ID: 902550756

View in Genome Browser
Species Human (GRCh38)
Location 1:17218181-17218203
Sequence CAGTTGCAAGAGAGGGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902550753_902550756 -9 Left 902550753 1:17218167-17218189 CCACAGGTTGGCTACAGTTGCAA 0: 1
1: 0
2: 3
3: 15
4: 106
Right 902550756 1:17218181-17218203 CAGTTGCAAGAGAGGGCATCTGG 0: 1
1: 0
2: 1
3: 22
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902550756 Original CRISPR CAGTTGCAAGAGAGGGCATC TGG Intronic
900200190 1:1401215-1401237 CACTTGCTAGAGATGGCTTCAGG - Intronic
902550756 1:17218181-17218203 CAGTTGCAAGAGAGGGCATCTGG + Intronic
903657242 1:24956868-24956890 CAGAGGAAACAGAGGGCATCTGG - Intronic
904874087 1:33640544-33640566 CAGTGGCAACAGAGACCATCTGG + Intronic
905042445 1:34971242-34971264 AAGGTTCAAGATAGGGCATCTGG - Intergenic
905943726 1:41884656-41884678 CATTTGCAAGTGAGGGGATTGGG - Intronic
906258448 1:44368123-44368145 CAGAAGAAAGAGAGGGCAGCTGG + Intergenic
907256580 1:53183580-53183602 CAGTTGCAAGAGAGACCACGTGG - Intergenic
908913990 1:69104848-69104870 CAGTTGCAACAGAGATCATATGG - Intergenic
909567377 1:77068213-77068235 CAGCTACAGGAGAGGGCAACAGG + Intergenic
913204857 1:116528950-116528972 GAGTTTCAAGAGAGGACATTTGG - Intronic
916459569 1:165009421-165009443 CAGTGGCAAGAGAGGCCACTGGG - Intergenic
921776719 1:219109791-219109813 CAGTGTCAAGAGAGCTCATCTGG - Intergenic
922999942 1:229998760-229998782 CAGTGGCAAGAGTGGTCACCAGG + Intergenic
923118945 1:230972061-230972083 GAGTTGCAAGAGAAGACAACTGG + Intronic
923995262 1:239486570-239486592 TAGTTGCAAGAGAGGTCATATGG - Intronic
1067182227 10:43996973-43996995 AAGTTGCAACAAAAGGCATCAGG - Intergenic
1067518163 10:46973128-46973150 AAGGTTCAAGAGTGGGCATCTGG + Intronic
1067644086 10:48078700-48078722 AAGGTTCAAGAGTGGGCATCTGG - Intergenic
1071485562 10:86099865-86099887 CAGTTGCAATGCAGGGCCTCTGG - Intronic
1071491027 10:86136440-86136462 CAGATGGAAGAGAGGGGCTCTGG + Intronic
1071728795 10:88227098-88227120 TAGTTGCAAGAGAGGTCATATGG + Intergenic
1072282538 10:93880780-93880802 ACGTTGCCAGAGAGTGCATCAGG + Intergenic
1073215292 10:101832853-101832875 AAGGGGGAAGAGAGGGCATCTGG - Intronic
1073999083 10:109349942-109349964 CACTTGCAAGTGAGGACATGTGG + Intergenic
1075099235 10:119494280-119494302 CACTTGCAAGGGAGGGTCTCAGG - Intergenic
1075729581 10:124628278-124628300 CACATGCAGGAGTGGGCATCCGG + Intronic
1077370217 11:2178212-2178234 CAGCTGGAAGGAAGGGCATCCGG + Intergenic
1077935947 11:6785655-6785677 TAGCAGCAAGAGAGGGAATCAGG - Exonic
1079004828 11:16784156-16784178 CAGTGGCTGGAGAGGTCATCAGG - Intronic
1079187874 11:18253738-18253760 CAGTTGCAAGTCTGGGCCTCTGG - Intergenic
1081995571 11:47361459-47361481 CAGTTCCAAGACAGGGCTTTTGG - Intronic
1083922740 11:65789273-65789295 CAGGTGCAGGAGAGGGCCTCTGG + Intronic
1084775020 11:71369331-71369353 CAGGTGCCAGAGAGCGCACCTGG + Intergenic
1089070903 11:115698852-115698874 CAGTTACAAGAGAGAACATGTGG + Intergenic
1089434668 11:118454508-118454530 TAGTTTCAACAGAGGCCATCTGG - Intronic
1090735421 11:129608735-129608757 CAGCTGCAGGTGAGGGCAACGGG + Intergenic
1091346382 11:134857038-134857060 CAGGTCCAAGAGACAGCATCTGG - Intergenic
1093371572 12:18372882-18372904 CATTTGTGAGAGATGGCATCTGG + Intronic
1095054392 12:37582340-37582362 CAGGGTCAAGAGAGTGCATCTGG - Intergenic
1096153408 12:49328944-49328966 CAGGGGCAGGGGAGGGCATCAGG - Exonic
1097885038 12:64720452-64720474 CAGAGGCAAGAGAGGGTATGGGG + Intronic
1102220171 12:111188815-111188837 TTGTTGGAAGAGAGGGCAGCAGG + Intronic
1105267794 13:18837200-18837222 CACTTCCAAGACAGGGCAGCCGG + Intergenic
1107868734 13:44728216-44728238 CAGTTGCAAGTCTGGGCCTCAGG + Intergenic
1109742187 13:66568691-66568713 GATTTGCAGGAGAGGGGATCAGG + Intronic
1110121633 13:71888806-71888828 CAGTTGGCAGAGAGGGAATGTGG + Intergenic
1110333040 13:74294671-74294693 CAGTTACAAGAGAATGCATGTGG - Intergenic
1110348731 13:74480809-74480831 CAGTTGCTATAGAAGGCATTTGG - Intergenic
1112274712 13:98005643-98005665 CAGATGCAAGAGAAGGCAGCAGG + Intronic
1112831183 13:103453606-103453628 CATTTGGAACAGAAGGCATCAGG + Intergenic
1114628394 14:24144178-24144200 CATTTCCAAGTGAGGGCAGCTGG - Exonic
1115875067 14:37852086-37852108 AACTTGCAAGAGAGGGCTTCAGG - Intronic
1116730113 14:48610784-48610806 GAGTGGTGAGAGAGGGCATCTGG - Intergenic
1117493240 14:56273687-56273709 CAGTGGCAAGAGAGGGCTCAGGG + Intronic
1117888268 14:60388557-60388579 CAGGAGCAAGAGAGGGCAGGAGG - Intergenic
1118740710 14:68737483-68737505 CAGAGGTGAGAGAGGGCATCAGG - Intergenic
1119098015 14:71852213-71852235 CAGTTGCAAGAGAGACCATATGG - Intergenic
1121370857 14:93357082-93357104 CACTTACAAGAGAGAGCATGTGG + Intronic
1123477562 15:20600829-20600851 CAGAAGCAGGAGAGAGCATCAGG - Intergenic
1123484231 15:20671890-20671912 CAGTTGCCACATAGGGCTTCTGG - Intergenic
1123640454 15:22399553-22399575 CAGAAGCAGGAGAGAGCATCAGG + Intergenic
1124176963 15:27435349-27435371 TAGTTGCAAGAGAGACCATACGG - Intronic
1125758671 15:42083014-42083036 CAGTGGCCAGAGCGGGCATGGGG - Intronic
1127912821 15:63432227-63432249 GAGTTCCAGGTGAGGGCATCAGG - Intergenic
1128570550 15:68730312-68730334 CAGATGCAAGGGAGGGGCTCTGG - Intergenic
1131696589 15:94883151-94883173 CAGTTGCAAGTTGGGGCTTCTGG - Intergenic
1133191380 16:4136021-4136043 AAGGTGCAAGAGAAGACATCAGG + Intergenic
1133458709 16:5967129-5967151 TAGTTGCAACAGAGACCATCTGG + Intergenic
1134074948 16:11284154-11284176 AAGTTGCTGGACAGGGCATCTGG - Intronic
1134593728 16:15477926-15477948 CAGTTGTAAGAGAGAGGACCTGG + Intronic
1134633410 16:15773749-15773771 TAGTTGCAACAGAGGCCATCTGG + Intronic
1139447063 16:67004521-67004543 CAGGAGCAAGGGAGGGCTTCAGG - Intronic
1141055461 16:80809784-80809806 AAGTGACAAGAGAGGTCATCTGG + Intergenic
1141154979 16:81591011-81591033 CAGTTGTGAGACAGGGCATATGG + Intronic
1141202376 16:81908059-81908081 CAGCTGGAGGAGAGGGCAACAGG - Intronic
1141582605 16:85010761-85010783 TAGTTGCCTGAAAGGGCATCTGG - Intronic
1142400961 16:89858620-89858642 CAGTTTCAAGGGAGGGCTCCTGG - Intronic
1143966000 17:10756908-10756930 TAGTTGCGACAGAGGCCATCTGG + Intergenic
1145806011 17:27730748-27730770 CAGGTGTAAGAGACAGCATCTGG + Intergenic
1146334772 17:31960101-31960123 TAGCTGCAAGAGAGGGCAGAGGG + Intronic
1146401278 17:32501895-32501917 CAGTTGCAAGTCAGGGTCTCTGG - Intronic
1146736460 17:35242933-35242955 TAGTTGCAAGAGTGGGCTTCCGG + Intergenic
1148105863 17:45118499-45118521 GGGTGGCAGGAGAGGGCATCAGG + Intronic
1150451106 17:65269885-65269907 CAGATGAAAAAGAGGACATCTGG - Intergenic
1152138100 17:78517787-78517809 CAGTTGTAAGAGAGAGAAGCTGG - Intronic
1153453026 18:5250654-5250676 CAGTTGCAAGACATGTCATCTGG + Intergenic
1153591398 18:6677254-6677276 CAGGTTCAAGACTGGGCATCTGG + Intergenic
1155233167 18:23793847-23793869 CAGTTGCAAGCCTGGGCCTCTGG + Intronic
1156639666 18:39075510-39075532 TAGTTGCAAGAGAGCTCTTCTGG - Intergenic
1157419925 18:47538581-47538603 CAGGTGCCAGAGTGGGCACCAGG + Intergenic
1159898720 18:74021934-74021956 CAGTTGGAAGGCAGGGCATGTGG - Intergenic
1163411855 19:17159869-17159891 CAGTTGCAACAGAGAACATCAGG + Intronic
1163789381 19:19297535-19297557 CAGTTCAAAGGAAGGGCATCGGG - Intronic
1164367252 19:27599221-27599243 CAATAGAAAAAGAGGGCATCCGG + Intergenic
1164797719 19:31047645-31047667 CAGTTGCAAGACAGATCATCGGG - Intergenic
1165144649 19:33723670-33723692 CAATTGCAAGGGACAGCATCAGG + Intronic
1165150921 19:33759630-33759652 CAGTTGGAGGAGAGGGAATTAGG - Intronic
1165462829 19:35954125-35954147 CAGAGGCAGGAGAGGGCACCAGG - Intergenic
1166522277 19:43488518-43488540 CAGTATCATGTGAGGGCATCTGG - Intronic
1167029448 19:46947750-46947772 CAGTTGCAAGTGCAGGCCTCTGG + Intronic
1167442407 19:49516003-49516025 CAGTTGAATGAGTGGGGATCTGG - Intronic
925078432 2:1039989-1040011 CAGTTGAAAGAGAAGGTCTCTGG + Intronic
925977787 2:9153143-9153165 CATTTGCAGAAGAGGGCTTCAGG + Intergenic
927505182 2:23608353-23608375 CAGTTGCAAGTCAGGGCAACAGG - Intronic
928215144 2:29355097-29355119 CAGTTGCTAGGGAAGGTATCAGG - Intronic
929430385 2:41881442-41881464 GAGTTGCAACAGAGACCATCTGG - Intergenic
930302992 2:49640361-49640383 CAGTTGCAACAGAGACCATATGG - Intergenic
931713997 2:65013868-65013890 TAGTTGCAATAGAGAGCATGTGG - Intronic
934166647 2:89300029-89300051 CAGTTGCAAATGAAGGAATCTGG - Intergenic
934200634 2:89882428-89882450 CAGTTGCAAATGAAGGAATCTGG + Intergenic
934611410 2:95739657-95739679 CAGGTGCAAGAGAGGGAGTGTGG - Intergenic
934818658 2:97352885-97352907 CAGTTGCAACTGAAGGAATCTGG + Intergenic
935242392 2:101190026-101190048 CAGTTGCAAGTCCGAGCATCTGG - Intronic
936051660 2:109228600-109228622 CAGTTGCAAGAGGTGTCTTCAGG + Intronic
936547350 2:113404107-113404129 CAGTTGCAAGAGAAGGGATCTGG + Intergenic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937548183 2:123051208-123051230 CAGTTGCAACAAACAGCATCTGG - Intergenic
937610080 2:123850584-123850606 CAGTAGGAAGAGAGGGCAAAGGG - Intergenic
939464294 2:142537881-142537903 CAGTTGAAACAAAGGGCATTTGG - Intergenic
939867237 2:147486348-147486370 CGGGTGGAAGAGAGGGCATGCGG - Intergenic
941168031 2:162104346-162104368 CAGGGGAAAGAGAGGGCACCAGG + Intergenic
941801146 2:169661180-169661202 AAGTTGCAAGAGAAGGCATGGGG - Intronic
942184711 2:173414032-173414054 AAGTTGCAAGAGAAGACATGAGG - Intergenic
943430583 2:187796127-187796149 CAGGAGCAAGAGAGAGCAACTGG + Intergenic
944944701 2:204670241-204670263 CAGCTGCAACAGAGGTCATGTGG - Intronic
946399519 2:219461129-219461151 CAGTTGCAGGGGAGGGCGTCAGG + Intronic
946998527 2:225425190-225425212 CAGCTACAAGAGAAGGAATCAGG + Intronic
947980531 2:234404969-234404991 AGATTGCAAGAGATGGCATCCGG + Intergenic
948761266 2:240192843-240192865 CAGTGGAGAGCGAGGGCATCTGG - Intergenic
1170000406 20:11608211-11608233 CATATGCAAGTGAGGGCTTCTGG - Intergenic
1171950774 20:31419717-31419739 CAGGTGAGAGAGAGGGCACCAGG - Intergenic
1175385989 20:58595429-58595451 CAGTTGCAACAGAGAACTTCTGG + Intergenic
1176943557 21:14952726-14952748 GAGTTGGAAGAGGGGGTATCTGG + Intergenic
1179442300 21:41403774-41403796 CAAAGGCAAGAGAGGGCATGTGG + Intronic
1180153775 21:45967136-45967158 CAGTGGCAAGTGTGGGCCTCTGG - Intergenic
1180222822 21:46370204-46370226 CAGCTGCAGGGGTGGGCATCCGG + Intronic
1182055583 22:27352041-27352063 CACATGCTAGAGAGGGCATAAGG - Intergenic
1182061111 22:27398214-27398236 AAGTTGCAACAGAGGACATCTGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1184261210 22:43317630-43317652 CAGTGGCAAAAGAGGGCCTTGGG + Intronic
950775544 3:15346791-15346813 CAGTTGCAACAGAGACCATATGG + Intergenic
951443316 3:22747726-22747748 CAGGTCCCAGAGAGGGCTTCAGG - Intergenic
952809451 3:37388176-37388198 CAGTTCCAAAAGAGTGCTTCAGG + Intronic
953822672 3:46221948-46221970 CAGTGGCAAGAGAGGGGCTGGGG - Intronic
954038863 3:47869128-47869150 AAAGTGCAAGAGAGGGCATGTGG + Intronic
954638366 3:52083891-52083913 CAGTTCCAAGAGTGTGCTTCAGG - Intronic
955591467 3:60540403-60540425 CAGTTGCAAGTCTGGGCCTCTGG - Intronic
955958624 3:64316520-64316542 CAGTTGCAAGCCTGGGCCTCTGG - Intronic
956729940 3:72187248-72187270 TAGTTGCAACAGAGATCATCTGG - Intergenic
960003660 3:112759878-112759900 CAGTCCCAAGAGAGGCCACCTGG - Intronic
962208029 3:133451424-133451446 GAGTTACAACAGAGGCCATCTGG - Intronic
962487615 3:135860468-135860490 CCTTTGAAAGAGAGAGCATCAGG - Intergenic
964811162 3:160666203-160666225 TAGTTGAAAGAGAGAGCATTGGG - Intergenic
972381787 4:38526291-38526313 CAGTAGCACCAGAAGGCATCAGG - Intergenic
972766941 4:42159903-42159925 CAGTCGCAAGTGCGGGCCTCCGG + Intergenic
973601665 4:52548545-52548567 CATTTGCAGAAGAGGGCACCTGG + Intergenic
973768516 4:54186067-54186089 CAGTTACAGGATAGGACATCTGG + Intronic
974934219 4:68394294-68394316 CAGTTGCAAGTCTGGGCCTCTGG - Intergenic
977696241 4:99969760-99969782 CAGTTTCAATACAGGGCATCTGG - Intergenic
979841263 4:125443782-125443804 GAGAAGCAAGAGAGGTCATCAGG + Intronic
980070975 4:128242767-128242789 CAGAGGCAAGAGAGGGCCTAGGG + Intergenic
981321377 4:143395962-143395984 CTGTTGAAGGAGAGGGCATATGG + Intronic
986496501 5:8346796-8346818 GAGTGGCACGAGAGGGCCTCTGG - Intergenic
987865915 5:23538422-23538444 CAGTTACAAGTGAGGACATGTGG + Intergenic
992241312 5:74772544-74772566 CAGTTGCAACAGAGGCCATATGG + Intronic
994443506 5:99841425-99841447 CAGTTGTAATTGAGGGCATTGGG + Intergenic
995651848 5:114378263-114378285 TAGTTGCAACAGAGGCCATGTGG + Intronic
996485095 5:124024295-124024317 CAGTAACTAGAGAGGGCAGCTGG - Intergenic
999225165 5:150016042-150016064 CAATTATAAGAGAAGGCATCTGG + Intronic
1000260686 5:159585507-159585529 GAGTTGCAAGAGAGATCGTCTGG - Intergenic
1000871200 5:166579686-166579708 CAGTTACAATAATGGGCATCAGG - Intergenic
1001073375 5:168605853-168605875 CAGGTCCAGGAAAGGGCATCTGG + Intergenic
1001099362 5:168801456-168801478 CAGTCACAAGTGAGAGCATCTGG - Intronic
1002276997 5:178110460-178110482 CACTTGCAAGAAATGGCATGAGG - Intergenic
1002952035 6:1823582-1823604 CAGGTGCCAGAAAGGGCATGTGG - Intronic
1003145660 6:3508210-3508232 GAGTTGCAAGAGATGCCTTCTGG + Intergenic
1004017769 6:11747839-11747861 CAGATGAAAGAGAGGCCATCAGG - Intronic
1006369846 6:33637228-33637250 CAGTTGCAAGTCCGGGCTTCTGG + Intronic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1009061378 6:58401108-58401130 AAGTTTCAAGAGTAGGCATCTGG - Intergenic
1009249050 6:61275660-61275682 AAGTTTCAAGAGTAGGCATCTGG - Intergenic
1011699983 6:89947151-89947173 CACTTGAAAGAGAAGGCACCTGG + Intronic
1011957778 6:93044718-93044740 CAGTTACCAAAGAGGGCAACTGG - Intergenic
1012518879 6:100096442-100096464 CATTTGCAAGAGAAGGGATAGGG + Intergenic
1012949328 6:105501392-105501414 CAGTTGCAATAAAGGGAATCTGG - Intergenic
1013997508 6:116325536-116325558 CAGTTGCAACACAGGACATTAGG - Intronic
1015343449 6:132128683-132128705 CAGTTGCAACAGAGACCATATGG + Intergenic
1018351217 6:162961310-162961332 CAGTTGCAAGTGAGACAATCAGG - Intronic
1018931857 6:168245243-168245265 CAGTGGCAAGAGTGGGGATGGGG - Intergenic
1020504365 7:8964776-8964798 CAGTTACAAGAAAGGGCCTTTGG - Intergenic
1020978952 7:15044093-15044115 CAGTTGGAAGAGAGCCAATCGGG + Intergenic
1022168985 7:27804559-27804581 CAGTTACAAGTGAGGTCCTCAGG + Intronic
1022172030 7:27840176-27840198 CAGTGGCATGAAAGGGGATCAGG - Intronic
1023159238 7:37281495-37281517 CATTTTCCAGAGAGGGCATGTGG - Intronic
1024331780 7:48162213-48162235 CAGTTGCAAGTCCAGGCATCTGG + Intergenic
1024569456 7:50711652-50711674 CAGTTGGTAGAGAGGGTATCAGG - Intronic
1024791472 7:52969481-52969503 CAGTTGGGATAGAGGGGATCTGG - Intergenic
1024909829 7:54434469-54434491 CAGTTGAAACAGAGTACATCTGG + Intergenic
1026237933 7:68545171-68545193 CTGTTACAAAGGAGGGCATCTGG - Intergenic
1027108481 7:75419909-75419931 GGGCTGCCAGAGAGGGCATCGGG - Intronic
1029967761 7:104758118-104758140 CATTTGCAAGTGAGGACATGTGG - Intronic
1030837502 7:114307798-114307820 GAGTTGCCAAAGATGGCATCAGG + Intronic
1032434786 7:131890910-131890932 AAGGTGAAAGAGAGGGCATAAGG - Intergenic
1032706953 7:134428816-134428838 CACTTGTAAGTGAGGGCATGTGG + Intergenic
1033360483 7:140635703-140635725 CAGTTGGAAGAGTGGGTCTCAGG + Intronic
1034561140 7:151879941-151879963 CAGTTGCAAGTCCAGGCATCCGG - Intergenic
1035340517 7:158157761-158157783 CAGGCGCAGGAGAGGGCACCCGG - Intronic
1036001288 8:4607987-4608009 CAGTGGTCAGAGAAGGCATCAGG + Intronic
1036562756 8:9911074-9911096 CAGTTGCTACATAGGGCATGAGG + Intergenic
1038750621 8:30292125-30292147 CAGGTTCAAGACTGGGCATCTGG + Intergenic
1039603267 8:38859857-38859879 CAGTTGTAACAGAGGCCATATGG + Intergenic
1041157333 8:55001924-55001946 CAGGTGCAAAAAAGGGCATGGGG + Intergenic
1041253554 8:55958623-55958645 TGGTTGCCAGAGAGGGGATCAGG - Intronic
1041496345 8:58489181-58489203 CAGTTGCAACAGAGACCATGTGG - Intergenic
1043838733 8:85076175-85076197 ATGGTGCAAGAGAGGGCGTCAGG - Intergenic
1045143413 8:99312930-99312952 CAACTGGAAGAAAGGGCATCAGG - Intronic
1047192733 8:122692946-122692968 CAGCTGCCAGAGATGGCACCTGG - Intergenic
1047944566 8:129862288-129862310 AAGTTGCAAGAGAAGGCATGGGG - Exonic
1048305671 8:133282759-133282781 CAGTTGCAACAGAGGTCATGTGG + Intronic
1048591032 8:135820963-135820985 CAGCTGGATGGGAGGGCATCAGG - Intergenic
1049258828 8:141628017-141628039 CAGTTCCATGGGAGGGGATCTGG - Intergenic
1049326852 8:142026029-142026051 CAGTGCCAAGAGATGGCACCTGG - Intergenic
1049623946 8:143611833-143611855 CAGGAGCCAGGGAGGGCATCTGG + Intergenic
1051696484 9:19773443-19773465 AGGTTGCAAGTGTGGGCATCAGG - Intronic
1054815762 9:69473759-69473781 AAGCTGCAACAGAGGGCATTTGG + Intronic
1055152349 9:73017335-73017357 CAGTTGCAACAGAGACCATAAGG + Intronic
1056047409 9:82733363-82733385 CTGTTCCAAGTGAGGGCTTCTGG + Intergenic
1056218715 9:84430180-84430202 CAGTTGCAACAAAGACCATCTGG - Intergenic
1058429702 9:104907302-104907324 CAGTTGCAGGGGAGGATATCAGG - Intronic
1058856507 9:109067833-109067855 AAGTTGGAAGAAAGGACATCTGG + Intronic
1060223770 9:121778685-121778707 CAGTTGCAATAGAGACCATATGG - Intronic
1062049731 9:134441069-134441091 CAGGTGCATGAGAGGGCTCCGGG - Intergenic
1062688597 9:137828946-137828968 CAGAGGCAAAAGAGGCCATCTGG - Intronic
1186453849 X:9695205-9695227 CAGTTGCAAGAGAGACCAGATGG + Intronic
1186947281 X:14582797-14582819 TAGTTGCAACAGAGGCAATCTGG - Intronic
1189666260 X:43357922-43357944 CAGTTCCAAAAGAGGGGTTCAGG - Intergenic
1192204417 X:69086577-69086599 CAACAGCAAGAGAGGGGATCTGG + Intergenic
1193371045 X:80697550-80697572 CATTTGTAAGAGAGGGCGTGTGG + Intronic
1197784380 X:130186030-130186052 AAGTTGGAAGAGAGGACAACTGG + Intergenic
1198646886 X:138817864-138817886 CAGTTGCAACAGAGACCATATGG - Intronic
1201452896 Y:14135708-14135730 CAGTTGCAAGAAAGGGTAATGGG - Intergenic