ID: 902551512

View in Genome Browser
Species Human (GRCh38)
Location 1:17222320-17222342
Sequence GGTCTCTGGAAGCTCCGGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902551504_902551512 -1 Left 902551504 1:17222298-17222320 CCAAGGGTGCCAACAGCTTCAGG 0: 1
1: 0
2: 2
3: 21
4: 203
Right 902551512 1:17222320-17222342 GGTCTCTGGAAGCTCCGGGGTGG 0: 1
1: 1
2: 1
3: 18
4: 158
902551508_902551512 -10 Left 902551508 1:17222307-17222329 CCAACAGCTTCAGGGTCTCTGGA 0: 1
1: 0
2: 3
3: 40
4: 274
Right 902551512 1:17222320-17222342 GGTCTCTGGAAGCTCCGGGGTGG 0: 1
1: 1
2: 1
3: 18
4: 158
902551502_902551512 11 Left 902551502 1:17222286-17222308 CCAGTGATGTGCCCAAGGGTGCC 0: 1
1: 0
2: 0
3: 49
4: 104
Right 902551512 1:17222320-17222342 GGTCTCTGGAAGCTCCGGGGTGG 0: 1
1: 1
2: 1
3: 18
4: 158
902551498_902551512 28 Left 902551498 1:17222269-17222291 CCCATCTCTCTTCTCTGCCAGTG 0: 1
1: 1
2: 3
3: 49
4: 398
Right 902551512 1:17222320-17222342 GGTCTCTGGAAGCTCCGGGGTGG 0: 1
1: 1
2: 1
3: 18
4: 158
902551499_902551512 27 Left 902551499 1:17222270-17222292 CCATCTCTCTTCTCTGCCAGTGA 0: 1
1: 1
2: 9
3: 65
4: 556
Right 902551512 1:17222320-17222342 GGTCTCTGGAAGCTCCGGGGTGG 0: 1
1: 1
2: 1
3: 18
4: 158
902551503_902551512 0 Left 902551503 1:17222297-17222319 CCCAAGGGTGCCAACAGCTTCAG 0: 1
1: 0
2: 0
3: 18
4: 202
Right 902551512 1:17222320-17222342 GGTCTCTGGAAGCTCCGGGGTGG 0: 1
1: 1
2: 1
3: 18
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902551512 Original CRISPR GGTCTCTGGAAGCTCCGGGG TGG Exonic
900056045 1:631484-631506 GGTCTACGGAGGCTCCAGGGTGG - Intergenic
900922838 1:5684591-5684613 GTTCTCTGGAATCTCAGGAGGGG - Intergenic
901463769 1:9407424-9407446 GGTATCTGGGAACTCCAGGGGGG - Intergenic
902410970 1:16211406-16211428 GGGTTCTGGAAGCTCCTGGAGGG + Intronic
902551512 1:17222320-17222342 GGTCTCTGGAAGCTCCGGGGTGG + Exonic
905546949 1:38807594-38807616 GGGCTCTGGAAGCCCAGAGGCGG - Intergenic
906218466 1:44058758-44058780 GCTCACTGCAAGCTCCAGGGAGG + Intergenic
906847323 1:49207133-49207155 GGTCTCAGGAGGCTCTGGGCAGG + Intronic
908629284 1:66084656-66084678 GGGGTCTGGAAGCTCAGGTGTGG + Intronic
912955529 1:114152534-114152556 GATATCTGGAGGGTCCGGGGCGG - Intronic
914985783 1:152455926-152455948 GGTCTCTGCAAGCACAGGGTTGG + Intergenic
915090263 1:153419317-153419339 GGTCTCTGGAGGCCCCTTGGTGG - Exonic
917044171 1:170838305-170838327 GGGCTGTGGAAGCTCAGGGGAGG + Intergenic
918236230 1:182583024-182583046 GTTCTCTGAAAACTCCTGGGAGG - Intronic
918488468 1:185054485-185054507 GGTCTCTGGCCCCTCCGGGCCGG + Intronic
920068223 1:203284177-203284199 GGTCTCTGGAAGCTGTGGGAGGG - Intergenic
921413297 1:214859823-214859845 GGTCTCATGAAGCTTCGGCGTGG + Intergenic
922728724 1:227939215-227939237 GGTCTCAGGAACCACGGGGGAGG + Intronic
922784656 1:228276921-228276943 GCTCACGGGAAGCTCTGGGGAGG - Exonic
923688903 1:236174436-236174458 GGGTTCTGGAAGATGCGGGGTGG + Intronic
1063197587 10:3758067-3758089 GGGCTCTGGAAGCTGCAGGCAGG + Intergenic
1066258618 10:33706380-33706402 GTTGTCTGGAAGCTCCAGTGTGG - Intergenic
1067169222 10:43892429-43892451 CATCTCTGGAAGCTGCTGGGAGG - Intergenic
1073208260 10:101779994-101780016 GGCCTCTAGAGGCTCCGGGCGGG - Intronic
1075386940 10:122061796-122061818 GGTCTCTGGGAGCACAGGGGCGG + Intronic
1075447795 10:122525955-122525977 GGTCTCGTGAAACTCCAGGGAGG + Intergenic
1075604251 10:123792942-123792964 GGTTTCTGGGGGCTCTGGGGTGG - Intronic
1076590715 10:131580352-131580374 GGTGTCTGGGATCTCCAGGGTGG - Intergenic
1076846483 10:133071821-133071843 GGCCTCGGGAAGCTGTGGGGTGG + Intronic
1077035865 11:494216-494238 GGGCTCCTGAGGCTCCGGGGTGG + Intergenic
1077193915 11:1269826-1269848 GGGCTCTGGAGGCTCCTGTGAGG + Intergenic
1077514235 11:2992128-2992150 CATCTCTGGAAGCCTCGGGGCGG - Intronic
1078477507 11:11643845-11643867 GGTCTCTAGAAGCTGGGAGGGGG + Intergenic
1078860141 11:15239191-15239213 TGTCTCTGGGGGCTCAGGGGTGG + Intronic
1081966400 11:47172787-47172809 GCTCTGTGGAGGCTCTGGGGTGG - Intronic
1082784949 11:57311617-57311639 GGCCTCTGGGGGCTGCGGGGCGG - Intronic
1084424322 11:69076506-69076528 GGTTTCCGGATGCTACGGGGTGG - Intronic
1084502610 11:69543842-69543864 TGTCTCTGAAGGCTCCAGGGAGG + Intergenic
1090749436 11:129733019-129733041 GGTCTTAGGATTCTCCGGGGAGG - Intergenic
1091695178 12:2623531-2623553 GTGCTCTGGAAGCTCAGAGGTGG - Intronic
1092486901 12:8909832-8909854 CTTTTCTGGAAGCTCTGGGGAGG + Intergenic
1095175831 12:39091026-39091048 GGTTCCTGGAAGCTGCGTGGAGG - Intergenic
1095954459 12:47798361-47798383 GGTGTCTGGAGGCTCTAGGGAGG - Intronic
1096553985 12:52391896-52391918 AGGCTCTGGAAGCTCCCAGGAGG - Intergenic
1099371014 12:81829804-81829826 GGTCCCTGGATGCACCAGGGAGG + Intergenic
1100281285 12:93120642-93120664 GGTCTTTGGAAGGCCCCGGGGGG - Intergenic
1103688471 12:122751680-122751702 GGTCTCAGGAAGCACAGGGTTGG + Intergenic
1103740030 12:123084810-123084832 GGTCTCTGAAAGCACAGGGCTGG - Intronic
1103990660 12:124797187-124797209 GGACTCTGGAAGCTCCAGCCTGG + Intronic
1106780874 13:33057679-33057701 CTTCTCTGGAAGCTCCCTGGTGG + Intronic
1113798013 13:113069942-113069964 GATCTCAGGAAGGCCCGGGGTGG + Intronic
1115359377 14:32484368-32484390 GATCTACGGAAGCTCCAGGGTGG + Intronic
1120953230 14:90061234-90061256 GGTCTCTGGATCCTGCGCGGGGG - Intergenic
1122981939 14:105196015-105196037 GGTCTCTGGGAGCTGGTGGGAGG - Intergenic
1126689902 15:51281037-51281059 GGTCTCTGGATGCTCAGTGGGGG - Intronic
1129231107 15:74197641-74197663 GGGCCCTGGAAGATCCTGGGTGG - Intronic
1129739785 15:77984672-77984694 GGTCCCTGGAGACCCCGGGGGGG + Intronic
1129845992 15:78767967-78767989 GGTCCCTGGAGGCCCTGGGGAGG - Intronic
1130224639 15:82047281-82047303 GGTCCCTGGGAGATCCGGGAGGG - Intergenic
1130286100 15:82555915-82555937 GGTCTTTGGGAGCTTCGAGGAGG + Exonic
1132558768 16:584144-584166 GGTCCAGGGAAGCTCTGGGGGGG + Intergenic
1132779337 16:1614289-1614311 GGTCTATGGGAGCCCCGGCGCGG - Intronic
1133002509 16:2858347-2858369 GGCCTCTGGAAGGGCAGGGGAGG + Intergenic
1133627010 16:7579950-7579972 GGTCTCTGGAACCCCCAGAGCGG - Intronic
1133714099 16:8430512-8430534 GGTCTGTAGAAGCTCAGGAGCGG - Intergenic
1135596006 16:23743788-23743810 GGTCTCACGAAGCTTCGGCGTGG + Intergenic
1137036840 16:35575283-35575305 GGTCCCTAGGAGGTCCGGGGCGG - Intergenic
1138533987 16:57650097-57650119 GGCCTCTGGCCGCTCTGGGGAGG + Intronic
1138559131 16:57789527-57789549 CCTCTCTGGAAGATTCGGGGGGG + Intronic
1141927692 16:87179869-87179891 AGGCTCTGGAAACTCCGTGGGGG - Intronic
1142364042 16:89640389-89640411 GGTCCCTGGGAGCTGCTGGGAGG + Intergenic
1142856181 17:2731586-2731608 GGTCTCTGGAAGAGCCGGTGAGG - Intergenic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
1146302446 17:31700076-31700098 AGTCTCTGGAAGTTCCGTGCTGG - Intergenic
1148547062 17:48527096-48527118 GGGCTCAGGAAGCTCCGCGGCGG - Intergenic
1151685214 17:75642256-75642278 GCTCTGGGGAAGCCCCGGGGAGG - Intronic
1151920949 17:77155178-77155200 GGAGTTTGGAAGCTCCTGGGGGG - Intronic
1151960256 17:77402109-77402131 GGAGTCTGGACCCTCCGGGGTGG - Exonic
1152980958 18:275853-275875 GGTGTCTGGATGCTCAGTGGGGG + Intergenic
1153022783 18:646577-646599 GGGCTCTGGGAGTTCAGGGGAGG + Intronic
1153515291 18:5895786-5895808 GGTCTCGGGGCGCCCCGGGGCGG - Intronic
1160700004 19:501684-501706 GGTGTCGGGAGGCTCCGGGGAGG - Exonic
1160700013 19:501708-501730 GGTGTCGGGAGACTCCGGGGAGG - Exonic
1160700021 19:501732-501754 GGTGTCGGGAGACTCCGGGGAGG - Exonic
1160700029 19:501756-501778 GGTGTCGGGAGGCTCCTGGGAGG - Exonic
1163325078 19:16598364-16598386 GGGCTCTGGAAGCTCCAGGGAGG - Intronic
1163573879 19:18099256-18099278 GGTCTCTGGCCGCGCGGGGGTGG + Intronic
1163725177 19:18919303-18919325 GGCCTCCGGCGGCTCCGGGGAGG - Exonic
1163977312 19:20864485-20864507 GGTCTCCTGAAGCTTCGGTGTGG - Intergenic
1164781503 19:30896986-30897008 GGTCTCTGGAAGTGTCAGGGGGG + Intergenic
1167155571 19:47736583-47736605 GGTTTCTGGAAGCTCTGAGATGG + Intronic
1168242671 19:55095299-55095321 GGGCTCCGGCAGCTTCGGGGAGG + Exonic
1168509962 19:56966450-56966472 GGTCTTTGGAAGAGCGGGGGCGG - Intergenic
926421493 2:12704112-12704134 AGTCTCTTGAAGCTTCGAGGTGG - Intergenic
928087819 2:28356720-28356742 GGTCTCTGGGAGAGCCTGGGAGG - Intergenic
930014419 2:46960523-46960545 GGCCCCTGCAAGCTCCTGGGTGG - Intronic
931187181 2:59964477-59964499 GTTGTCTGGAAGCTCTGGGAAGG - Intergenic
931982681 2:67711216-67711238 GGTCTCTGGAAACTCCTGAAGGG - Intergenic
933646198 2:84814613-84814635 GGTCCCGGAAAGCTCCGGTGGGG - Intronic
934978729 2:98823241-98823263 GGGCTCGGCGAGCTCCGGGGTGG + Exonic
935537076 2:104307532-104307554 GGTTTCTGGAAGCTCTTGCGTGG - Intergenic
939225848 2:139363238-139363260 GGTCTCTGGAAGCACAAGGAAGG + Intergenic
948004649 2:234597247-234597269 AGTCTCTGGAAGCTCCCAGGTGG + Intergenic
1171026989 20:21639801-21639823 GCTCACTGCAAGCTCCGGAGAGG - Intergenic
1171226488 20:23445903-23445925 GAACTCTGGAAGCTCCTGGCTGG - Intergenic
1171416569 20:24985443-24985465 TGTTTCTGGAGGCTCTGGGGAGG - Intronic
1172352728 20:34255964-34255986 GGCCTCTGGAGGCTGCGGGTGGG - Intronic
1172603108 20:36197122-36197144 GGTATCTGGAAGGTCCAGGGTGG + Intronic
1173615455 20:44400533-44400555 GGTCTCTGCCTGCTCCGGGAGGG + Intronic
1173649251 20:44652307-44652329 GGTCTCTGGCTGCGCCTGGGCGG - Intergenic
1173903091 20:46605333-46605355 GGTCACAGGAAGCACAGGGGTGG - Intronic
1174792852 20:53496598-53496620 GGGCTGTGGAAGCTCAGAGGTGG + Intergenic
1179115840 21:38490986-38491008 GCTCTCTGGAAGGTCAGGGAAGG + Intronic
1180957041 22:19745846-19745868 GGGCTCTGGGAGCTCCCAGGAGG - Intergenic
1183279108 22:36922742-36922764 GGTCTCTGGGAGCCCTTGGGAGG - Intronic
1184245506 22:43233883-43233905 GCTCTCTGGGAGCCTCGGGGAGG + Intronic
1184280029 22:43432087-43432109 GGTCCCTAGCAGCTCGGGGGTGG + Intronic
1184731830 22:46374903-46374925 GGCCTCGGGAAGCACCTGGGAGG + Intronic
1185222115 22:49634303-49634325 GGTCTGTGCAAGCTCCTGGCAGG + Intronic
949543260 3:5050771-5050793 TCTCTCAGGAGGCTCCGGGGCGG + Intergenic
950788570 3:15454964-15454986 GCTCTCAAGAAGCTCAGGGGAGG - Intronic
950873068 3:16245837-16245859 TGTTTCTGCAAGCTCCAGGGAGG + Intergenic
953455995 3:43042873-43042895 CTTCCCTGGAAGCTCCAGGGAGG - Intronic
960861183 3:122154835-122154857 GGTCACTGCAAGCTCTGGGAAGG - Intergenic
961042364 3:123686438-123686460 GGTCTTGGGAAGCTTCTGGGAGG + Intronic
962713868 3:138110544-138110566 GCGCTCTGGAAGCCCAGGGGAGG - Intronic
967284757 3:187858270-187858292 GGCCCCTGGAAGCTCCGCCGGGG - Intergenic
969051509 4:4376605-4376627 GCCCTCTGAAGGCTCCGGGGAGG + Intronic
969423489 4:7110619-7110641 GGGCTCTGGAAGCCCTGGCGTGG - Intergenic
970744584 4:19279946-19279968 GTTCTGTGGAAGCCCAGGGGAGG + Intergenic
973007294 4:45028998-45029020 TCTCTCTGAAGGCTCCGGGGAGG - Intergenic
974720982 4:65737576-65737598 GGTCTCTGGATGCTCATTGGAGG - Intergenic
977818515 4:101444005-101444027 GCTCACTGCAAGCTCCGGGTAGG + Intronic
985420843 4:189783900-189783922 GGGCTCTGGAAGCTGCAGCGAGG - Intergenic
985420847 4:189783924-189783946 GGACTCTGGAAGCTGCAGGGAGG - Intergenic
985671893 5:1210993-1211015 GGGTTCTGGAAGGGCCGGGGTGG - Intronic
993899498 5:93574802-93574824 GATATTTGGAAGCTCCGGTGGGG - Intergenic
994459569 5:100054834-100054856 GATCTACGGAAGCTCCAGGGTGG + Intergenic
996303453 5:122017310-122017332 TTTCTCTGGAAGCTCCAGAGGGG + Intronic
996353991 5:122576839-122576861 GGTCTCTGGGAGATCAGGGTAGG - Intergenic
997304413 5:132827236-132827258 ATTCTCAGGAAGCTCAGGGGTGG - Intronic
997638948 5:135435869-135435891 GGTCTCTGGAGGGGTCGGGGAGG + Intergenic
998069183 5:139183405-139183427 GGTCTCTGGAAACTCCGGGGAGG - Intronic
999091357 5:148939050-148939072 TGTCTCTCGAGGCTCCTGGGAGG + Intronic
1002090420 5:176802393-176802415 GGTTTCAGCAAGCTCCGAGGGGG + Intergenic
1002397528 5:178969729-178969751 GGTCTCGGAACGCTCCGAGGTGG - Intergenic
1002599749 5:180347393-180347415 GCTGTCTGGAAGCTCTGGGTGGG - Intronic
1002858250 6:1056789-1056811 GGTCTCTGGCAGCTCCCGGAGGG - Intergenic
1006154353 6:32006240-32006262 GGTCACTGGAAGCTCTTGGGGGG + Intergenic
1006160651 6:32038967-32038989 GGTCCCTGGAAGCTCTTGGGGGG + Intronic
1015789469 6:136951918-136951940 GGTAACTGGAAGCTTCAGGGTGG + Intergenic
1018943683 6:168329449-168329471 GGGCTCAGGAAGCTGCAGGGTGG - Intergenic
1019747034 7:2706519-2706541 GGTCTCAGAAGGCTCCGTGGAGG + Intronic
1020006320 7:4785324-4785346 GTGCTCTGGAAGCTCCAGGCAGG - Intronic
1025740511 7:64192315-64192337 GCTCTCCAGGAGCTCCGGGGAGG - Intronic
1027245075 7:76361225-76361247 GCTCACTGCAAGCTCCGGAGAGG - Intergenic
1029515083 7:101018830-101018852 GGAGTCTGGAAGCTCCCGGATGG - Exonic
1034528056 7:151678549-151678571 GCCCTCTGGAAGCCCCGGGCTGG + Intronic
1035250909 7:157596286-157596308 GGTCTGTGGCAGAGCCGGGGCGG + Intronic
1035605330 8:926624-926646 GCTCTCTGGAACCGCCTGGGCGG + Intergenic
1035942844 8:3923147-3923169 GGTCTCATGAAGCTTCGGCGTGG - Intronic
1036608487 8:10329319-10329341 AGACGCTGGAAGATCCGGGGAGG - Intronic
1036707199 8:11054809-11054831 GGGCCCTGGGAGCTCCTGGGAGG + Intronic
1037931093 8:22880840-22880862 GGTCTATAGAAGCTCCTGGTGGG - Intronic
1041265011 8:56055926-56055948 GGTCTCTGGCAGCTCTAGGTGGG + Intergenic
1049755235 8:144308605-144308627 CTTCTCTGGAAGCCCTGGGGAGG + Intronic
1051329616 9:16010522-16010544 GGTCTCTGGAAGCACTGAGGGGG - Intronic
1053138235 9:35665071-35665093 GGTCTCTAGCAGCTCCCGGGCGG + Exonic
1055473817 9:76641741-76641763 GGTCTCAGGAGACTCCTGGGGGG - Intronic
1056604686 9:88076791-88076813 GGGCCCTGGAAGCTCCAGGCGGG - Intergenic
1061039506 9:128131762-128131784 GGTCCCTGGAAGCTCCAGGCTGG + Intergenic
1062359099 9:136178999-136179021 GGACTCTGGAACCTCCCGGGGGG - Intergenic
1202629694 M:6314-6336 GGTCTACGGAGGCTCCAGGGTGG - Intergenic
1186521672 X:10211979-10212001 GCTTTCTGGAAGATCCAGGGTGG + Intronic
1187820614 X:23284036-23284058 CCTCTGTGGAAGCTCTGGGGTGG + Intergenic
1189222555 X:39384770-39384792 GGTCTCAGGAAGGCCTGGGGTGG - Intergenic
1191228045 X:58066149-58066171 TGTCTCTGCAAGCACCGGGCTGG + Intergenic
1194494723 X:94600263-94600285 GGTCTCAGGAAGCTTTGGCGTGG + Intergenic
1195995317 X:110725721-110725743 GATCTCTGAAAGCTCTGGGGAGG - Intronic