ID: 902554449

View in Genome Browser
Species Human (GRCh38)
Location 1:17238749-17238771
Sequence TACCCAAGGATGGTGATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902554449_902554455 8 Left 902554449 1:17238749-17238771 CCTTTCATCACCATCCTTGGGTA 0: 1
1: 0
2: 1
3: 7
4: 150
Right 902554455 1:17238780-17238802 GCACCTGCAGATCTCTCAGCTGG 0: 1
1: 0
2: 2
3: 24
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902554449 Original CRISPR TACCCAAGGATGGTGATGAA AGG (reversed) Intronic
902317350 1:15632220-15632242 TCACCAAAGATGGTGATGATGGG + Intronic
902554449 1:17238749-17238771 TACCCAAGGATGGTGATGAAAGG - Intronic
908169325 1:61488900-61488922 CACCAAAGGGTGGTGAGGAAAGG + Intergenic
910179192 1:84462856-84462878 TAATCAAGGAGGGTGCTGAAAGG - Intergenic
918231400 1:182536441-182536463 TACCAAAGGTTGGTGAGGATGGG - Intronic
919042542 1:192410029-192410051 CACCCAAGCATGTTGATGAAGGG - Intergenic
920129851 1:203723770-203723792 TACCCAAGGATCCTGAGGAGTGG + Intronic
923315141 1:232773100-232773122 TACCCAGGGAAGGGGACGAAGGG - Intergenic
1065878009 10:30013713-30013735 TATCAAAGCATGGGGATGAACGG + Exonic
1067676348 10:48381917-48381939 CACCCAAGTATGATTATGAAGGG + Intronic
1067818762 10:49507661-49507683 TACCCCAGGGTGGGGTTGAAGGG - Intronic
1068271592 10:54734532-54734554 TACCTAGGGGTGGTGATGCAAGG - Intronic
1068316141 10:55345295-55345317 TACCCATTCATGGTGATGACTGG + Intronic
1068522910 10:58096545-58096567 TACAGAGGGATGGTGATAAAAGG + Intergenic
1068575532 10:58680136-58680158 TACACAGGAATGGTGACGAAGGG - Intronic
1073607945 10:104914925-104914947 TAGCCAAGGACAGTGATGACGGG + Intronic
1075359959 10:121822389-121822411 TAACCAAGGATGGTAGTGATGGG + Intronic
1075576720 10:123582975-123582997 TACCCAAGGATGGAAAAGGATGG + Intergenic
1080529834 11:33163797-33163819 TCCCCAAGGATTGGGATGACAGG + Intergenic
1080635833 11:34122384-34122406 TCCACAGTGATGGTGATGAATGG + Intronic
1081599562 11:44483905-44483927 CACCCAGGGATGAGGATGAAGGG - Intergenic
1085814101 11:79717335-79717357 TACCCAAGGAAACTGAAGAAGGG - Intergenic
1086151652 11:83617849-83617871 TAGCCAAGCATGGTGGTGCATGG + Intronic
1092166533 12:6346153-6346175 TCCCCAAAGATGGTGAGAAAGGG + Intergenic
1094459778 12:30683092-30683114 AAGCAAAGGATGGTTATGAAAGG + Intronic
1097183749 12:57185339-57185361 GACCCAGGGATGGGGAGGAAAGG + Intronic
1097746303 12:63307296-63307318 TACCAGAGGATGGGGGTGAAGGG + Intergenic
1099348380 12:81532428-81532450 AATCCAAGGATGGTAGTGAAAGG - Intronic
1100607468 12:96163461-96163483 TACCCAAGGATGAGCATGAGTGG + Intergenic
1101694842 12:107115399-107115421 TAACCAATGATGGTGTAGAATGG + Intergenic
1103304873 12:119956055-119956077 CAGCCAAGGAAGGAGATGAAAGG - Intergenic
1104162636 12:126194395-126194417 TACTCAAGGATGGGGAGGGAGGG + Intergenic
1105855654 13:24369684-24369706 GAACCAAGGATGGTGAAGACAGG - Intergenic
1106519129 13:30481729-30481751 TATCCAAGGCTGGTGCTCAAGGG + Intronic
1106877137 13:34086369-34086391 TACCCAAGGAGGAAAATGAAAGG - Intergenic
1107100682 13:36587520-36587542 CAACCAAGGAGGGAGATGAAAGG - Intergenic
1108108098 13:47035235-47035257 TACCCCAGGATGATGGTGCAGGG - Intergenic
1108607048 13:52050175-52050197 TACCCAAAGAAGAAGATGAAGGG - Intronic
1111068284 13:83127519-83127541 TCACAAAGAATGGTGATGAATGG - Intergenic
1114343341 14:21768684-21768706 TAACCAAAGATGGGGAAGAATGG - Intergenic
1116499333 14:45601373-45601395 TACCCAAGGGTTCTGATGGAGGG - Intergenic
1127490313 15:59456259-59456281 TATCCAAGGACGGTGGTGGATGG + Intronic
1129235521 15:74221691-74221713 GACCCAAGGATGGGGATGCTGGG + Intergenic
1129956922 15:79646870-79646892 TACCCAAAGATTATGATGGAAGG + Intergenic
1130104403 15:80918669-80918691 TACCCAGGGGTGGGGATGAAGGG + Intronic
1130520071 15:84655307-84655329 CACCCAGGGAAGGTGCTGAATGG - Exonic
1134781137 16:16896433-16896455 TACCCAAGGATGCTGAGCAAGGG + Intergenic
1135222387 16:20624085-20624107 TACCCAAGGAAGGTGAGTGAGGG - Exonic
1136065702 16:27756896-27756918 TCCACATGGATGGTGTTGAATGG - Intronic
1136100078 16:27987586-27987608 CACCCAGGGATGGCTATGAAAGG - Intronic
1137738258 16:50741317-50741339 TTCCCAAGGATGGTGAAGAAGGG - Intergenic
1137947417 16:52747297-52747319 CAACAATGGATGGTGATGAATGG + Intergenic
1138081997 16:54099622-54099644 TACATAATGATAGTGATGAATGG - Intronic
1139353630 16:66353671-66353693 GACACAAGCATGGTGAGGAAGGG + Intergenic
1139896656 16:70293156-70293178 TCCCAAAGTATGGTGATTAAAGG - Intronic
1140984673 16:80146769-80146791 TACCCGAGGAAGTGGATGAATGG - Intergenic
1144908457 17:18657945-18657967 TAGCCAGGCATGGTGATGCATGG - Intronic
1146927101 17:36752751-36752773 TAACTAAGGTTGGTGATGATAGG - Intergenic
1147431187 17:40371753-40371775 TGCCCAAGGACGGTAAAGAAGGG - Intergenic
1148590946 17:48816631-48816653 GACCCAATGATGGGGATGAAGGG + Intronic
1151616258 17:75214325-75214347 GACTGAAGGATGGTGAGGAAGGG + Intronic
1151841705 17:76623164-76623186 GACCCAAGCATTGTGATTAATGG - Intergenic
1160329355 18:77977755-77977777 GACACAGGGATGGTGAGGAATGG + Intergenic
1162479193 19:10918730-10918752 CACCCAAGGAAGCTGCTGAAAGG + Intronic
1165590145 19:36961947-36961969 TACCCAGGCATGGTGGTGCATGG - Intronic
1166523003 19:43494153-43494175 TAGCCAGGCATGGTGATGCAGGG - Intronic
925553195 2:5098403-5098425 CACCCTATGATGGTGATTAAGGG - Intergenic
925933731 2:8733035-8733057 AACCAAAGGATGGTGCTCAAAGG + Intronic
926861452 2:17314495-17314517 TACGCATGGTTGGTGATGCAGGG - Intergenic
929862870 2:45694281-45694303 TTCCCCTGGATGGTGATGAAGGG - Intronic
935899814 2:107779495-107779517 TCACCATGGATGGTGATGCATGG + Intergenic
937637857 2:124176989-124177011 TAGCCAGGCATGGTGATGCATGG - Intronic
939285907 2:140128941-140128963 TGCCCAAGGATGGTATTGATGGG + Intergenic
939971943 2:148671747-148671769 TACTCAAAGATGGTTAAGAAAGG - Intronic
942087827 2:172459779-172459801 TACCCCAGGATAGCCATGAAGGG + Intronic
944061106 2:195569513-195569535 TTCCCAATGGTGGTGCTGAATGG - Intergenic
944806517 2:203287071-203287093 TAGCCAGGGATGGTGGTGCATGG + Intronic
945885615 2:215372267-215372289 TACCCAGGGTGGGTGACGAAAGG + Exonic
947007652 2:225530432-225530454 TACCAAAGGATAGGGATAAAAGG - Intronic
947799518 2:232919992-232920014 TACACAATGATGATAATGAAGGG + Intronic
1168787940 20:556174-556196 TACCCAAGGAAGGTCAGGAGGGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170044830 20:12073822-12073844 TAGCCAAGCATGGTGGTGCATGG + Intergenic
1172152660 20:32801329-32801351 GCCCCAAGGAGGGTGATGACCGG + Exonic
1173105107 20:40126223-40126245 TGCCCTGGGATGCTGATGAATGG + Intergenic
1174972759 20:55295568-55295590 TACCAAAAGATGGTGATGACTGG - Intergenic
1181748931 22:24975792-24975814 TAGCCAAGGATGGTGCAGAGCGG + Intronic
1182735233 22:32528642-32528664 CTCCCCAGGATGGTGAAGAAGGG + Intronic
1182847999 22:33447317-33447339 TACACAAGCATGGAGATGAGGGG + Intronic
1184470675 22:44694113-44694135 TACCCAAGGACGGCCAAGAAGGG + Intronic
952385147 3:32835647-32835669 TGACCAAGGATGGTGAAGGAAGG - Intronic
954819115 3:53309616-53309638 TATCCAAGCATGGTGATGCATGG + Intronic
955203871 3:56877515-56877537 TAGCCAGGTATGGTGATGCATGG - Intronic
955858479 3:63300356-63300378 TACCCTAGGATGAAGATGATTGG - Intronic
956049290 3:65230362-65230384 TGTCTAAGGCTGGTGATGAATGG + Intergenic
956330636 3:68103078-68103100 TACCCAAGTTTGGAGATAAAGGG + Intronic
956381721 3:68671152-68671174 TATGCAAGGATGGTGAGGAGCGG - Intergenic
957090623 3:75726475-75726497 TAGCCAGGCATGGTGATGCACGG + Intronic
959328718 3:104974058-104974080 TACCAGAGGCTGGGGATGAAGGG - Intergenic
959461146 3:106627538-106627560 TACCTGAGGAAGGTGAAGAAGGG + Intergenic
962295227 3:134177554-134177576 TACCAAAGTCTGGTGATGACTGG - Intronic
962351144 3:134656584-134656606 TAGGCAAGGGTGGTGATGATAGG + Intronic
964396809 3:156254400-156254422 TTTCCCAGGATGGTGAGGAATGG + Intronic
967301304 3:188016784-188016806 TACACAATGATGGTGAGGGAGGG + Intergenic
968627406 4:1632639-1632661 GAGTCAAGGATGGTGATGAGAGG - Intronic
968635542 4:1676625-1676647 TACCCAAGGACAGGGCTGAAGGG - Intronic
975077159 4:70224823-70224845 TCCCCAGGGATGGGGATGACAGG - Intergenic
975921343 4:79393874-79393896 TAGCCAGGTATGGTGATGCATGG - Intergenic
978021621 4:103821237-103821259 TAAGAAAGGTTGGTGATGAACGG - Intergenic
985674181 5:1221776-1221798 TAGCCAGGGATGGTGAGGGAGGG - Exonic
986927290 5:12770923-12770945 TTTCCAAAGATGGTGATAAAAGG - Intergenic
989471747 5:41827623-41827645 CAGCCAAGGTTAGTGATGAATGG - Intronic
992411776 5:76512015-76512037 GACCTAAGGATACTGATGAAAGG - Intronic
994427085 5:99604001-99604023 TACCTCAGGATTGGGATGAAAGG + Intergenic
995036674 5:107542392-107542414 TAGTAAAAGATGGTGATGAAAGG + Intronic
1000042170 5:157492995-157493017 GACCCAGGGCTGGTGATGACTGG - Exonic
1001271639 5:170316982-170317004 AAAACCAGGATGGTGATGAATGG + Intergenic
1003242367 6:4355689-4355711 TTCCCAAGGGTGGTGTTTAAAGG - Intergenic
1004042554 6:11994982-11995004 ACCCCAAGGATGATGGTGAAAGG + Intergenic
1005152247 6:22765599-22765621 CACCCTTGGATGGTGAGGAAAGG - Intergenic
1006218249 6:32464898-32464920 AACCCAAGGAATGTGATGCATGG - Intergenic
1007070453 6:39033859-39033881 TCCTCAAGGAAGGTGAAGAAAGG - Intergenic
1013522930 6:110949120-110949142 TAGCCAGGCATGGTGATGCATGG + Intergenic
1015415045 6:132938829-132938851 TACACAAGGATGTAGATGGAGGG - Intergenic
1017333393 6:153225864-153225886 TATCCCAGGATGGTGGTGTATGG - Intergenic
1018896723 6:168024642-168024664 TGGCCAAGGATGGAGAAGAAAGG + Intronic
1020715116 7:11664802-11664824 TATCCATGGATGGTGTTTAAAGG - Intronic
1020762019 7:12279594-12279616 TACTCAAGTTTGGTCATGAAGGG + Intergenic
1029894696 7:103970533-103970555 CTCCCAAGGATAGTGCTGAAAGG + Intronic
1032515470 7:132503372-132503394 TGCCCCAGGAAGGTGAAGAAAGG + Intronic
1033408094 7:141090085-141090107 TATCCAAGTATGCTGATGAGAGG - Intronic
1033581661 7:142742692-142742714 TAACCAAGTATGGTTCTGAAAGG + Intergenic
1041272495 8:56122872-56122894 AACCCAAGCATGGTGGGGAAAGG + Intergenic
1042929167 8:73996561-73996583 TAGCCAGGCATGGTGATGCATGG - Intronic
1045274351 8:100688892-100688914 TAGTCAAGCATGGTGATGAGTGG + Intronic
1047885905 8:129249652-129249674 TATCCCAGCATGGGGATGAAGGG + Intergenic
1049915279 9:311508-311530 TACCCAAGGACTGGGATTAAAGG + Intronic
1051620786 9:19047909-19047931 AACCCCAGAATGGTGGTGAAAGG + Intronic
1052900372 9:33788659-33788681 TAACCAAGTATGGTTCTGAAAGG + Intronic
1055224389 9:73976649-73976671 TAGCCAAGCATGGTGGTGCATGG - Intergenic
1056373715 9:85986013-85986035 ATCCCCAGGATGGTGGTGAAGGG + Intronic
1057615044 9:96581930-96581952 TAAGGAAGGATGATGATGAAAGG - Intronic
1060724665 9:125999058-125999080 AAGCCAAGGCTGGAGATGAAGGG - Intergenic
1062029081 9:134353914-134353936 TCCCCAAGGCTGGTGGTGATGGG + Intronic
1185566450 X:1098919-1098941 TAGCCAGGTATGGTGATGCATGG + Intergenic
1186084409 X:5971233-5971255 TACCCAGGGAGGGTAATGTAGGG - Intronic
1186595159 X:10973118-10973140 GACTCAATGATGGTGAAGAAAGG + Intergenic
1187346006 X:18464722-18464744 TACCTAAGGCTGGGGGTGAAAGG + Intronic
1187934328 X:24321258-24321280 TCTCCATGGATGGGGATGAAGGG + Intergenic
1188262366 X:28036095-28036117 TCCACAAGGATGTTAATGAAGGG + Intergenic
1190868614 X:54406010-54406032 TAGCCAGGCATGGTGATGCATGG + Intergenic
1191651802 X:63546966-63546988 TACCCAATGATGGTGATTGCTGG - Intergenic
1193996576 X:88372745-88372767 TTTCCAAGTATGGGGATGAAAGG + Intergenic
1195921064 X:109984221-109984243 AACCCAAGTATCCTGATGAATGG + Intergenic
1197095414 X:122588785-122588807 AACCCAAGTATGGTTATAAATGG - Intergenic
1197390170 X:125853494-125853516 TACCAGAGGCTGGTCATGAAAGG - Intergenic
1197997245 X:132390743-132390765 TACTCATGGATGGTCATGAGAGG - Intronic
1200213321 X:154356559-154356581 CACCCAGGGATGCTGATGAGAGG - Intronic
1200213667 X:154358026-154358048 TACCTTAGGATGGTGGTGACAGG - Intronic