGCTGG + Intronic
934858457 2:97743630-97743652 CATAAACAAGAACAGGAGGCCGG - Intergenic
934887624 2:98038816-98038838 TAGAAAAGAAAGAAGGAGGCCGG - Intergenic
935523238 2:104135553-104135575 CAGGAAAGAGAGAAGGCAGCAGG + Intergenic
936322515 2:111478938-111478960 CAGAAATGTGAGCAGGCAGCTGG - Intergenic
936335005 2:111581580-111581602 CACAAAAGACAGCAGGCCGCAGG - Intergenic
936349617 2:111702869-111702891 TAGAAGAGAGATCAGGAGGAGGG - Intergenic
937202127 2:120210422-120210444 CTGAAAACAGAGAAGGTGGCTGG + Intergenic
938029809 2:127982344-127982366 TAGACAAGAGAGGAGGAGACAGG + Intronic
938067002 2:128286802-128286824 CAGAAAACAGAGCAGGCTGCTGG + Intronic
939023983 2:136989984-136990006 AAGAAAAGAAAGCAGAAGACAGG - Intronic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
939152300 2:138487342-138487364 CAGAAAAGAAGGCAGTAGGTGGG - Intergenic
939161105 2:138589860-138589882 CAGATAAGTGAGCTGGAGGTGGG + Intergenic
941216592 2:162717459-162717481 AAGAGCAGTGAGCAGGAGGCTGG - Intronic
941838452 2:170052645-170052667 CAAAATAGAGAGTAGGAGGGTGG + Intronic
941915163 2:170807621-170807643 CAGAAAAGTGAACATGAGGAAGG + Intergenic
942267869 2:174246596-174246618 AAGAAAAGAGGCCAGGAAGCTGG - Intronic
942298332 2:174538313-174538335 CAGAAAAGAAATCAGGACTCAGG - Intergenic
942388770 2:175470147-175470169 CAAAAAAGAGAGGAGGAGGAGGG - Intergenic
942681340 2:178480571-178480593 CGGAAGCGCGAGCAGGAGGCCGG + Exonic
942775514 2:179576767-179576789 CAGGGAAGAGACCAGGAAGCAGG + Intronic
942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG + Intergenic
942908064 2:181207317-181207339 CAGAAAAGAAAGGAGGATGTGGG - Intergenic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943649387 2:190440921-190440943 CAGAACAGATAGCAAGATGCTGG + Intronic
943959334 2:194241452-194241474 CAGAAAAGAGAGCTTGTGGAGGG + Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944153521 2:196587860-196587882 CAGAAATGAGACCAGAAGGGTGG - Intronic
944364277 2:198898264-198898286 AAGAAAAGAGAGAAGAAGGAAGG + Intergenic
944650201 2:201821975-201821997 CAATAAAGAGACCATGAGGCCGG - Intronic
944656467 2:201880962-201880984 CAGAAGAGAGAGAAGCAGCCAGG + Intronic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
945204055 2:207312991-207313013 TAGAAAACAGAGCCTGAGGCAGG + Intergenic
945839843 2:214874286-214874308 CAGAAAAGAGAGGAGAAGCTAGG + Intergenic
945908890 2:215624021-215624043 AAGAAAAGAGAGGACGAGGGAGG + Intergenic
946832654 2:223741839-223741861 GAGGAAAGAGAGGAGGAGGAAGG - Intergenic
947166134 2:227264158-227264180 CAGAGAGCAGAGTAGGAGGCAGG + Intronic
947212305 2:227719167-227719189 AAGAAAAGAGGCCAGGTGGCCGG - Intergenic
947233716 2:227918513-227918535 TAGAAAAGAGACCAAGAAGCAGG - Intronic
947597153 2:231420177-231420199 CAGAAAAGCTAGGAGGAGCCAGG + Intergenic
947897957 2:233693009-233693031 CTGAAATGAGCGAAGGAGGCAGG - Exonic
948027598 2:234790338-234790360 AAGAAATGAGAGGAGGAGGCTGG + Intergenic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
948385784 2:237579745-237579767 CTGGACAGAGAACAGGAGGCTGG + Intronic
948444268 2:238019953-238019975 AAGAGAAGGGAACAGGAGGCTGG - Intronic
948663558 2:239521086-239521108 AAGAAAAGAGGGCAGGCGGGCGG - Intergenic
948744769 2:240080784-240080806 CAAAAAAAATAACAGGAGGCCGG + Intergenic
948794986 2:240397902-240397924 CAGAAAAGACAGCAGGCAGGAGG + Intergenic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
1168794716 20:603883-603905 CAGAGAGGAGAGCTGGTGGCTGG + Exonic
1168805531 20:670310-670332 CAGAGCAGAAAGTAGGAGGCCGG - Intronic
1168972812 20:1942360-1942382 CAGAAAAGAAACCAAGAGCCTGG - Intergenic
1169043739 20:2518952-2518974 CAGGAAAGAGAGAGGGGGGCAGG - Intronic
1169321909 20:4640138-4640160 CAGAAAACAGATCAGCAGCCGGG + Intergenic
1169939854 20:10925340-10925362 CAGGAGAGAGAGCAGATGGCTGG + Intergenic
1170429262 20:16261540-16261562 CAGGAAAGAAAGCAGCAGTCGGG - Intergenic
1170930510 20:20766021-20766043 CAGAAACTAGAGGAGAAGGCGGG + Intergenic
1171061076 20:21960616-21960638 CATAAAAGAGAGGAACAGGCTGG - Intergenic
1171154853 20:22862526-22862548 CAGAAAAGTGAACAGGTGACAGG + Intergenic
1171161081 20:22924413-22924435 GATAAAAGGGAGCAGGAGGTAGG + Intergenic
1171428610 20:25064430-25064452 CAGAACAGAGGGCAGAAGCCAGG - Intergenic
1171460839 20:25297067-25297089 CAGGACAGAGGGCAGGGGGCAGG - Exonic
1172468395 20:35173872-35173894 CAGAAAAGGCAGCAGGGGCCAGG + Intronic
1172523248 20:35582714-35582736 GGGAAAAGAGACCTGGAGGCTGG + Intergenic
1172757922 20:37300225-37300247 CAGAGAAGTGATCAGGAGGGAGG - Intronic
1172959039 20:38784507-38784529 GAGAAAAGAGCCAAGGAGGCCGG - Intergenic
1173239048 20:41277078-41277100 CAGACAAGACAGCATGAGGAAGG + Intronic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1173470560 20:43320367-43320389 CAGACAGAAGGGCAGGAGGCAGG - Intergenic
1173724084 20:45284874-45284896 CAAAAAACATAGCAGGAGGGGGG - Intergenic
1173766533 20:45615365-45615387 CAGTCAAGTGGGCAGGAGGCAGG + Intronic
1174102499 20:48138276-48138298 CAGGACAGAGAGCGGGAGGGAGG - Intergenic
1174466600 20:50722584-50722606 GAGGAAAGAGAGCTGCAGGCAGG - Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174554476 20:51383936-51383958 CAGAAAAGAGACCTGGAGGCTGG + Intergenic
1175446336 20:59022827-59022849 CAGAACTGAAAGCAGGAGGAAGG - Exonic
1175616731 20:60406109-60406131 ATGAAAAGATAGCAGCAGGCTGG - Intergenic
1176790835 21:13317178-13317200 GATACAAGAGAGCAGGAGGGTGG + Intergenic
1177510482 21:22080507-22080529 CAGAAAAGAAAACATGAGGTTGG + Intergenic
1177670210 21:24214739-24214761 AAGAAAAGAGAGAAGGGGGAGGG + Intergenic
1177990956 21:28036190-28036212 GATACAAGAGAGCAGGAGGGTGG - Intergenic
1178096835 21:29224068-29224090 CAGGAAAGAGAGGAGCACGCAGG - Intronic
1178103148 21:29291635-29291657 CAGAGAAGTGTGGAGGAGGCTGG + Intronic
1178259671 21:31087484-31087506 CAGCAATGAGAGGAGGAGGAGGG - Intergenic
1178275626 21:31234301-31234323 CTGAAAAGAGAGCAGGAGAGGGG + Intronic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178549296 21:33522032-33522054 AAGAAAAGAAAGCAGAAGACTGG + Intronic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1178788942 21:35680450-35680472 CCCAAAATAGAGCAGAAGGCAGG - Intronic
1178788947 21:35680529-35680551 AAAAAAAGAGAGCAGAAGGCAGG - Intronic
1178924324 21:36762338-36762360 CAGAGAAGAGAGCAGGGGTAGGG + Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179167698 21:38947592-38947614 CAGAAAGGAGAGATGGAGGGAGG - Intergenic
1179217274 21:39378382-39378404 CAAAACAAAGAGCAGGAGTCTGG - Intergenic
1179331757 21:40409426-40409448 CAGAGAAGAGACCATCAGGCTGG - Intronic
1180186923 21:46144731-46144753 CAGAAAAGAGAGAGAGAGGGAGG - Intronic
1181036290 22:20171381-20171403 CAGAAGTGAGAGGAGGAGGGAGG + Intergenic
1181449387 22:23008395-23008417 AAGAAAAAAAAGCAAGAGGCAGG + Intergenic
1181580902 22:23827559-23827581 CATAAGAGAGAGCAGGGGGCAGG - Intronic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181653460 22:24275104-24275126 CAGACAAGTCTGCAGGAGGCAGG - Intronic
1181821950 22:25483332-25483354 CAGGAGAGGGAGCAGCAGGCTGG - Intergenic
1181873993 22:25925606-25925628 CAGAAACTTGAGCAGGTGGCTGG + Intronic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182270808 22:29152193-29152215 CAGCAAAGACTGCAGGAGGATGG - Intronic
1182678492 22:32059482-32059504 CATAAACAAAAGCAGGAGGCAGG + Intronic
1183026625 22:35070302-35070324 TGGAGGAGAGAGCAGGAGGCTGG - Intronic
1183408041 22:37639968-37639990 AGGAAGAGAGAGCAGGAGTCTGG - Intronic
1183426831 22:37744560-37744582 CAGAAAAGCCTGGAGGAGGCTGG + Intronic
1183973668 22:41497363-41497385 AAGAAATGACAGCAAGAGGCCGG - Intronic
1184355282 22:43975491-43975513 CAGGAAAGAGAGCGTCAGGCTGG + Intronic
1185098008 22:48822145-48822167 AAGAAAATAGTGCAGGAGGGCGG - Intronic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
949494615 3:4619837-4619859 GAGAAAAGAGAGAAGGAGAGGGG - Intronic
949795470 3:7845556-7845578 CACTAAAGAGAGCTTGAGGCTGG + Intergenic
950183985 3:10933876-10933898 CAGAATAAAGAGCAGCAGGAGGG - Intronic
950290381 3:11779316-11779338 GAGCAAAGAGAGGAGGAGGAAGG + Intergenic
950406816 3:12810088-12810110 CAGCAGACAGTGCAGGAGGCTGG - Exonic
950452706 3:13074137-13074159 ATGAAAAGAGAGCAGGAAGAGGG + Intergenic
950467771 3:13165495-13165517 CAGAAAAGAAAGCAAGCGGGGGG + Intergenic
950543551 3:13626086-13626108 GATAAAACAGAGCAGGACGCAGG - Intronic
950808782 3:15632008-15632030 CAGCAAGGACAGCAGGGGGCTGG - Intronic
950838424 3:15942879-15942901 TAGAAGAGAGAGAAGAAGGCAGG - Intergenic
950899629 3:16486085-16486107 CAGAAAGCAGAGGAGGAGGTGGG - Intronic
950918300 3:16667490-16667512 GAGAAAAGAGAGCAGGAGTGGGG + Intronic
951580241 3:24155374-24155396 CAGAAAAGAAAGCAAGGGGTGGG - Intronic
952494933 3:33907529-33907551 AAGATAAGAGAGTTGGAGGCCGG - Intergenic
953417621 3:42732009-42732031 CAGTAAAGAGAGCAGGAAGATGG - Intronic
953448848 3:42989923-42989945 CCCAAAAGAAAGCAGGTGGCCGG - Intronic
953589358 3:44236660-44236682 CAGCCATGAGGGCAGGAGGCGGG + Intergenic
953868416 3:46604744-46604766 CAAAAGAGAAAGCAAGAGGCGGG + Intronic
953885081 3:46710453-46710475 CCGGAAAGAGAGCTGGAGTCTGG + Exonic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954144752 3:48628983-48629005 CAGAAAACAGAACACAAGGCAGG - Intronic
954429523 3:50462894-50462916 AAAAAAAGAGAGAGGGAGGCTGG + Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955403030 3:58607119-58607141 CAGAAAACTTACCAGGAGGCTGG - Intronic
955407659 3:58635651-58635673 CAGTGAAGAACGCAGGAGGCCGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955607579 3:60722350-60722372 AAGAAAAGAGAGCAGGAGTTGGG + Intronic
956103388 3:65791541-65791563 CAGAAAAGAGAAAGGGAGGGAGG + Intronic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
957054885 3:75435568-75435590 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
957798147 3:85039044-85039066 GAGAAAAGAGAGGAAGAGGAAGG + Intronic
957834416 3:85568519-85568541 AAGAAAAGAGAGAGGGAGGGAGG - Intronic
958121375 3:89293674-89293696 CAGAAAAGAGAGAAAGAGCAAGG - Intronic
958133008 3:89453945-89453967 CAGAAGAGAGAGAGGGAGACAGG - Intronic
959112619 3:102140153-102140175 AAGAAAAGAGAGAGGGAGGGAGG - Intronic
959114615 3:102161963-102161985 AAGAAATAAGAGGAGGAGGCAGG + Intronic
959245220 3:103858927-103858949 CAGCAAAGTCAGCAGGAGACTGG - Intergenic
959445732 3:106436356-106436378 AAGAAGAGAGAGAAGGAGGGAGG + Intergenic
959932480 3:111999291-111999313 CAGCAAAGAGGGCAGAAAGCCGG - Exonic
960046987 3:113208696-113208718 AAGAAAGGTGAGCAGCAGGCCGG + Intergenic
960246370 3:115404603-115404625 AAGAAAAGAAAGAAGGAGGGTGG + Intergenic
960968293 3:123120802-123120824 CAGTAAAGAGAGGTGGAGGTGGG - Intronic
961068704 3:123899787-123899809 CAGAAAAAAGATCAGGAGTTTGG - Intronic
961158150 3:124698270-124698292 GAAAAACAAGAGCAGGAGGCCGG - Intronic
961299947 3:125916106-125916128 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961441288 3:126954801-126954823 CAGAAGACACAGCAAGAGGCTGG + Intronic
961602974 3:128075381-128075403 CCGGAAAGGGAACAGGAGGCAGG + Intronic
961888556 3:130111967-130111989 CAGAGAAGGGCTCAGGAGGCGGG + Intronic
961917598 3:130393294-130393316 CAGAAAAGTGAGACGTAGGCAGG - Intronic
962629976 3:137265664-137265686 CAGGAAATAGAGCATGAGGCTGG + Intergenic
962644966 3:137429284-137429306 TATGAAAGAAAGCAGGAGGCAGG - Intergenic
962714413 3:138114754-138114776 CAGGACAGGGATCAGGAGGCAGG - Intronic
962904894 3:139792713-139792735 CAGAGAAGAAAGGAGGAGACAGG + Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963681353 3:148381822-148381844 CAGCAAAGATAGCAGGAGGCAGG + Intergenic
965780387 3:172279477-172279499 CGAAAAAGAAAGCAGCAGGCAGG - Intronic
966043376 3:175519342-175519364 GAGACAGGAGAGCAGGAGGGTGG + Intronic
966075616 3:175933476-175933498 CAGGAAAGGGAGCAGGGGACAGG + Intergenic
966830763 3:184006420-184006442 TAGGAAGGAGAGCAGGAGGAAGG - Intronic
966866296 3:184260718-184260740 AACAAGAGAGGGCAGGAGGCCGG - Intronic
966929528 3:184666862-184666884 CGGAAACCAGAGAAGGAGGCTGG + Intronic
968320554 3:197764411-197764433 TAGAAAGCAGAGGAGGAGGCGGG + Intronic
968423323 4:503492-503514 CAGAAAAGACAGCAGCACCCGGG - Intronic
968738021 4:2308750-2308772 AAGAAAAGAGAGAAAGAGGGAGG + Intronic
968864142 4:3196982-3197004 TAGTAAAGAGGGCAAGAGGCAGG - Intronic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
969816632 4:9691976-9691998 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
969823711 4:9740236-9740258 AAGAAAAGAGAGAGGGAGGGAGG - Intergenic
970410777 4:15806183-15806205 CAGATAAGAGGGCACGGGGCAGG - Intronic
970436093 4:16036978-16037000 AAGGAAAGAGAGCAGGAGCCAGG + Intronic
970596701 4:17606632-17606654 TATAAAAGAAACCAGGAGGCTGG - Intronic
971022061 4:22546926-22546948 CAGAAAAGAGAGGAAGATGTGGG - Intergenic
971178095 4:24300952-24300974 CAGATGAGAGAGCAGAAGGATGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971198113 4:24488602-24488624 CAGAAGGGACAGCAGGAGACTGG - Intergenic
971265624 4:25094071-25094093 AACAAAAGAGGGCAGGAAGCTGG + Intergenic
971346556 4:25816845-25816867 CAGATAAGAGAGTTGGAGGTGGG - Intronic
971802063 4:31305374-31305396 CAGAAAATAAAGCTAGAGGCAGG + Intergenic
971919443 4:32917820-32917842 AAGAAAAGAAAGAAGGAGGAAGG - Intergenic
972570122 4:40303100-40303122 CAGGAAGGAGAGAAGGAGGCCGG + Intergenic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
972760870 4:42102687-42102709 CAGAAAAGAAAACTGGAGGCTGG + Intergenic
973570204 4:52231111-52231133 CAGAAAAGAGAAGAGGAAGAAGG + Intergenic
973822069 4:54670622-54670644 GAGAAAAGGGAGCAGGAACCAGG - Intronic
974333890 4:60514950-60514972 AAGAAAAGAGAGAAGCAGTCTGG + Intergenic
975366802 4:73539156-73539178 TTGAAAAGAGAGGAGGAGGCAGG - Intergenic
975370913 4:73586486-73586508 CAGAAAGGGGGGCAGAAGGCAGG - Intronic
975476032 4:74824385-74824407 AAGAAAAGATATTAGGAGGCAGG + Intergenic
976038350 4:80852119-80852141 CAGAAAAGGGAAGAGAAGGCGGG - Intronic
976478829 4:85515107-85515129 TAGAATAGAAAGCTGGAGGCTGG + Intronic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
976989952 4:91353775-91353797 CAGACAAGGGAGCAGTAAGCAGG + Intronic
977216633 4:94292795-94292817 CAAAAAAGAGAGGAGGATGTTGG - Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977810137 4:101347761-101347783 AAGAAAACAGAGCAAGGGGCGGG - Exonic
978237916 4:106482374-106482396 CAGCACAGAGAGGAGGAGACAGG + Intergenic
978587555 4:110290065-110290087 GAGACAAGAAAGCAGGAGGAGGG - Intergenic
979810171 4:125027047-125027069 CACAAAAGAAAGATGGAGGCCGG - Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980242060 4:130190326-130190348 CAGAAAAGAGAGCATGTGCAGGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980662668 4:135884252-135884274 AAAACAAGAGAGCAGGAGGAAGG - Intergenic
980774108 4:137417013-137417035 CAAAAAAGTGCGTAGGAGGCTGG + Intergenic
980879300 4:138693218-138693240 AGGAAGAGAGAGCAGCAGGCAGG - Intergenic
981489946 4:145328460-145328482 GAGAAAAGAGAGAGGGAGGGAGG + Intergenic
981513377 4:145581663-145581685 CAGAAGAGAGTACAGGAGCCAGG - Intergenic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
982485454 4:155959770-155959792 GATAATAGTGAGCAGGAGGCTGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
983910641 4:173235124-173235146 CAGAATAGACAGCAGTAGTCTGG - Intronic
983999663 4:174224989-174225011 GAGAAAAGAGGGGAGGAGACGGG - Intergenic
984268161 4:177518877-177518899 CATAAAAGAGAACAGAAGCCAGG - Intergenic
985522906 5:387225-387247 CAGAGGAGAGAGCAGGAGACAGG - Intronic
985748089 5:1658991-1659013 CAGGCAAGAGAGCAGGTGGCTGG - Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
987360051 5:17098517-17098539 CAGACAAGAGAGCAGCAAGGGGG - Intronic
987768477 5:22267845-22267867 CAGAAAATAGAGCTGAAGCCTGG + Intronic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988362765 5:30256582-30256604 CAGACAAGAAAGCATGTGGCGGG + Intergenic
988885117 5:35548097-35548119 CAGAATAGAGTGCAGGAAGAAGG - Intergenic
989285952 5:39700099-39700121 GAGAAAAGAGAGAGAGAGGCTGG + Intergenic
989751116 5:44895260-44895282 GAGGAAAGAGAGCAAGAGACTGG - Intergenic
990425401 5:55683030-55683052 AAGAAGAGAGGGAAGGAGGCAGG + Intronic
990503119 5:56416747-56416769 CAGAAAAGGGAATAGGAAGCAGG + Intergenic
990503359 5:56419743-56419765 CAGAAAAGAGAATAGGAAGCAGG - Intergenic
990755424 5:59064108-59064130 AAGGAAAGAGAGAAGGAGGGAGG + Intronic
991226983 5:64285142-64285164 CAGAAAACAAAGCAGCAGCCTGG - Intronic
992913605 5:81424127-81424149 CAGAAAAAAGAGCAACTGGCCGG + Intronic
993407652 5:87531538-87531560 CACAAAAGAGAGAAGGAAGGAGG - Intergenic
994801262 5:104380196-104380218 AATAAAACTGAGCAGGAGGCAGG + Intergenic
995607843 5:113877123-113877145 CTGAATAGAGAACAGGAGGTAGG + Intergenic
995962095 5:117854106-117854128 AAGAAAAGAGAGAGAGAGGCAGG + Intergenic
996008774 5:118456938-118456960 CAAAAAAGAAAGAAGGAGACCGG - Intergenic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996205866 5:120734284-120734306 GGGAAGAGGGAGCAGGAGGCTGG + Intergenic
996438731 5:123465086-123465108 CAAAAAAGATAGAAGGAGGATGG + Intergenic
996650314 5:125867928-125867950 CAGAAGAGACAGCAGGAAGCTGG + Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997336549 5:133112815-133112837 CATAAAAGAGACAAGAAGGCCGG + Intergenic
997348047 5:133207944-133207966 CAGTAAAAAGAGTAGGAGCCAGG - Intronic
997587010 5:135049192-135049214 CAGAAGTGTGAGCAGGAAGCAGG - Intronic
997823677 5:137087806-137087828 CAGAAAGGAGGTCAGGAAGCAGG + Intronic
997925509 5:138027336-138027358 CAGAAAAGCCAGCAGGAAGCTGG + Intronic
998002203 5:138634250-138634272 TAGGAAAGAGGGGAGGAGGCCGG + Intronic
998247765 5:140524068-140524090 AAGAGAAGAGAGCAGAAAGCAGG + Exonic
998407861 5:141883944-141883966 AAGGAAAGAGAGGAGGAGGGAGG - Intergenic
998477199 5:142431998-142432020 CAGCATGGTGAGCAGGAGGCGGG + Intergenic
998692789 5:144605802-144605824 CAGTAAAGAAATCAGGTGGCGGG + Intergenic
999300131 5:150485920-150485942 CAGAGAAGAGCTCCGGAGGCCGG - Intronic
999637580 5:153638929-153638951 AAAGAAAGAAAGCAGGAGGCAGG + Intronic
999674780 5:153987986-153988008 AAGAAAAGGAAGGAGGAGGCAGG - Intergenic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1000115126 5:158146874-158146896 CCGAAAAGAGAGCAGAAGGGGGG - Intergenic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000518129 5:162265548-162265570 TGGAAAAGAGAGATGGAGGCAGG - Intergenic
1001241944 5:170077891-170077913 GAGAAGAGAGAGAAGGAGGGGGG - Intronic
1001423417 5:171604835-171604857 GAAAAAGAAGAGCAGGAGGCTGG - Intergenic
1001563114 5:172683133-172683155 AAGAAGAGAAAGGAGGAGGCAGG + Intronic
1001617846 5:173056866-173056888 CAGAGAAGAGAGCGGGTGGGAGG + Intronic
1001634295 5:173198679-173198701 AAGAAAAGAGAGAGGGAGGGAGG - Intergenic
1001710208 5:173772389-173772411 CAGAAAGGAGGGCAGGAAGGAGG - Intergenic
1001711947 5:173786176-173786198 CAGAAAGGAGAGACGTAGGCCGG + Intergenic
1001943111 5:175754527-175754549 CAGAAAGGTGACCAGAAGGCTGG - Intergenic
1002040654 5:176511527-176511549 CAGAAATGAAAACATGAGGCCGG - Intergenic
1002162583 5:177324449-177324471 CAGAAAACAGACTAAGAGGCTGG - Intergenic
1002169194 5:177366056-177366078 CTGGAAAGATAGCAGGTGGCAGG - Intronic
1002447140 5:179296516-179296538 CAGCAAGGAAAGCAGGAGGCGGG + Intronic
1002885656 6:1291329-1291351 CAGAAAAGTGACCAGAAGTCAGG + Intergenic
1003066147 6:2904604-2904626 CAGAAAAGAAATCTGGAGGTCGG - Intergenic
1003220305 6:4155241-4155263 CAGAAAACAGAGGAAGGGGCTGG + Intergenic
1003568343 6:7239396-7239418 AGGAAAAGAGAGGAGGAGGGAGG - Intronic
1003944591 6:11062805-11062827 CAGAAAATAGAAGAGGAGGGAGG + Intergenic
1004193093 6:13481388-13481410 CAGAAAAGAGGCCAGGTGGCCGG + Intronic
1004336780 6:14771319-14771341 CAGAAAAGAGAGGAGAATTCCGG + Intergenic
1004447017 6:15709866-15709888 CAGGAAACAGAGCAAGAGGTGGG - Intergenic
1004630410 6:17415721-17415743 CAGGAAAGAAAGCACAAGGCAGG + Intronic
1004685617 6:17940642-17940664 TATAAAAGACAGCAGAAGGCAGG + Intronic
1005403160 6:25456163-25456185 ATGAAAAGAGAACAGCAGGCTGG - Intronic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1006016416 6:31084749-31084771 AAAAAAAAAGAGGAGGAGGCAGG - Intergenic
1006183765 6:32169025-32169047 CAGACAAGACAGTAGGAGGTGGG + Exonic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006433213 6:34011059-34011081 CAGAGAGCAGAGCAAGAGGCAGG + Intergenic
1006473310 6:34240136-34240158 CAGAGAAGAGAGCTGGTGGTGGG + Intronic
1006673153 6:35742640-35742662 CTGAAAAGAGACCAGGGGTCAGG - Intronic
1007755476 6:44096521-44096543 CAGGAAAGAGAGCATCTGGCAGG - Intergenic
1007806881 6:44456995-44457017 GAGAAAAGAGAGACGGAGGCAGG + Intergenic
1008042527 6:46816881-46816903 CAGGAAGGTGAGCAGGAGCCTGG + Intronic
1008455698 6:51708218-51708240 AGGAAAAGAGAGGAGGAGGGAGG - Intronic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009819686 6:68784202-68784224 GAGAAAAGAGAGCAGTAGAAAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011440955 6:87386722-87386744 AAGAAAAAAAAGCAGGGGGCGGG + Intronic
1012150764 6:95748422-95748444 CAGAAAACAGAGCAGGAGTAAGG - Intergenic
1012398911 6:98828550-98828572 CAGAAAAGACAAGAGGAGCCAGG + Intergenic
1012479760 6:99653497-99653519 GAGAAAAGAGAAAAGGAAGCAGG + Intergenic
1012491215 6:99784239-99784261 GGGAAAAAAGAGCAGGAGCCAGG + Intergenic
1012928357 6:105290692-105290714 CAGATAAGAGAGTTGCAGGCTGG - Intronic
1012982285 6:105843382-105843404 CAGAAAAGAGTGCAGGAAAGAGG + Intergenic
1013314024 6:108924219-108924241 TTGAAAAATGAGCAGGAGGCCGG + Intronic
1013415388 6:109920085-109920107 CAGGGATGAGAGCAGGAGTCAGG - Intergenic
1013780724 6:113725934-113725956 CAAAAAATAGAGCAGGGGCCAGG - Intergenic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1014224244 6:118829872-118829894 CAAAAAAGAGAGAAAGAGGGAGG + Intronic
1014327008 6:120010184-120010206 GAGATAGGAGAGAAGGAGGCAGG + Intergenic
1015154985 6:130083047-130083069 AACAAAAGAGGGCAGGAGGAAGG + Intronic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017133936 6:151132009-151132031 CCTAGAAGAGAGCAGGTGGCCGG + Intergenic
1017332344 6:153214534-153214556 CAGGAATGAGAGCAGCAGGCTGG + Intergenic
1017450797 6:154552693-154552715 CAGAAAAGGGAACAGGATGTGGG - Intergenic
1017581802 6:155873014-155873036 CAGAACAGAGAGGGGCAGGCTGG + Intergenic
1017781469 6:157718865-157718887 GAGAAAAGAGAGGAGGAAGAAGG - Intronic
1017892889 6:158653959-158653981 AAGAAAAGAGATGAGGAGGATGG - Intronic
1018118188 6:160608705-160608727 CAGAAAAGAGAACGGGAGATTGG - Intronic
1018926189 6:168208654-168208676 CAGAAAAGTGAGCAGGGGCCGGG + Intergenic
1019034811 6:169045514-169045536 CACCAAAAAGAGCAAGAGGCCGG - Intergenic
1019100629 6:169626411-169626433 CAGAGAAGGCAGCAGGAGCCTGG - Intronic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019290302 7:247009-247031 AAGGAAAGAGGGAAGGAGGCAGG + Intronic
1019795804 7:3047432-3047454 CAGAAAAAAGGACAGGAGGTTGG - Intergenic
1019931602 7:4226971-4226993 CAGAGACGAGGGCAGGTGGCTGG + Intronic
1020103751 7:5410907-5410929 GAGAAAAGAAAGGAGAAGGCTGG + Intronic
1020567081 7:9811317-9811339 CAGAAGAGAGAGCAAGAGCTAGG + Intergenic
1020728202 7:11843736-11843758 TAGAAAAGAGAGAAGGGGGCAGG - Intergenic
1021313246 7:19117433-19117455 CGGAGGAGAGAGCAGGAGGACGG + Exonic
1021904425 7:25319199-25319221 AAGAAAAGAGGGCAGGAAGAAGG - Intergenic
1022415278 7:30171951-30171973 CAGAGCAGTGAGCAGGAGCCTGG - Intergenic
1022467802 7:30663109-30663131 TAGTAAAGAGAGCAAGAGTCTGG + Intronic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023137797 7:37070593-37070615 CACAGATGAGAACAGGAGGCTGG - Intronic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1023502459 7:40865146-40865168 GAGAAAAGAGAGGAGGAGGGGGG - Intergenic
1023549701 7:41356746-41356768 CAGAAAAGGGAACAGCAGGATGG - Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024279286 7:47706176-47706198 CAGAATAGAGAGCTGGGTGCAGG + Intronic
1024309473 7:47956268-47956290 GGGAAAAGAGAGCGGGAGGTGGG + Intronic
1024787649 7:52926680-52926702 CGGAGAAGAGATCAGGAGACTGG + Intergenic
1024988064 7:55213052-55213074 CAGAAGTGAGGGCAGGAAGCAGG + Intronic
1025790326 7:64682062-64682084 CTGAAAAGAGAGTAGGTCGCAGG - Intronic
1026009150 7:66623375-66623397 CAGAAAAGAGATGAGAGGGCTGG + Intergenic
1026076712 7:67178168-67178190 CAGAAAAAAAAACAGGAGGTGGG + Intronic
1026175322 7:67991535-67991557 AAGAAGATAGTGCAGGAGGCTGG - Intergenic
1026184382 7:68070800-68070822 GAGAAAAGAGAGCAGGTTGAGGG + Intergenic
1027159400 7:75791408-75791430 GAGGGAAGAGAGCAGGAGCCAGG - Intergenic
1027529982 7:79318088-79318110 CAGAAAAGAGAGCAAAAAGAAGG - Intronic
1028233286 7:88330476-88330498 CATGAATGACAGCAGGAGGCAGG + Intergenic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028957899 7:96714066-96714088 CAGACAAGAGAGCAGGTGCAGGG - Intergenic
1029105334 7:98170562-98170584 AAGAAAAGACGGCTGGAGGCGGG - Intronic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029350380 7:100009257-100009279 AAAAAAAAAGAGCAGGGGGCAGG + Intergenic
1029530531 7:101122306-101122328 GAGAGAAGGGAGCAGGAAGCGGG + Intergenic
1029599839 7:101557347-101557369 CTGGAAGGAGAGCAGGAGGGTGG - Intronic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1030214365 7:107028702-107028724 AAGAAAAGAGGGTAGGAGACAGG + Intergenic
1030480221 7:110093985-110094007 CAGAAAACAATGCAGGTGGCAGG + Intergenic
1031386365 7:121156679-121156701 CAGAAATGATAGAAGGAGGATGG + Intronic
1031680896 7:124673409-124673431 CCGAAAAGAAAGCATTAGGCTGG - Intergenic
1031887028 7:127253553-127253575 CCGAAAAGAAAGCATGTGGCGGG - Intergenic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1032023153 7:128421323-128421345 TAGAACAGAGGGCAGGGGGCAGG + Intergenic
1032616816 7:133481830-133481852 CAGAAAGGAGTGAAGGAGGAGGG + Intronic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1033122342 7:138677198-138677220 TAAGAAAAAGAGCAGGAGGCCGG - Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1034259835 7:149748106-149748128 CTGCAAAGAGAGCTGGGGGCGGG + Intergenic
1034457233 7:151177437-151177459 CAGAGAGGAGAGCAGGATGGTGG - Intronic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034556456 7:151853268-151853290 CAGAAAAGAGAGGAGAAAGTCGG + Intronic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1035765253 8:2100193-2100215 CAGGAAAGAAGGCGGGAGGCAGG - Intronic
1036099571 8:5763627-5763649 CTGAAAACAGCTCAGGAGGCTGG + Intergenic
1036379545 8:8228086-8228108 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036640302 8:10579459-10579481 GAGAACTGAGAGCAGGAGGCAGG + Intergenic
1036850015 8:12194529-12194551 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1036871377 8:12436802-12436824 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1037085131 8:14838918-14838940 CAGAAAGGTGACCAGGAAGCAGG + Intronic
1037277697 8:17199395-17199417 CAGAAAAGAAAACTGGGGGCAGG - Intronic
1037323339 8:17664563-17664585 CAGAACTGAGAGGAGGAGGCCGG - Intronic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1038020587 8:23549281-23549303 CAAAAGTGAGAGGAGGAGGCAGG - Intronic
1038362046 8:26889941-26889963 CAGAGAGCAGAGCAGGATGCAGG + Intergenic
1038428601 8:27481754-27481776 CAGGAATTAGAGCAGGAGGCTGG - Intergenic
1039229970 8:35433952-35433974 CACAAAATAGAGTAGGAGTCAGG - Intronic
1039667364 8:39548432-39548454 CAGAAAAGAAAGCTCAAGGCTGG - Intergenic
1039797034 8:40924521-40924543 CAGAACAGAGGGCAGGTGGCTGG + Intergenic
1039904425 8:41775539-41775561 CAGAAGTGAGAGCAGGAAGGGGG + Intronic
1040279593 8:46032294-46032316 TAGAAACGAAAGAAGGAGGCTGG + Intergenic
1040798547 8:51315238-51315260 AAAAAAAGAGAGCATGAGGCCGG - Intergenic
1040801509 8:51346743-51346765 GGCAAAAGGGAGCAGGAGGCAGG - Intronic
1041740493 8:61152005-61152027 TAGAAAAGAAAGCTGGGGGCGGG - Intronic
1041952797 8:63523040-63523062 CAGAAATGAGCGCAGGAAACAGG + Intergenic
1042769949 8:72368626-72368648 CAGGAAAGAGAGCAAGAGAAGGG - Intergenic
1042978036 8:74492683-74492705 CAGAAATAAGAGAAGCAGGCAGG - Intergenic
1043405892 8:79932510-79932532 CAGACAGGAAGGCAGGAGGCAGG + Intronic
1044434781 8:92149018-92149040 CAGAACAGAGCTGAGGAGGCTGG + Intergenic
1044576675 8:93777379-93777401 TTCAAAAGAGAGCAGAAGGCAGG - Intronic
1045167980 8:99628456-99628478 AGGAAAAGGGAACAGGAGGCAGG - Intronic
1045401741 8:101825889-101825911 TAAAAAAGAAAACAGGAGGCAGG + Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1048106221 8:131413198-131413220 AAGAAAGGGAAGCAGGAGGCAGG + Intergenic
1048341393 8:133541639-133541661 CAGAAACTAGAGCAGAAGACTGG - Intronic
1048745796 8:137613771-137613793 CAGAAAGGGGAACAGGAAGCAGG - Intergenic
1048817935 8:138351468-138351490 CAGAAAAGACACCAGAAGCCAGG + Intronic
1049346018 8:142139086-142139108 CAGCAAAGATACCAGGAGGAGGG + Intergenic
1049477973 8:142805702-142805724 CTGAAAAGGGGCCAGGAGGCAGG - Intergenic
1049742235 8:144246742-144246764 CTGAAAAGGGAGCAGGTGGTGGG + Intronic
1050098818 9:2096631-2096653 CAGAAAAGAGAACAGTAAGTAGG - Intronic
1050192348 9:3040537-3040559 CAGTAGCAAGAGCAGGAGGCTGG - Intergenic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050800767 9:9610019-9610041 CATAAATGAGAGGAGAAGGCTGG - Intronic
1051246581 9:15117880-15117902 CAGAAAAGAGAGCCTGTGCCTGG - Intergenic
1051264079 9:15294588-15294610 CACAAAAGAGAGCAGTAAACAGG - Intronic
1051386069 9:16510280-16510302 CAGAAAGGAAACCAGGATGCAGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052952018 9:34220149-34220171 AAGAAAAGAGAGGAGAGGGCAGG - Intronic
1053194301 9:36103742-36103764 CAAAAAAGAGAGCATTAGACTGG + Intronic
1053251267 9:36575888-36575910 GAAAAAAGAGAGCAGGAGAATGG - Intronic
1054731615 9:68706468-68706490 CAGACAAGAGAGCTGGGGGTTGG - Intronic
1055094515 9:72398045-72398067 CTGAAAAGTGAGTAAGAGGCTGG + Intergenic
1055826874 9:80338202-80338224 AAGAAATGAGAGAAGGAGACAGG + Intergenic
1056176467 9:84041479-84041501 TTGAAAAAAGAACAGGAGGCCGG + Intergenic
1056242626 9:84663670-84663692 GAGGAAAGAGAGAAGTAGGCAGG - Intergenic
1056422495 9:86442952-86442974 AAGGAAAGAGAGAAGGAGGGAGG - Intergenic
1056498467 9:87184582-87184604 GAGAATAGAAAGCATGAGGCAGG - Intergenic
1056507977 9:87275402-87275424 CAGACACTAGAGCAGGAGGGAGG + Intergenic
1056825869 9:89875953-89875975 TAAAAAAGAAAGAAGGAGGCTGG + Intergenic
1057055815 9:91959864-91959886 AAGAACAGAGAGAAGCAGGCTGG - Intergenic
1057184716 9:93050617-93050639 AAGAAAAGAGCGCAGGGGGCTGG + Intergenic
1057447624 9:95128835-95128857 CAGGTAAGAGGCCAGGAGGCAGG + Intronic
1057959928 9:99445450-99445472 CAGACACCAGAGCAGCAGGCAGG - Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058928464 9:109692906-109692928 GAGAAAAGAGAGATGGAGGTGGG - Intronic
1059684698 9:116623750-116623772 CAGAAAAGCGTGCAGGAGCAGGG + Intronic
1059913730 9:119075764-119075786 AAAAAAAAAGAGCAGGAGGTGGG - Intergenic
1060522249 9:124300486-124300508 CAGGTGAGACAGCAGGAGGCGGG + Intronic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1060816417 9:126637831-126637853 CAGTACAGAGAGCGGGGGGCGGG - Intronic
1060978904 9:127781316-127781338 CAGAAGTGAGAGCAGGGGGCTGG - Intergenic
1061118081 9:128627255-128627277 CAAAGATGAGAGGAGGAGGCTGG - Intronic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061359456 9:130131808-130131830 CAGGCACGAGAGCAAGAGGCGGG - Intronic
1061722031 9:132557752-132557774 AAGAAAAGAAATGAGGAGGCCGG - Intronic
1061858519 9:133456046-133456068 CTGAAAAGGGAGCAGGAGACAGG - Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062128689 9:134880859-134880881 CAGGAAAGAGAGCAGCAGGGTGG - Exonic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1185570701 X:1132789-1132811 CAGAAGAGAGTGCAGAAGCCGGG + Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185751187 X:2610610-2610632 GAGACAAGAGAGAAGGAGACAGG - Intergenic
1186010467 X:5125894-5125916 AAGAAAAGAGGGCGGGAGGGAGG - Intergenic
1186096974 X:6112743-6112765 CACTTAAGAAAGCAGGAGGCCGG - Intronic
1186219474 X:7334256-7334278 ACGAAAAGAGAGGAGGAGGAGGG - Intronic
1186342609 X:8659958-8659980 CAAAAAAGAGAGTAGATGGCAGG + Intronic
1186494634 X:10002423-10002445 AAGAAAAGAGAGAGGGAGGAAGG + Intergenic
1186554862 X:10547274-10547296 CAAAAAAGAAAGAAGGAGGCCGG + Intronic
1187116278 X:16355177-16355199 CAGAGAAGAGGGCAAGAGCCAGG + Intergenic
1187529069 X:20080293-20080315 CAGAAAGGAGAGCATGAAGGTGG - Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187992072 X:24885528-24885550 AAAAAAAGAGAGAAGGAGGGAGG - Intronic
1188310093 X:28605768-28605790 TAGAAAAGAGAGAATGAGTCGGG - Intronic
1188444607 X:30243067-30243089 AAGAAGAGAGAGCTGGAGCCCGG + Exonic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1188829439 X:34878421-34878443 CAGAAATGAGTGGAGGAGACAGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190836135 X:54102323-54102345 CAGAAAATAGACTAAGAGGCAGG - Intronic
1190836870 X:54109322-54109344 CAGAAAATAGACTAAGAGGCAGG + Intronic
1190920876 X:54851541-54851563 AAAAAAAGAGAGAAAGAGGCCGG + Intergenic
1190938706 X:55019734-55019756 CAGACTAGAGAGTAGGAGACTGG + Intronic
1190942975 X:55061386-55061408 GAGAGTAGAGAGCAGGAGGAGGG - Intergenic
1191068048 X:56371162-56371184 GAGAAAAGAGAGCAGAAAACTGG + Intergenic
1191135429 X:57058899-57058921 CTGAAAAGAGAGCTGAAGCCAGG - Intergenic
1192533639 X:71910788-71910810 GAGAAAAGAGAGGAGGAGGAGGG + Intergenic
1192536943 X:71936245-71936267 TAGAGATGGGAGCAGGAGGCTGG + Intergenic
1193224429 X:78965506-78965528 AAGAAAAGAGAGAGGGAGGGAGG - Intergenic
1194790738 X:98146271-98146293 AAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1195035387 X:100967301-100967323 AAGAAAACAGGCCAGGAGGCCGG + Intergenic
1195665019 X:107421213-107421235 CAACAAAGAGAACAGGAGGGAGG + Intergenic
1196519557 X:116657119-116657141 CAGAAAAGAGGGAAGGAATCTGG + Intergenic
1196872137 X:120122744-120122766 CATAAAAGAGAGAAGCAAGCAGG + Intergenic
1197749070 X:129952677-129952699 GAGAAAGGAGAGCGGGAGGGAGG - Intergenic
1197934895 X:131729843-131729865 CAAAAAAGAGAAAAGGAGCCGGG + Intergenic
1198683682 X:139205965-139205987 AAGAAAAGAGAGAAGGAGGGAGG + Intronic
1199462368 X:148098754-148098776 CAGAGAACAGAGCAAGAAGCAGG + Intergenic
1199582317 X:149372746-149372768 CTGAAAATATAGCTGGAGGCTGG + Intergenic
1199767872 X:150953873-150953895 AAGAAAACAGAGAAGGAGGGGGG - Intergenic
1199798923 X:151230372-151230394 AAGAAAGGAGAACTGGAGGCAGG + Intergenic
1199802432 X:151264991-151265013 TAAAAATGAAAGCAGGAGGCAGG - Intergenic
1199966539 X:152825046-152825068 CAGAAAAGAGTCCTGAAGGCGGG - Intergenic
1200128357 X:153828793-153828815 CCGAAAAGGAAGCAGGAGGATGG + Intronic
1200137806 X:153883425-153883447 CAGAGGAGAGAGCAGGGGGGCGG + Intronic
1201697281 Y:16839918-16839940 CAGACAAGGGAGCAGTAAGCAGG - Intergenic
1201788919 Y:17816457-17816479 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1201812634 Y:18089530-18089552 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202334211 Y:23789816-23789838 CAGAGGAGAGGGCAGGGGGCGGG + Intergenic
1202350525 Y:23985532-23985554 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202520254 Y:25684589-25684611 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202536557 Y:25880243-25880265 CAGAGGAGAGGGCAGGGGGCGGG - Intergenic