ID: 902553701

View in Genome Browser
Species Human (GRCh38)
Location 1:17234401-17234423
Sequence CAACCACCTCTTGAATGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902553697_902553701 20 Left 902553697 1:17234358-17234380 CCTAGCTACAGAATCAGCATTAC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 902553701 1:17234401-17234423 CAACCACCTCTTGAATGCTTAGG 0: 1
1: 0
2: 3
3: 19
4: 144
902553695_902553701 26 Left 902553695 1:17234352-17234374 CCCAGTCCTAGCTACAGAATCAG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 902553701 1:17234401-17234423 CAACCACCTCTTGAATGCTTAGG 0: 1
1: 0
2: 3
3: 19
4: 144
902553696_902553701 25 Left 902553696 1:17234353-17234375 CCAGTCCTAGCTACAGAATCAGC 0: 1
1: 0
2: 0
3: 13
4: 138
Right 902553701 1:17234401-17234423 CAACCACCTCTTGAATGCTTAGG 0: 1
1: 0
2: 3
3: 19
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902553701 Original CRISPR CAACCACCTCTTGAATGCTT AGG Intronic
902553701 1:17234401-17234423 CAACCACCTCTTGAATGCTTAGG + Intronic
911652113 1:100401307-100401329 CAAACACTTATTGAACGCTTAGG - Intronic
912095954 1:106144123-106144145 CAAACACTACTTGAATGCTTGGG + Intergenic
916293685 1:163193333-163193355 CAAGCAGCTTTTGAATACTTTGG - Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
919473395 1:198006514-198006536 CCACCACCTCTTAGATACTTTGG - Intergenic
1064476504 10:15695869-15695891 CAATCACCTCTTTAGTCCTTTGG + Intronic
1064623625 10:17240228-17240250 AAACCACCTGTTGAGTACTTGGG + Intergenic
1065423206 10:25570589-25570611 GAAACCTCTCTTGAATGCTTTGG - Intronic
1065721722 10:28634208-28634230 CAACCACCCAATGACTGCTTGGG - Intergenic
1067966983 10:50923968-50923990 AAGTCACATCTTGAATGCTTTGG + Intergenic
1069166482 10:65166790-65166812 AAGTCACCTCTTGAATGCTGTGG + Intergenic
1071258303 10:83895200-83895222 AAACCTGCTCTTAAATGCTTTGG + Intergenic
1073967322 10:109005943-109005965 CAACTACCTCATGAATTGTTTGG - Intergenic
1076277828 10:129219602-129219624 CAACCATCTCTTAAAAGCTCTGG - Intergenic
1080106407 11:28515772-28515794 CAACCACTTCTTTAAAGCCTTGG + Intergenic
1082981825 11:59131243-59131265 AAGTCACATCTTGAATGCTTTGG - Intergenic
1085608010 11:77920411-77920433 CAAACACTTCGTGAATGCTGTGG - Intronic
1087406231 11:97734179-97734201 CAACCTGCTCTTGAATGACTTGG + Intergenic
1090166920 11:124559355-124559377 CACCCACACCTTGAATGCTTTGG + Intergenic
1090400898 11:126447582-126447604 CATTCAGCTCTTTAATGCTTAGG - Intronic
1090521282 11:127482265-127482287 AAACAACCTCTTGAATTCTCAGG + Intergenic
1090831217 11:130422035-130422057 CAACCTGCTCTTGAATGACTTGG + Intronic
1090833850 11:130439462-130439484 CAACCACAGCTTGAAAGCATTGG + Intergenic
1092045119 12:5426438-5426460 AAAGAACATCTTGAATGCTTTGG - Intergenic
1093753634 12:22829341-22829363 CTGTCACCTCTTGAATGTTTTGG - Intergenic
1094050043 12:26209307-26209329 TAAACAGTTCTTGAATGCTTGGG + Intronic
1099560427 12:84166587-84166609 AAACAATCTCTTGTATGCTTAGG + Intergenic
1099800498 12:87451307-87451329 AAGTCACCACTTGAATGCTTTGG - Intergenic
1099910985 12:88833101-88833123 AAACCACATCTGGCATGCTTAGG + Intergenic
1103485215 12:121278429-121278451 CAAACACCTGTTGGATGCTATGG + Intronic
1105297478 13:19101696-19101718 CAACCACCTTTTTATTGCCTAGG + Intergenic
1105584721 13:21733343-21733365 CAACCACCTGTTGTAGGATTAGG + Intergenic
1107365217 13:39665172-39665194 CAACCACCTTTTCAATAATTTGG + Intronic
1109252244 13:60032950-60032972 AGGCCACATCTTGAATGCTTTGG + Intronic
1110342035 13:74403016-74403038 AGGTCACCTCTTGAATGCTTTGG + Intergenic
1112725088 13:102294427-102294449 CAAACACATCCTGAATGATTAGG + Intronic
1114380445 14:22198220-22198242 AGGTCACCTCTTGAATGCTTTGG - Intergenic
1115152646 14:30302978-30303000 CAGCCACCTCTGGGATGCTGAGG - Intergenic
1116566210 14:46447414-46447436 CAAACACATCTTTAATGATTAGG - Intergenic
1118886852 14:69874556-69874578 AAACCACAGCTTGAATGCTGTGG + Intronic
1120394025 14:83944782-83944804 AAGTCACCTCTTAAATGCTTTGG + Intergenic
1123861136 15:24467860-24467882 AGGCCACATCTTGAATGCTTTGG + Intergenic
1126937638 15:53728967-53728989 CAAACCCCTATTGAATACTTGGG + Intronic
1127390693 15:58502915-58502937 CAAATACCTGTTGAATGATTAGG - Intronic
1132230924 15:100183687-100183709 CAACTACATCCTGAATACTTTGG + Intronic
1132257371 15:100387525-100387547 CGACCAGCTCTTCAATTCTTAGG - Intergenic
1133690558 16:8210489-8210511 GACCCTCCTGTTGAATGCTTAGG + Intergenic
1135005299 16:18816307-18816329 CAAACATCTCTTGAAAGCTATGG - Exonic
1135286835 16:21200881-21200903 CAATCACCTCTTGAATCTTAAGG - Intronic
1146233950 17:31139968-31139990 CAATCACCTTTTTACTGCTTAGG - Intronic
1152614887 17:81333498-81333520 CAGCCACCTCCTGCCTGCTTAGG - Intergenic
1153946287 18:10020778-10020800 CACCAACTTCTTGAAGGCTTTGG - Intergenic
1156933076 18:42668869-42668891 CAAGCATTTCCTGAATGCTTGGG + Intergenic
1158535305 18:58303121-58303143 CAACCACTTCTTGCAAGCATGGG + Intronic
1158791342 18:60784079-60784101 AGGTCACCTCTTGAATGCTTTGG - Intergenic
1162041547 19:7973922-7973944 CAACACCCTCCTCAATGCTTTGG - Intronic
1162204423 19:9045115-9045137 TACCCACCCCTTGAATGCTGTGG + Intergenic
1164850984 19:31483971-31483993 ATGCCACATCTTGAATGCTTTGG + Intergenic
1166421122 19:42637092-42637114 AAATAACCTTTTGAATGCTTTGG + Intronic
927380620 2:22475834-22475856 AAGTCACCTCTTGACTGCTTTGG - Intergenic
927549819 2:23988159-23988181 GCACTAACTCTTGAATGCTTAGG - Intronic
928742442 2:34371080-34371102 CCACCTCCTCTTGAATGGGTAGG - Intergenic
929455383 2:42061343-42061365 CAACCAAGTCTTACATGCTTCGG - Intergenic
930280511 2:49363152-49363174 AAGTCACCTCTTGAATGCTTTGG + Intergenic
935995281 2:108764676-108764698 CAACGAGCTCTTTATTGCTTGGG - Exonic
936535913 2:113311083-113311105 CTATCACCTCTTGGAAGCTTTGG - Intergenic
937041155 2:118821677-118821699 CACCCACATTTTGAAAGCTTTGG + Intergenic
939605779 2:144253696-144253718 CTGTCACCTCTTGAATGCTTTGG - Intronic
940783693 2:157959657-157959679 CTACTCTCTCTTGAATGCTTTGG + Intronic
941146345 2:161850970-161850992 CAACCTACTCCTGAATGATTTGG - Intronic
943406461 2:187493641-187493663 TAAACCCCCCTTGAATGCTTTGG + Intronic
943491290 2:188558896-188558918 AAGTCACTTCTTGAATGCTTTGG - Intronic
943877499 2:193089949-193089971 GAACCACCTCCTGTATTCTTGGG - Intergenic
946836242 2:223775534-223775556 CATCCACCTCTTGAAAGCTTTGG + Intronic
948481065 2:238250891-238250913 CTCCCACTTCTTGAATGCTCTGG + Intronic
1170354633 20:15478662-15478684 AAAACACTTCTTGAATGATTGGG + Intronic
1170671736 20:18440581-18440603 CAACCACCTGTTGCATTCTAGGG - Intronic
1170883027 20:20314171-20314193 CAGGCTCCTCTTGAATGCCTGGG - Intronic
1172510178 20:35495261-35495283 CTACCAAATCTTGAATGCTGTGG - Intronic
1173247058 20:41344249-41344271 CAACCAACTCTTGGGTGGTTTGG + Intronic
1174829147 20:53797027-53797049 CAACCAGCTCTTAAGTGCTGGGG + Intergenic
1176302653 21:5105913-5105935 CAACCCCTTCTGGAATTCTTTGG - Intergenic
1177252972 21:18620701-18620723 CAACCACCACTTGGATGTCTAGG + Intergenic
1177504424 21:22001537-22001559 AAATCACCTCTTGAAAGCTTTGG + Intergenic
1177934656 21:27329042-27329064 CACCCACTTATTGAAAGCTTTGG - Intergenic
1179854372 21:44156010-44156032 CAACCCCTTCTGGAATTCTTTGG + Intergenic
1179929325 21:44556900-44556922 CGGCCACCTCGTGAAAGCTTTGG + Intronic
1183957752 22:41392183-41392205 AAACCACCTCTAGAATTCTAAGG - Intronic
952250481 3:31648489-31648511 CAGCCACCTGTGGAATGCTTTGG - Intergenic
952881735 3:37990074-37990096 CAACCTCCTCTTGGCGGCTTAGG - Intronic
953891041 3:46751669-46751691 CAACCTCCTGTTGACTGCCTTGG - Intronic
954916028 3:54149344-54149366 CAGCCACCTCTTGGCTGCCTTGG + Intronic
956274664 3:67485092-67485114 CAGCCACCTCTGGAATTCTTAGG + Intronic
958684652 3:97377824-97377846 AAGTCACCTCTTGAAAGCTTTGG - Intronic
959206436 3:103312946-103312968 CAAAGTCCTCTTGAATCCTTTGG + Intergenic
959403631 3:105933679-105933701 CAACCACCCATTTAATGCTTTGG - Intergenic
960055443 3:113273569-113273591 CAACCACCACTCTAGTGCTTTGG + Intronic
960473135 3:118092856-118092878 CTGCTTCCTCTTGAATGCTTTGG - Intergenic
960486440 3:118258851-118258873 AGGTCACCTCTTGAATGCTTTGG - Intergenic
961036401 3:123645172-123645194 CACCCACCTCATGAACGCTGTGG - Intronic
962911910 3:139860081-139860103 CAACGGCCTCTTGATTGATTAGG + Intergenic
965915745 3:173843493-173843515 AAGTCACCTCTTGAATGCTTTGG + Intronic
967151508 3:186654547-186654569 CCACCACCTCTTCATTCCTTAGG + Intergenic
972749297 4:41972777-41972799 AAGTCACCTCTTGAATGCTTTGG - Intergenic
974215475 4:58841521-58841543 AATTCACCTCTTGAATGGTTTGG - Intergenic
979967381 4:127091379-127091401 CAACCAGCTCTTGGATTCGTTGG - Intergenic
982797641 4:159664630-159664652 AAATCATATCTTGAATGCTTTGG + Intergenic
983348576 4:166558785-166558807 AAATCACCTCTTGAACACTTTGG - Intergenic
983558074 4:169076246-169076268 CAACCTGGTCTTGAATGCCTGGG + Intergenic
984692876 4:182748459-182748481 CACCCGCCTCTTCAGTGCTTTGG + Intronic
986829384 5:11559260-11559282 CAACCATCAGGTGAATGCTTGGG + Intronic
988173018 5:27683387-27683409 AAGTCACTTCTTGAATGCTTTGG + Intergenic
989147201 5:38260596-38260618 ACACCACCTCTTAAATACTTTGG + Intronic
990190413 5:53253479-53253501 CAACCACCTCATGAAGATTTTGG + Intergenic
990252201 5:53927498-53927520 CAATCACCTCTTGAAGCCTTTGG + Intronic
992002332 5:72447913-72447935 CACCCACCACTTGTATGCCTCGG - Intronic
993098347 5:83506313-83506335 AAGTCACCTCTTGAATGCTTTGG + Intronic
993978515 5:94512549-94512571 CAAGCTGGTCTTGAATGCTTGGG - Intronic
995173474 5:109144753-109144775 CAAAAACCTCTTAAATGCTTTGG - Intronic
997363669 5:133311742-133311764 CACCCACCTCTTGAATGCCAGGG + Intronic
997559378 5:134832523-134832545 GAACCAGCTATTGAATACTTAGG + Intronic
998785861 5:145708102-145708124 CAACCACCCCAAGAGTGCTTTGG - Intronic
998846001 5:146310506-146310528 CTACCACATCTTCATTGCTTTGG + Intronic
1001949218 5:175804446-175804468 GACCCACCCCTTGTATGCTTTGG + Intronic
1003813339 6:9810396-9810418 CAACCTCCTCTGGGATGCTCAGG + Intronic
1010257421 6:73774974-73774996 CAATAGCCTCTTGAATGCCTTGG + Intronic
1011210975 6:84956261-84956283 AAGTCACCTCTTGAATGCTTTGG - Intergenic
1011443326 6:87410467-87410489 CAACTACCTCTTGATTACGTTGG - Intronic
1012164538 6:95931822-95931844 AAAACACCTCTTGTATACTTGGG + Intergenic
1012700586 6:102451857-102451879 ACATTACCTCTTGAATGCTTTGG + Intergenic
1013078383 6:106790898-106790920 CATCCACCTCTTAAATGACTTGG - Intergenic
1013236823 6:108204193-108204215 CGACCACCTATTGAGTGTTTAGG - Intergenic
1013587464 6:111592059-111592081 CAACCTCCACAGGAATGCTTCGG + Exonic
1016649668 6:146448969-146448991 AAGTCACCTCTTGAATGCTTTGG + Intergenic
1018971757 6:168534871-168534893 CAAAGACCTCTTGATTTCTTTGG - Intronic
1022161067 7:27711790-27711812 CACCTACCTCCTGAATGGTTGGG - Intergenic
1023871845 7:44267477-44267499 CAACCAGCTCCTAAATGCTTGGG + Intronic
1025895223 7:65693758-65693780 CAAACACTTCGTGAATGCTGTGG + Intergenic
1026149357 7:67774916-67774938 GAACTAACCCTTGAATGCTTTGG + Intergenic
1027996657 7:85433865-85433887 AAGTCACCTCTTGAATGCTCTGG - Intergenic
1028350714 7:89843918-89843940 CTACCTCCTCTTGACTCCTTTGG - Intergenic
1028708056 7:93874128-93874150 TTGTCACCTCTTGAATGCTTTGG - Intronic
1029278730 7:99423499-99423521 CACCAACCTCTTGCCTGCTTCGG - Intronic
1031238619 7:119210494-119210516 CTGTCAGCTCTTGAATGCTTTGG - Intergenic
1033002603 7:137523730-137523752 CAATCACAACTTAAATGCTTCGG - Intronic
1035282993 7:157788886-157788908 GAACCACCTCTCCAATGCTGGGG + Intronic
1037655882 8:20883757-20883779 TAACCACATCCTGAATGTTTAGG - Intergenic
1039304521 8:36247102-36247124 CAACCACCTCCTGAATGGTTTGG + Intergenic
1039359914 8:36864860-36864882 CAATCACATCTTGAATGTATTGG - Intronic
1044308990 8:90670966-90670988 CAGCCATCTTTTGATTGCTTAGG + Intronic
1051335586 9:16063189-16063211 AAATCACCCCTTAAATGCTTAGG - Intergenic
1056086982 9:83160492-83160514 AAGCCACCTCTTGAATGCTTTGG - Intergenic
1058905922 9:109482708-109482730 CTACCACCTCTGCAATGCTCTGG + Intronic
1059197875 9:112387946-112387968 CAGCCTGGTCTTGAATGCTTGGG - Intronic
1060886048 9:127153295-127153317 CACTCACCTCTTGATTCCTTTGG + Intronic
1187620055 X:21042515-21042537 CAACCACATCTAGAATGCCTGGG + Intergenic
1188870210 X:35363179-35363201 CAAACGCCATTTGAATGCTTTGG + Intergenic
1189025669 X:37391017-37391039 CGACCATTTCTTGAATGCTCAGG - Intronic
1193019059 X:76770147-76770169 CCTCCACCTCCTGAATACTTGGG - Intergenic
1193963617 X:87955417-87955439 CAACTTCCTCCTGAATGATTTGG + Intergenic
1194442834 X:93954283-93954305 AAGTCACCTCTTGAATGCTTTGG - Intergenic
1197819377 X:130529774-130529796 GAACCACCTCCAGAATTCTTGGG - Intergenic
1198836146 X:140806623-140806645 AAGTCACATCTTGAATGCTTTGG + Intergenic
1199535082 X:148893804-148893826 CAGCCACCTCTGGAAAGCTGGGG + Intronic
1199593677 X:149490365-149490387 CGGCCGCCTCTTGAGTGCTTTGG - Exonic
1201018370 Y:9626504-9626526 CCACCACCCCTTGAATGGCTTGG - Intergenic