ID: 902554682

View in Genome Browser
Species Human (GRCh38)
Location 1:17240005-17240027
Sequence CATTGCCCCAGCGTGGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902554682_902554688 25 Left 902554682 1:17240005-17240027 CCCGGCCCCACGCTGGGGCAATG 0: 1
1: 0
2: 0
3: 31
4: 185
Right 902554688 1:17240053-17240075 AGCCTCTCATCTGAGAAGTCTGG 0: 1
1: 0
2: 0
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902554682 Original CRISPR CATTGCCCCAGCGTGGGGCC GGG (reversed) Intronic
900370372 1:2329519-2329541 CAATCCCCCACCCTGGGGCCAGG + Intronic
900486413 1:2924828-2924850 CTTGGCCCCAGCTTGGGGCCTGG - Intergenic
901255735 1:7824938-7824960 GACTGCCCCAGCGTGCAGCCTGG - Intronic
901597738 1:10398846-10398868 CATTGCCCCGGCGAGGCTCCGGG - Intronic
901924357 1:12556531-12556553 CAGAGCCCCAGCCTGGGGCCTGG - Intergenic
902554682 1:17240005-17240027 CATTGCCCCAGCGTGGGGCCGGG - Intronic
903149752 1:21398336-21398358 CATTGGCCCTGCGTGGGTCTAGG - Intergenic
903870001 1:26427033-26427055 CATTGGCCCAGAATGGGGCGGGG - Exonic
904210252 1:28882595-28882617 CTTTGCCACAGCGTGGGGCAGGG - Intergenic
905278363 1:36833553-36833575 CATTGCCCCAGCCTGGAGCAGGG - Intronic
905665348 1:39760317-39760339 CAATGCCCCGGCCTGGGGTCTGG + Exonic
911734633 1:101323685-101323707 AATGGCCCCAGTGGGGGGCCAGG - Intergenic
914985948 1:152457296-152457318 GATTGCCACAGCATGGGGCAGGG - Intergenic
915528334 1:156489611-156489633 TATTCCCCCAGCGCTGGGCCAGG - Intronic
915978999 1:160408606-160408628 CATAGCCCCAGGGTGGGGGCAGG - Intronic
917958870 1:180126725-180126747 CATTTCCCCAGCCTCTGGCCTGG + Intergenic
919744288 1:200999278-200999300 CAGTGCCCAAGTGTGGGGTCGGG - Intronic
919926684 1:202195083-202195105 CCTTGCCCCAGAGCGGGGCTGGG - Intronic
923106378 1:230857009-230857031 CACTCCCCCTGCGTGGGCCCTGG - Intronic
924384133 1:243487263-243487285 CAAGGCCCCAGGGGGGGGCCCGG - Intronic
924653092 1:245948510-245948532 CAGTGCCACAGCGTGGTCCCCGG - Intronic
1063160688 10:3416061-3416083 CATGGCCTCAGCGTGGGCCCTGG - Intergenic
1066067835 10:31775038-31775060 CCTTGCTCCAGAGTGGGGACTGG - Intergenic
1066221346 10:33337570-33337592 CAATTCCCCAGCGTGGAGACAGG + Intergenic
1067414988 10:46096027-46096049 CATTGCACCAGGGAGGGACCTGG + Intergenic
1067435034 10:46270607-46270629 CATTGCACCAGGGAGGGACCTGG + Intergenic
1067438720 10:46296390-46296412 CATTGCACCAGGGAGGGACCTGG - Intronic
1070707169 10:78648078-78648100 CTTGGCCCCATCTTGGGGCCAGG - Intergenic
1073122540 10:101131513-101131535 CCTGGCCCCACCGGGGGGCCCGG - Exonic
1073205688 10:101768188-101768210 CCTGGCCACAACGTGGGGCCAGG - Intergenic
1074786953 10:116849776-116849798 CGTTGCCGCAGCGCGGGGCGGGG - Intronic
1076765551 10:132631088-132631110 CCTTGGCCCTGCGTGGGGCTGGG - Intronic
1077147415 11:1052361-1052383 CATGGCCACAGCGTGGGGGCAGG - Intergenic
1077502760 11:2916761-2916783 CATTGCCCCAGCATCTGGGCAGG - Intronic
1077630612 11:3808731-3808753 GACTCCCACAGCGTGGGGCCCGG - Intronic
1078766202 11:14300893-14300915 CACTGCCACAGAGTGGTGCCTGG + Intronic
1079136595 11:17779134-17779156 CATCGGCCCTGCTTGGGGCCCGG + Intronic
1079352524 11:19703853-19703875 CATTGGTCCAGGGTGGGACCAGG + Intronic
1081740862 11:45439098-45439120 CATTGCCCCTTCCTGGGGCTTGG - Intergenic
1083081153 11:60094864-60094886 CATTAGCCCAGCGTGGTGGCAGG + Intronic
1083569925 11:63754403-63754425 AATTAGCCCAGTGTGGGGCCAGG + Intronic
1083638793 11:64134348-64134370 CATTCCCCCAGTGAGAGGCCAGG + Intronic
1084230134 11:67746187-67746209 CATATCCCCACAGTGGGGCCGGG + Intergenic
1084326179 11:68401474-68401496 AATTGCTCCAGGTTGGGGCCAGG + Intronic
1084541491 11:69789690-69789712 GAGTGACCCACCGTGGGGCCGGG - Intergenic
1084615153 11:70230988-70231010 CAGTGGCCCAGCTTGGGGCAGGG + Intergenic
1085042863 11:73336895-73336917 CATGGCCCCTGCATGTGGCCTGG + Intronic
1085668519 11:78439184-78439206 CATTAGCCCAGCGTGGTGACAGG - Intronic
1089605372 11:119638433-119638455 CAGGGACCCAGCTTGGGGCCAGG + Intronic
1089800762 11:121024626-121024648 CCTTGCCCCAGCGTGGGGGATGG + Intronic
1090196091 11:124817778-124817800 CTTTGTCCCATCGTGGGTCCAGG - Intergenic
1090993003 11:131837762-131837784 GGCTCCCCCAGCGTGGGGCCTGG - Intronic
1091124651 11:133083356-133083378 CACTGCCCCAGCCTGAGTCCCGG + Intronic
1091437568 12:484694-484716 CCTTGGGCCAGCCTGGGGCCAGG - Intronic
1091594177 12:1864733-1864755 CATATTCCCAGTGTGGGGCCAGG - Intronic
1093113472 12:15181017-15181039 CATTTCCCCAGCGAGGGGAGGGG - Intronic
1101632080 12:106504968-106504990 CATTTCTCCAGCCTGGGACCTGG + Intronic
1102234466 12:111285655-111285677 CATTTCCCCAGGGTGAGGCAGGG - Intronic
1102434291 12:112908718-112908740 GGTTGCCCCAGCGTGGAGCCTGG - Exonic
1103722399 12:122981822-122981844 CACTGGTCCAGCGAGGGGCCCGG - Exonic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106558884 13:30832419-30832441 CCTTGCCCCAGAGTAGGGCTGGG - Intergenic
1109802203 13:67395217-67395239 CATTAGCCCAGCGTGGCGGCGGG + Intergenic
1111968337 13:94883734-94883756 CATTAGCCCAGCGTGGTGGCAGG + Intergenic
1115776064 14:36716602-36716624 CAGTGCCCCAGAGTGGTGCCTGG - Intronic
1117521047 14:56551821-56551843 CAATGCCCCAGCCTGGGCCCAGG + Intronic
1119749636 14:77068202-77068224 GGGTGCCCCAGAGTGGGGCCGGG - Intergenic
1120066412 14:80046144-80046166 AATTAGCCCAGCGTGGGGGCAGG - Intergenic
1122072491 14:99213750-99213772 CAGTGCCCCAGAGAGGGGACAGG - Intronic
1122417620 14:101557950-101557972 CACTGCCCCAGTGCGGGGCGTGG - Intergenic
1122601641 14:102924478-102924500 CACTGCGCCAGCGAGGGGCCTGG + Intronic
1122877968 14:104677539-104677561 CACTGCCCCCGCGTGTGGCCTGG - Intergenic
1122906248 14:104802892-104802914 AATTCACCTAGCGTGGGGCCAGG - Exonic
1122930157 14:104929454-104929476 CACTGCCCTAGCGTCGGGCATGG + Intronic
1126542753 15:49840605-49840627 CATTGCCCCAGTTTGGAGCAGGG - Intergenic
1127753594 15:62068514-62068536 CATTGCCGAAGCGCGGTGCCCGG - Exonic
1127825853 15:62702139-62702161 CACCGCCCCAGCGAGGGTCCTGG - Exonic
1129016559 15:72474229-72474251 CACCGCCCCTGCGTGGAGCCCGG - Intergenic
1129425675 15:75460873-75460895 CAGTGACCCAGGTTGGGGCCTGG + Intergenic
1132710199 16:1263014-1263036 CATTGCAGGAGGGTGGGGCCCGG - Intergenic
1132886673 16:2185243-2185265 CAAGGCACCACCGTGGGGCCAGG - Intronic
1136298626 16:29318234-29318256 CATTCGCCCAGGCTGGGGCCTGG + Intergenic
1136460599 16:30407871-30407893 CTGTGCCAGAGCGTGGGGCCGGG + Intronic
1136778244 16:32882769-32882791 CATAGCCCAGGCCTGGGGCCGGG + Intergenic
1136867609 16:33769677-33769699 TACTGCCCCAGGATGGGGCCTGG + Intergenic
1136892376 16:33978745-33978767 CATAGCCCAGGCCTGGGGCCGGG - Intergenic
1138540079 16:57682595-57682617 CAGCTCCCCAGGGTGGGGCCTGG + Intronic
1141642586 16:85349861-85349883 ACTTGCCCCAGAGTGCGGCCTGG + Intergenic
1141702955 16:85650800-85650822 CATGGCCACAGCTTTGGGCCGGG - Intronic
1142060283 16:88024730-88024752 CATTCGCCCAGGCTGGGGCCTGG + Intronic
1203080666 16_KI270728v1_random:1144878-1144900 CATAGCCCAGGCCTGGGGCCGGG + Intergenic
1143082731 17:4393818-4393840 CAGTGCCTCAGCCTGGGGCCAGG - Intergenic
1143372625 17:6449790-6449812 CATGGCCCCATCCTGGGGGCAGG + Intronic
1148053142 17:44779108-44779130 CCTTGCCCCAGAGCGGGGCCGGG - Intronic
1152023547 17:77794580-77794602 CCTTGCCCCAGTGTCAGGCCTGG - Intergenic
1152641650 17:81451914-81451936 CAGAGCCCCAGCCTGGGCCCTGG + Intronic
1152762844 17:82118444-82118466 CTTTGCCCCAGCGAGGTGCGAGG + Intronic
1155159179 18:23182007-23182029 CAGTGGCCCAGCGTGCAGCCAGG + Intronic
1155990132 18:32271554-32271576 TGTTGACCCAGGGTGGGGCCTGG + Intronic
1156054258 18:32979305-32979327 AATTAGCCCAGCGTGGGGGCAGG - Intronic
1156347139 18:36267922-36267944 CAATCCCCTAGCCTGGGGCCTGG + Intronic
1157501330 18:48193043-48193065 CAAGTCCCCAGCGTGGGGCCTGG - Intronic
1157553764 18:48599177-48599199 TATTGGCCCAGGGTGTGGCCGGG + Intronic
1157619462 18:49007946-49007968 CAGCTCCCCAGCTTGGGGCCTGG - Intergenic
1158351336 18:56567474-56567496 CATAGCCCCAACCTGGGGGCAGG + Intergenic
1159460274 18:68714870-68714892 CCTGGCCCCGCCGTGGGGCCGGG - Intronic
1160905628 19:1450443-1450465 CATTTCCCCAGAGTGGGAGCTGG + Intronic
1161023265 19:2021751-2021773 GGTTGCCCCAGCCTGGGGCTGGG - Intronic
1161459963 19:4390743-4390765 CATTGCCCCGGGGTGGGGGTGGG - Intronic
1161975845 19:7607506-7607528 CCTTCCCCCACCCTGGGGCCTGG + Intronic
1165744556 19:38222853-38222875 CCTTCCCCCAGCCTGGGTCCCGG - Intronic
1167814874 19:51870831-51870853 GATTGCCCCAGCTTAGTGCCTGG - Intronic
1168407715 19:56119686-56119708 CAGTGCACCAGGGAGGGGCCAGG + Intronic
925310682 2:2879348-2879370 GACTTCCCCAGCCTGGGGCCTGG + Intergenic
925560781 2:5192341-5192363 CATTGAACCAGCGTGGAGCCAGG - Intergenic
925713150 2:6761164-6761186 CAGTGCCCCAGCAGGGGTCCAGG - Intergenic
925781101 2:7382571-7382593 CATGGCACCAGCGTGTGGCTTGG + Intergenic
927141659 2:20135171-20135193 CATGGCCCCAGGGTGGGAGCTGG - Intergenic
927472401 2:23385838-23385860 CCTGGCCGCCGCGTGGGGCCGGG + Intronic
928254294 2:29708542-29708564 GATTGCCTCAGTGTGGGGTCAGG - Intronic
932041202 2:68301741-68301763 AATTGGCCCAGCGTGGTGGCAGG + Intronic
933728403 2:85438933-85438955 CACTCCCCCAGCCTGGGCCCAGG + Intergenic
937239935 2:120453403-120453425 CACAGCCCCCGCCTGGGGCCAGG - Intergenic
937980001 2:127609251-127609273 CAGTGTCTGAGCGTGGGGCCAGG + Intronic
939952103 2:148487912-148487934 CAGTGCCCCAGCAGGGGGTCGGG + Intronic
942678321 2:178451159-178451181 CGTTGCTCCAGCGAGGGGGCAGG + Exonic
944229596 2:197379250-197379272 CATTGCCTCAGTGTATGGCCAGG + Intergenic
945295597 2:208168376-208168398 CATTACCCAAGAGTTGGGCCGGG + Intronic
945953872 2:216067057-216067079 GATTGCCCCAGCTTGCTGCCTGG + Intronic
946174073 2:217912099-217912121 CATGGGCCCAAGGTGGGGCCAGG + Intronic
947398336 2:229708315-229708337 AATTGGCCTAGGGTGGGGCCTGG - Intronic
947639080 2:231696146-231696168 CCTTGCTCCAGAGTTGGGCCTGG - Intergenic
947714620 2:232333378-232333400 CCCTTCCCCAGCATGGGGCCGGG - Intronic
947936531 2:234009480-234009502 CTTGGCCCCAGCCTGGGCCCTGG + Intronic
948162852 2:235839367-235839389 CATTGGGCCTGGGTGGGGCCCGG + Intronic
948792231 2:240385060-240385082 CAGCGCCCCACCGTGGGGCCAGG - Intergenic
949079398 2:242084769-242084791 CATGGCACCATCGTGGTGCCTGG + Intergenic
1169189975 20:3652401-3652423 CACTGGCTCAGCGTGTGGCCAGG + Intergenic
1170031300 20:11947046-11947068 TATTGCACCTGCGTGAGGCCAGG - Intergenic
1171983701 20:31644859-31644881 CATAGTCCCAGCGGGAGGCCAGG - Exonic
1173504756 20:43577985-43578007 CATTTGCCCAGCCTGGGGTCTGG - Intronic
1174133275 20:48360545-48360567 CGGGGCCACAGCGTGGGGCCTGG - Intergenic
1174269954 20:49360686-49360708 CACTGCTGCAGCTTGGGGCCAGG - Intergenic
1175601403 20:60276773-60276795 CAATGCCCCAACGTGGCTCCTGG + Intergenic
1176426727 21:6552952-6552974 CAGTGGCCCAGGGTGGGGCTGGG + Intergenic
1179702218 21:43161274-43161296 CAGTGGCCCAGGGTGGGGCTGGG + Intronic
1180076947 21:45467817-45467839 CCTTGCCCCAGCGGGGGTGCCGG + Intronic
1180862966 22:19097773-19097795 CATTGGCCCAGCCTGGGGCAGGG - Intronic
1181923549 22:26339782-26339804 CATAGCCCCAGCCTGTAGCCTGG + Intronic
1184684689 22:46090796-46090818 CATTGCCCTGCTGTGGGGCCTGG + Intronic
1185056150 22:48579303-48579325 CAGGGCCGCAGCGTGGGGTCCGG + Intronic
952159191 3:30676703-30676725 CAATTCTCCAGCGTGGGTCCGGG + Intronic
954391033 3:50267985-50268007 CTTTGCCCCAGCTGAGGGCCAGG + Intronic
955456424 3:59126604-59126626 CATTGCCCCAGGGTGGACCAAGG - Intergenic
958785718 3:98594177-98594199 GATTTCCCCAGGCTGGGGCCGGG + Intergenic
961647085 3:128398344-128398366 CACTGCCCCAGCCTCGGGACTGG - Intronic
962128057 3:132643526-132643548 CATTGCCTGAGTCTGGGGCCAGG - Intronic
962726821 3:138236591-138236613 CATTGCCCAAGTGAGGGGCAGGG + Intronic
968515923 4:1015583-1015605 CATTGCCCCTGTGTGGGGCAGGG + Intronic
968990995 4:3912331-3912353 CATATCCCCACAGTGGGGCCGGG + Intergenic
969897292 4:10317302-10317324 TAATTCCACAGCGTGGGGCCAGG + Intergenic
969938284 4:10704989-10705011 TATGGCCCAAGCGTGGGGCATGG + Intergenic
972823695 4:42731929-42731951 CTGTACCCCAGCCTGGGGCCTGG + Intergenic
973553169 4:52055681-52055703 AATTGCTCTCGCGTGGGGCCTGG - Intronic
985574811 5:669166-669188 CAGAGCCCCAGGGCGGGGCCTGG + Intronic
985575986 5:673706-673728 CACCTCCCCAGTGTGGGGCCGGG - Intronic
988413541 5:30916718-30916740 CATTGCCCCAGCGGTATGCCAGG + Intergenic
990630391 5:57662409-57662431 CATTGCCCCAGTGAGGGCCCTGG - Intergenic
991332917 5:65511808-65511830 CATGGACCCAGAGTGGGGCTGGG - Intergenic
992286042 5:75236650-75236672 CACTGTCCCAGTCTGGGGCCTGG + Exonic
999311802 5:150556223-150556245 CTTTGCCCCAGGGTGGGTGCAGG + Exonic
1001217953 5:169873598-169873620 CAGTGTCCCAGCGTGGAGCCAGG - Intronic
1002419924 5:179140128-179140150 CTGTGCCCCAGAGTGGGGCCAGG - Intronic
1002568634 5:180127937-180127959 CAGTTACCCAGCGTGGAGCCTGG - Intronic
1003795427 6:9597352-9597374 AATTGGCCCAGCGTGGTGGCAGG - Intronic
1005957027 6:30671384-30671406 CATTGCCTGACAGTGGGGCCGGG - Intronic
1010041956 6:71395266-71395288 CAGAGACCCAGAGTGGGGCCTGG + Intergenic
1010569917 6:77463920-77463942 AAGTGCCCCAGCTTGGGGCGAGG - Intergenic
1013481161 6:110553887-110553909 GATTGCCCCAGCTTGCTGCCTGG - Intergenic
1014844456 6:126258303-126258325 CACTGCCCCGCCCTGGGGCCAGG + Intergenic
1019644129 7:2120108-2120130 CATAGACCCAGTGTGGGGCGTGG - Intronic
1020131710 7:5562599-5562621 GATTGGCCCAGGGTGTGGCCGGG + Intronic
1020279731 7:6644098-6644120 CATGGCCCCTGGGTGGGGCGGGG + Intronic
1020313823 7:6890211-6890233 CATATCCCCACAGTGGGGCCGGG + Intergenic
1021640020 7:22727684-22727706 CCTTGCCCCTGCGTGTGGCCGGG + Intronic
1023850591 7:44147871-44147893 CACTGCCCCGGAGTAGGGCCTGG + Intronic
1023990694 7:45126525-45126547 CATTTCCCCAGCACTGGGCCTGG - Intergenic
1025605654 7:63038316-63038338 CACTGCCCCAACGTGGGCCAAGG - Intergenic
1026984585 7:74546824-74546846 CATGGACCCAGCGTGGGCCTTGG + Intronic
1029424938 7:100489253-100489275 CATGGCCCCACCGTGGGGGCTGG - Exonic
1030223504 7:107123661-107123683 CTTTGGCCCAGGGTAGGGCCAGG + Intronic
1032518794 7:132526892-132526914 CATTGTGCCACCGTGGGGCAGGG - Intronic
1032832470 7:135641957-135641979 AATTGCCACAGTGTTGGGCCAGG + Intronic
1035636095 8:1145380-1145402 CACTCGCCCAGCGTGGGGCCTGG + Intergenic
1036651538 8:10647060-10647082 TGCTGCCCCAGCCTGGGGCCCGG - Intronic
1036931068 8:12955881-12955903 CATTGCCACAGCCTGGGGGCTGG + Intronic
1037855354 8:22367459-22367481 CACTGCCCCAGCCTGGGGTGCGG - Intronic
1040279715 8:46033338-46033360 AAATGCCCAATCGTGGGGCCTGG + Intergenic
1045741050 8:105359667-105359689 AAATACCCCAGAGTGGGGCCGGG - Intronic
1048458061 8:134596058-134596080 CCTTGCACCAGCGTGGGGCTTGG - Intronic
1050284405 9:4086294-4086316 CATTGCCCCAGGGTGGGGTTGGG - Intronic
1053361486 9:37489917-37489939 CACAGCCCCAGCTTGGTGCCTGG - Intronic
1056661210 9:88544589-88544611 CTTTGCCCCAGCGTCGGTGCTGG - Intronic
1057887851 9:98844743-98844765 CATTGCCTCAGCTGGGGGCCAGG + Intronic
1061031731 9:128088559-128088581 CATTGCCCCAGCTTCCTGCCTGG - Intronic
1061057588 9:128232682-128232704 CTTTGCCCCATCGTGCTGCCTGG + Intronic
1061217487 9:129230167-129230189 CCAGGCCCCAGTGTGGGGCCTGG + Intergenic
1062045150 9:134421579-134421601 CATGGGCCCAGCGTGTGGCAGGG + Intronic
1185463242 X:341830-341852 CATTGCCCCTGCGAGGACCCCGG - Intronic
1185612179 X:1399219-1399241 ACTGGCCTCAGCGTGGGGCCAGG - Intergenic
1185747446 X:2584152-2584174 CATGGCCCCAGCGGGGCGCGCGG + Intergenic
1188405155 X:29798275-29798297 CATTGCCCCAGTGTGGGAGCAGG + Intronic
1189487097 X:41442416-41442438 CTTCTCCCCAGGGTGGGGCCGGG + Intergenic
1190263149 X:48811530-48811552 CATTTCCCCAGAATGGGGACAGG + Intronic
1196053786 X:111333501-111333523 CCTTGCCCTAGAGTTGGGCCAGG - Intronic
1196477981 X:116111614-116111636 CAGTACCCCAGCCTGGAGCCCGG - Intergenic
1198682454 X:139197538-139197560 GAATGCCCCAGTGTGGGGCACGG + Intronic