ID: 902558932

View in Genome Browser
Species Human (GRCh38)
Location 1:17264893-17264915
Sequence CACTTCAGCCTCCTGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 825
Summary {0: 2, 1: 3, 2: 16, 3: 126, 4: 678}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902558932_902558940 7 Left 902558932 1:17264893-17264915 CCCAGCCTCAGGAGGCTGAAGTG 0: 2
1: 3
2: 16
3: 126
4: 678
Right 902558940 1:17264923-17264945 TACTTGAGCCCAGGAGGCAGAGG 0: 39
1: 1846
2: 24218
3: 71925
4: 134909
902558932_902558938 -2 Left 902558932 1:17264893-17264915 CCCAGCCTCAGGAGGCTGAAGTG 0: 2
1: 3
2: 16
3: 126
4: 678
Right 902558938 1:17264914-17264936 TGGGAGGATTACTTGAGCCCAGG 0: 519
1: 15379
2: 47381
3: 85254
4: 130263
902558932_902558939 1 Left 902558932 1:17264893-17264915 CCCAGCCTCAGGAGGCTGAAGTG 0: 2
1: 3
2: 16
3: 126
4: 678
Right 902558939 1:17264917-17264939 GAGGATTACTTGAGCCCAGGAGG 0: 282
1: 7996
2: 21776
3: 75311
4: 137390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902558932 Original CRISPR CACTTCAGCCTCCTGAGGCT GGG (reversed) Intronic
900333964 1:2151768-2151790 CACTTCAGCCTCTGGAGTGTTGG + Intronic
900599363 1:3496531-3496553 CCCTTCAGCCCCCTCTGGCTGGG - Intronic
900616221 1:3566835-3566857 CACTGCTGCCTCCTGAGTCTGGG - Intronic
900651397 1:3731758-3731780 CAGTTCAGCATCCGGAGGCCTGG - Intronic
900694982 1:4004231-4004253 CACTGCAGGCTCCTGAGGGCGGG + Intergenic
900799207 1:4727159-4727181 CTCTTCACCCACCTGAGCCTGGG - Intronic
900919502 1:5661655-5661677 GACCTCAGCCTCCGGAGGCCCGG + Intergenic
901205019 1:7489709-7489731 CACTACAGCCTCAGGAGGGTGGG - Intronic
901230549 1:7639655-7639677 CACTTCAGCCTCCTGAGGCTGGG - Intronic
901249060 1:7759033-7759055 CACCTCAGCCTCCAGTAGCTGGG - Intronic
901263249 1:7889326-7889348 CACTTCAGCTTCCTGAGTAGCGG - Intergenic
901300599 1:8197613-8197635 CACTTCAGCCTCCCGAGTCATGG - Intergenic
901818779 1:11811998-11812020 CACCTCAGCCTCCTGAGTAGTGG - Intronic
902118978 1:14145328-14145350 CACCTCAGCCTCCTGAGAGCTGG - Intergenic
902140280 1:14347997-14348019 CACCTCAGCCTCCTGAGAGCTGG + Intergenic
902321368 1:15669418-15669440 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
902532591 1:17099849-17099871 CACATCATCCCCCTGAGCCTTGG - Intronic
902558932 1:17264893-17264915 CACTTCAGCCTCCTGAGGCTGGG - Intronic
903241135 1:21983461-21983483 CACTGCAGCCTCCTGGGCCAAGG - Intronic
903244645 1:22006639-22006661 CACTGCAGCCTCCTGGGCCAAGG - Intronic
903477677 1:23631048-23631070 CACCTCAGCCTCCTGAGTCTGGG - Intronic
903632972 1:24790780-24790802 CATTACAGCCTCCAGAGGATTGG + Intronic
903764830 1:25727511-25727533 GACTCCAGGCTCCAGAGGCTGGG + Intronic
903855329 1:26334308-26334330 TACTTCAGCCTCCTGAGACCTGG - Intronic
904027757 1:27515305-27515327 CACCTCAGCCTCCTGAGTAGAGG - Intergenic
904038907 1:27573116-27573138 CACTCCAGCCTTCTGGGGGTGGG + Intronic
904438888 1:30516956-30516978 CACCTCAGCCTCCTGAGCAATGG - Intergenic
904766581 1:32853356-32853378 TGCCTCAGCCTCCTGAGGCTGGG - Intronic
905141561 1:35849571-35849593 CACCTCAGCCTCCTGAGTAGCGG - Intronic
906230553 1:44159261-44159283 CACTTCAGCCTCCTGATAACTGG + Intergenic
906382010 1:45338877-45338899 CACCTCAGCCTCCTGTAGCTGGG + Intronic
906405840 1:45541236-45541258 CACCTCAGCCTCCTGACTATAGG - Intergenic
906465115 1:46071578-46071600 TGCCTCAGCCTCCTGAGTCTGGG - Intronic
906988565 1:50713044-50713066 CACCTCAGCCTCCTGTAGCTGGG - Intronic
907010902 1:50961779-50961801 CACCTCAGCCTCCTGAGAGTGGG + Intronic
907031880 1:51180500-51180522 CACCTCAGCCTCCTGAGTACTGG + Intergenic
907044539 1:51292068-51292090 CACTTCAGCCTCCTGACTACAGG - Intronic
907143583 1:52211589-52211611 GGCCTCAGCCTCCTGAGGCTGGG - Intronic
907177488 1:52538531-52538553 CACTTCAGCCTCCTGAGACTGGG - Intronic
907279716 1:53339640-53339662 CACCTCAGCCTCCCAAGGCTAGG + Intergenic
907392506 1:54167503-54167525 CACTTCAGCTTCCTCTGGGTGGG - Intronic
907409882 1:54276360-54276382 CACCTCAGCCTCCTCAGGCTGGG - Intronic
908085020 1:60622704-60622726 CACTCCAGCCTCCTGAGCTGAGG - Intergenic
908228984 1:62085236-62085258 CACCTCAGCCTCCTAAGGAGTGG - Intronic
908375976 1:63541676-63541698 TACCTCAGCCTCCTGAGGCTGGG + Intronic
908807618 1:67947246-67947268 GGCTGCAGCCTCCTGAGTCTGGG - Intergenic
909902086 1:81150434-81150456 CACTTCAGCCTCCAGAGTGGTGG - Intergenic
909959750 1:81825247-81825269 CACATCAGCCTCCTGAGAGTGGG - Intronic
911016092 1:93334332-93334354 CATTTCAGCCTCCCAAAGCTGGG + Intergenic
911026375 1:93439943-93439965 CACCTCAGCCTCCTGAGCAGCGG + Intergenic
911199286 1:95028319-95028341 CACCTCAGCCTCCAGTAGCTGGG + Intronic
911704760 1:100998393-100998415 TGCCTCAGCCTCCTGAGGCTGGG - Intronic
912417618 1:109520807-109520829 CGCTTCAATCTCCTGAGTCTGGG + Intergenic
913099062 1:115546305-115546327 TATTACAGCCTCCTGTGGCTAGG - Intergenic
914239878 1:145846266-145846288 CACTTTATCCTTCTGAGACTGGG - Intronic
914723360 1:150307469-150307491 CACCTCAGCCTCCTGAGTAGAGG + Intronic
915385426 1:155487479-155487501 CACCTCAGCCTCCCAAGTCTGGG + Intronic
916923507 1:169493739-169493761 CAATGCAGCCTCCTGAAGATGGG - Intergenic
916935747 1:169626545-169626567 CACTCCAGCCTGCTGAAGATTGG + Intronic
917157257 1:172016971-172016993 CACCTCAGCCTCCTGGGAATTGG + Intronic
917329085 1:173863136-173863158 CTCTTCAGCCTCTTGTAGCTAGG - Intergenic
917425073 1:174904761-174904783 TACCTCAGCCTCCTGAGTATTGG + Intronic
918190571 1:182170178-182170200 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
920143361 1:203837044-203837066 CACTTCAGCCTCCAAATGCTAGG - Intronic
920422828 1:205847129-205847151 CACCTCAGCCTCCTGTAACTAGG + Intronic
920423628 1:205854608-205854630 CACCTCAGCCTCCTGTAACTAGG - Intergenic
920982974 1:210855645-210855667 CACATGAGCCTACTGAGACTGGG - Intronic
922707476 1:227796900-227796922 CACCTCACCCTCCTGGGGTTGGG + Intergenic
922912396 1:229228592-229228614 CCCCTCAGTCTCCTGAAGCTGGG - Intergenic
924042670 1:239998274-239998296 GACATCAGCCTCCTGCGGCCCGG - Intergenic
924401672 1:243689829-243689851 CACCTCAGCATCCTGAGTATTGG - Intronic
924474424 1:244370855-244370877 CACTTAACCCTTCTGAGACTTGG + Intronic
924489885 1:244526157-244526179 CACCTCAGCCTCCCAATGCTGGG - Intronic
924543599 1:245004489-245004511 CACCTCAGCCTCCTGAGTAGCGG + Intronic
924724522 1:246656814-246656836 CACCTTAGCCTCCTGTAGCTGGG - Intronic
924769720 1:247068200-247068222 TACCTCAGCCACCTGAGTCTGGG - Intronic
924927599 1:248698085-248698107 CACTTCCTCCTGCTGACGCTGGG + Intergenic
1063412801 10:5849673-5849695 CGCTTCAGTCTCCTGAAGCTGGG + Intergenic
1063660210 10:8030318-8030340 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1063708489 10:8454219-8454241 CACCTCAGTCTCTTGAGGCCAGG + Intergenic
1063766966 10:9153384-9153406 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1064112971 10:12554269-12554291 CGCCTCAGCCTCCCGAAGCTGGG + Intronic
1064202499 10:13296709-13296731 CACCTCAGCCTCCCAAAGCTAGG - Intronic
1064647281 10:17472564-17472586 CACTTCATCCTCTTGAGACTGGG - Intergenic
1064803224 10:19099874-19099896 TGCCTCAGCCTCCCGAGGCTGGG + Intronic
1066079061 10:31911426-31911448 CACTTCAGCCTCCCGAGTAGCGG + Intronic
1066223165 10:33355888-33355910 CACTGCAGCCTCCTGCTCCTGGG + Intergenic
1066532549 10:36356247-36356269 GGCCTCAGCCTCCTGAGTCTGGG - Intergenic
1067782334 10:49217883-49217905 CACTTCAGCCTCCCTGGGCAGGG + Intergenic
1068964074 10:62894374-62894396 CTCTGCAGCCTCCTCAGGCGTGG - Intronic
1069797173 10:71060948-71060970 CAATTCAGCAAGCTGAGGCTGGG + Intergenic
1069923691 10:71833342-71833364 CACCTCAGCCTCCTGAGTACTGG - Intronic
1069927526 10:71861207-71861229 CACCTAAGCCTCCTGTAGCTGGG - Intergenic
1070089917 10:73274458-73274480 CACTTCATCTTCCTGAGACTGGG - Exonic
1070175231 10:73964352-73964374 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1070250834 10:74771690-74771712 CACTTCAGCCTTGAGAGGCTGGG - Intergenic
1070291360 10:75117306-75117328 CACCTCAGCCTCCTGAGTTCTGG - Intronic
1070293158 10:75134945-75134967 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1071464080 10:85923633-85923655 CACTTCATCCTTCTGAGTCTTGG - Intronic
1072106839 10:92282570-92282592 TGCTTCAGCCTCCTGAGTTTGGG - Intronic
1072138294 10:92567855-92567877 CACCTCAGCCTCCTGTAGCTAGG - Intronic
1072179635 10:92969102-92969124 GACTTTAGACTTCTGAGGCTAGG + Intronic
1072593201 10:96846366-96846388 CACCTGAGCCTCCTGAGGCTGGG + Intronic
1072593624 10:96850598-96850620 CACCTCAGCCTCCTGAGTATGGG + Intronic
1072736810 10:97884760-97884782 CAGTACAGCCTCCTGATGCTTGG - Intronic
1073113424 10:101076481-101076503 CACTTCTGACTCCCAAGGCTAGG - Intergenic
1073198727 10:101717303-101717325 CACCACAGCCTCCTGTAGCTGGG + Intergenic
1073551784 10:104408984-104409006 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1073882231 10:107996419-107996441 CACCTCATCCTGCTGAGGTTGGG - Intergenic
1074738861 10:116464899-116464921 CACTGCAGCTTCCTGATGCGTGG + Intronic
1074790475 10:116881575-116881597 CACTTGAGGCTGCTGCGGCTAGG + Exonic
1075514179 10:123096135-123096157 CACTTCAGCCTCTTGTGTATCGG - Intergenic
1075921413 10:126216395-126216417 CAAGTCAGCCTGCTGAGGCTTGG + Intronic
1076127632 10:127987921-127987943 GTCTTCAGGCTCCTGAGGCCAGG + Intronic
1076766313 10:132635855-132635877 GCCTCCAGCCTCCTGATGCTGGG - Intronic
1077057601 11:602564-602586 TGCCTCAGCCTCCTGAGGCTGGG - Intronic
1077221926 11:1421751-1421773 CCCTTCGGCCTCCTCAGTCTGGG - Intronic
1077359308 11:2133713-2133735 CCCTTCAGCCTCCGGGGGCTGGG - Intronic
1077504156 11:2922457-2922479 CACTTCTGCCTCCTGGTGCCCGG + Exonic
1077531572 11:3098916-3098938 CACTTCAACCTCCCAAGGCTGGG + Intronic
1078090069 11:8259560-8259582 CACTGCTGCCTGCTGAGGCCTGG - Intronic
1079239249 11:18710788-18710810 CACATCAGTCACTTGAGGCTGGG + Exonic
1079409478 11:20174019-20174041 CACTTCTGCCTTCAGAGCCTTGG - Intergenic
1079833403 11:25300375-25300397 CATTTCAGGGACCTGAGGCTGGG + Intergenic
1079833471 11:25300932-25300954 CATTTCAGGGACCTGAGGCTGGG + Intergenic
1080124214 11:28712239-28712261 CACTTCAGCCTCCCACGCCTGGG - Intergenic
1080470061 11:32536809-32536831 CACTTCAGCCTCCAAAGTATTGG + Intergenic
1080629216 11:34057967-34057989 CACTTCAGCCTCCAAAGTGTTGG + Intronic
1080735744 11:35012099-35012121 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1081898445 11:46607147-46607169 TACCTCAGCCTCCTGTAGCTGGG - Intronic
1081926981 11:46838678-46838700 CACCTCAGCCTCTAGTGGCTGGG - Intronic
1083674809 11:64319307-64319329 CTCTTCCTCCTCCTGAGGGTGGG + Intronic
1084126324 11:67101460-67101482 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1084135552 11:67177505-67177527 CACATCAGCCTGCAGAGGGTCGG + Intronic
1084350694 11:68597032-68597054 CACTTCCTCCTCCTGAGGGTGGG - Intronic
1085030878 11:73270298-73270320 GCCTTCAGCTTCCTGGGGCTTGG + Intronic
1085484806 11:76853342-76853364 CACCTCAGCCTCCAGAGTGTTGG - Intergenic
1086103455 11:83125809-83125831 CACCTCAGCCTCCTGAGTATTGG + Intergenic
1086356219 11:86002895-86002917 CACCTCAGCCTCCCAAGGGTGGG - Intronic
1086885838 11:92204778-92204800 CACTTCTCTGTCCTGAGGCTGGG + Intergenic
1087064786 11:94017925-94017947 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1087766935 11:102165244-102165266 CACCTCAGCCTCCTGAGAACTGG - Intronic
1089016106 11:115166721-115166743 CGCTTTAGGATCCTGAGGCTTGG - Intergenic
1089239470 11:117063814-117063836 CACTTCAGCTTCCCAAAGCTAGG + Intronic
1089854679 11:121532797-121532819 TGCCTCAGCCTCCTGAGTCTGGG + Intronic
1090020957 11:123127921-123127943 TGCCTCAGCCTCCTGAGTCTGGG - Intronic
1090169301 11:124584767-124584789 GACTCCTGCCTCTTGAGGCTGGG - Intergenic
1090272823 11:125399837-125399859 CACCTCAGCCCCCTCAGGGTTGG + Intronic
1090274102 11:125407649-125407671 CACCTGAGCCTCCTGAGTCATGG - Intronic
1091355932 11:134937712-134937734 CTTTTCAGGCTCCTGGGGCTGGG + Intergenic
1091415779 12:282251-282273 CACTTCAGCCTCCTGACCACAGG + Exonic
1091454514 12:596806-596828 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1092224195 12:6736131-6736153 CACTTCTGCCTCCTTGGGGTTGG - Intergenic
1092339337 12:7662149-7662171 CACTTCAGCCTTCTGAGCAGTGG - Intronic
1092393249 12:8100524-8100546 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
1092529965 12:9335967-9335989 CTCTTCAGCCTCCTGCTGCAGGG - Intergenic
1092790220 12:12064241-12064263 CACCTCAGCCTCCAGAGTATGGG + Intronic
1092898656 12:13037947-13037969 CACTTCAGCCTCCTGAGTGCTGG - Intergenic
1093642294 12:21541760-21541782 CATTTCATACTGCTGAGGCTTGG + Intronic
1094070108 12:26403502-26403524 CCCTTCAGCCTCCTGAGTAGCGG - Intronic
1095581832 12:43808694-43808716 CACATCAGCCTCCTGAGAGCTGG - Intergenic
1095696545 12:45150134-45150156 CACTGCAGCCTCCTAATCCTGGG + Intergenic
1096160454 12:49372331-49372353 CACTGTGGCCTGCTGAGGCTTGG + Intronic
1096169368 12:49454764-49454786 CACCTCAGCCTCCTGAGTCACGG - Intronic
1096287226 12:50310869-50310891 CACCTCAGCCTCTCGATGCTGGG - Intergenic
1098301625 12:69060167-69060189 CACCTCAGCCTCCCAAAGCTGGG - Intergenic
1098601311 12:72334719-72334741 AACTTCGGCCTACTAAGGCTGGG - Intronic
1098791334 12:74828024-74828046 CACCTCAGCCTCCTGAAGTGTGG - Intergenic
1099205644 12:79723121-79723143 CACCTCAACCTCCTGTAGCTGGG - Intergenic
1100229204 12:92590030-92590052 CACTTCAGCATCTTGCGACTTGG + Intergenic
1100296698 12:93269154-93269176 TGCCTCAGCCTCCTGAGTCTGGG - Intergenic
1100382715 12:94076578-94076600 CGCTTCAGCCATCTGAGGCTTGG + Intergenic
1100445723 12:94657751-94657773 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1100511710 12:95281362-95281384 TACTTCAGCCTCCTGAGTAGCGG - Intronic
1100520343 12:95368784-95368806 CACCTCAGCCTCCTGAGTGTAGG - Intergenic
1100531499 12:95465864-95465886 CACTTCAGCGTCCTGAGTACTGG - Intergenic
1100976811 12:100131195-100131217 CACTTCAGCCTCCTGAGTAGTGG - Intronic
1101095060 12:101329879-101329901 CACTTTAGCCTCCTGAGTACAGG - Intronic
1101753124 12:107599669-107599691 CACGACAGCCTTGTGAGGCTGGG + Intronic
1101926227 12:108973503-108973525 CACCTCAGCCTCCTGAGTAGGGG + Intronic
1102021749 12:109688129-109688151 GTCTTCTGCCTGCTGAGGCTGGG - Intergenic
1102101646 12:110282334-110282356 CACTTCGGGCTCCTGAACCTAGG - Intronic
1102138353 12:110594001-110594023 CACCTCAGCCTCCTGAGTACAGG + Intergenic
1102338776 12:112105203-112105225 CACCTCAGCCTCCTGAGTACTGG - Intronic
1102554918 12:113720572-113720594 CCCTGCAGCCTCCTCAGCCTTGG + Intergenic
1102569351 12:113818110-113818132 CGCCTCAGCCTCCCAAGGCTGGG - Exonic
1102569905 12:113821107-113821129 CTCTCCAGCCTCGTGAGCCTCGG - Intronic
1102922021 12:116798680-116798702 CGCCTCAGCCTCCTGAATCTGGG + Intronic
1103320981 12:120092783-120092805 ACCTCCAGCCTCCTCAGGCTTGG - Intronic
1103392721 12:120585840-120585862 CACATCAGCCTCATGAAGTTAGG + Intergenic
1103642815 12:122365893-122365915 CACCTCAGCTTCCTGAGGAGTGG - Intronic
1103739719 12:123083102-123083124 CACCACAGCCTCCTGTAGCTGGG - Intronic
1105325154 13:19364174-19364196 CACCTCAGTCTCCTGAGGCTGGG - Intergenic
1105531068 13:21220904-21220926 CACCTCAGCCTCCTGAGTGATGG - Intergenic
1105802819 13:23924021-23924043 TACTTCAGCCTCCTGAGTTGTGG + Intergenic
1106478876 13:30121823-30121845 CACTACATGCCCCTGAGGCTAGG - Intergenic
1106789323 13:33138696-33138718 CACTTCTGCCGCCTGCAGCTCGG - Intronic
1107277592 13:38693804-38693826 CACTCCAACCTCCTGATTCTTGG + Intronic
1107512939 13:41103228-41103250 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1107644626 13:42481003-42481025 TGCCTCAGCCTCCTGAAGCTGGG - Intergenic
1108287072 13:48919197-48919219 CCCTGCAGCCTCCTGAGTCTTGG - Intergenic
1109259859 13:60131320-60131342 CACATCAGCCTCCTGAGTAGCGG - Intronic
1109751851 13:66703781-66703803 CACTTCAGCCTCCTGAGTAGTGG - Intronic
1110507089 13:76299441-76299463 AACTTGAGCCTCCTGAAGTTTGG + Intergenic
1110562215 13:76921528-76921550 CACTTCAGCCTCCTGAGAGCTGG + Intergenic
1111193320 13:84837743-84837765 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1112055673 13:95688626-95688648 TGCCTCAGCCTCCTGGGGCTGGG + Intronic
1112148621 13:96730845-96730867 CACCTCAGCTTCCTGTAGCTAGG + Intronic
1113366107 13:109677394-109677416 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1113491435 13:110695166-110695188 CACTTCAGCCTCCAGAGTAGCGG - Intronic
1113746321 13:112747354-112747376 CACTGCAGCCTCCCGGAGCTTGG + Intronic
1114195919 14:20476085-20476107 CACCTCAGCCTCCTGAGTAACGG + Intronic
1114250817 14:20958942-20958964 CACTTTAGCCTACTGTGGCAAGG - Intergenic
1114928319 14:27433735-27433757 CACCTCAGCCTCCTGAGGAACGG + Intergenic
1115428258 14:33286178-33286200 CACCCCAGCCTCCTGAGTCCAGG + Intronic
1115591735 14:34872475-34872497 CACCTTAGCCTCCTGAGTGTGGG - Intronic
1115618071 14:35115274-35115296 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1116642194 14:47478487-47478509 CACCTCAGCCTCCTGAGAGCTGG + Intronic
1116843841 14:49846577-49846599 TGCATCAGCCTCCTGAGGATTGG + Intronic
1116849176 14:49891987-49892009 CACTGCAGCCTCCTCATCCTGGG - Intergenic
1118106686 14:62667948-62667970 CACTGCAGCCTCCTTATCCTGGG + Intergenic
1118267422 14:64308126-64308148 CACCTCAGCCTCCTGAGGAGCGG + Intronic
1118368183 14:65113496-65113518 CACCTCAGCCTCTTGTGGCTGGG + Intergenic
1119239236 14:73045147-73045169 CACCTCAGCCTCCTGAGGGAAGG + Intergenic
1119344740 14:73914146-73914168 CACATCAGTCTCCCGAGGCTGGG + Intronic
1119807716 14:77493109-77493131 CACTTCAGCCCCCAGTAGCTGGG + Intronic
1119845879 14:77829406-77829428 CACTTTAGCCTCCTGAGTAGTGG + Intronic
1120848699 14:89149129-89149151 CTCTTCAGCCTTTTGTGGCTCGG - Intronic
1120910943 14:89666174-89666196 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1120957146 14:90092796-90092818 CACTTCAGCCTCCTGAGTAGAGG - Intronic
1121114501 14:91334356-91334378 CACTTCAGACTCCCGAGAGTTGG + Intronic
1121313665 14:92948720-92948742 TACTTCAGCCTCCTGTGCTTGGG - Intronic
1121359920 14:93247459-93247481 TGCCTCAGCCTCCCGAGGCTGGG + Intronic
1121408898 14:93735803-93735825 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
1121691522 14:95880931-95880953 CACTTCAGCTCTCTGAGCCTGGG - Intergenic
1122084423 14:99289893-99289915 CCCTTCTGCCTCCTGGGCCTGGG - Intergenic
1122120448 14:99550631-99550653 CACTGCAGTCTCCTAAGGTTGGG - Intronic
1122164921 14:99815427-99815449 CACTGCGCCCTGCTGAGGCTTGG + Intronic
1122273689 14:100580187-100580209 TGCTTCAGCCTCCCAAGGCTGGG - Intronic
1122275655 14:100589461-100589483 CACTCCAGCCCCCTTAAGCTAGG + Intergenic
1122432109 14:101658552-101658574 CACTTCAGTCTCCTGAGTACTGG - Intergenic
1122496174 14:102157146-102157168 CACCTCAGCCTCTTGTAGCTGGG - Intronic
1122650954 14:103226846-103226868 CTATTCAGGCACCTGAGGCTGGG + Intergenic
1123654793 15:22506470-22506492 CACTTCAGCCCCCTGAGTAGTGG + Intergenic
1124649118 15:31462045-31462067 CCCTTCAGCCTGATGGGGCTTGG + Intergenic
1125445944 15:39756477-39756499 CACCTCAGCCTCCTGATGCTTGG + Intronic
1125463839 15:39932089-39932111 CCACTCAGCCTCCTGAGGGTGGG + Intergenic
1125560728 15:40631002-40631024 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1125580512 15:40782108-40782130 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1125934819 15:43626033-43626055 TGTCTCAGCCTCCTGAGGCTGGG + Intergenic
1126473579 15:49042912-49042934 TGCCTCAGCCTCCTGAAGCTGGG - Intronic
1126549640 15:49913015-49913037 CACTTCAGCGTCCTGAGTAGTGG - Intronic
1127066084 15:55240320-55240342 TACTCCAGCCTACTGAGGTTTGG + Intronic
1127370935 15:58339909-58339931 CACTTCAGCCTCCCGAAGTTCGG + Intronic
1127895340 15:63293876-63293898 CACTTCAGCCTCAAGTAGCTGGG + Intronic
1128977241 15:72162786-72162808 CTCATCAGCCTCCTCTGGCTCGG - Intronic
1129269197 15:74410607-74410629 CACTAGGGCCTCCCGAGGCTGGG - Exonic
1129330132 15:74822958-74822980 TTCTTAAGCCTCCTGAGGGTGGG - Intronic
1129457172 15:75682234-75682256 CACAGCGGCCACCTGAGGCTGGG + Intronic
1129614227 15:77085020-77085042 CACTTTATCCTCCTTTGGCTTGG - Intergenic
1129672582 15:77615533-77615555 CTCTTCAACCTCCGGACGCTGGG - Exonic
1129726610 15:77904706-77904728 CACAGCGGCCACCTGAGGCTGGG - Intergenic
1130351646 15:83097626-83097648 CACTTCAGCCTCCAGGGTCTTGG - Intergenic
1130777049 15:86995270-86995292 CACCTCAGCCTCCTGATAGTTGG - Intronic
1131033851 15:89208088-89208110 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1131443456 15:92476266-92476288 GACTTGAGCTTCCTGAGGCAGGG - Intronic
1131608761 15:93938578-93938600 CACCTCGGCCTCCAGAAGCTGGG - Intergenic
1132071524 15:98781006-98781028 CACCTCAGCCTCCTGAGAAGTGG - Intronic
1132313030 15:100870920-100870942 CACCTCTGCAACCTGAGGCTTGG + Intergenic
1132506607 16:313061-313083 CACTTCAGCCTCATGAGTGCTGG - Intronic
1132607269 16:798813-798835 CACTTCAGCAGCCTGCGGGTGGG + Exonic
1132611206 16:817157-817179 CAATGCAGCCGCTTGAGGCTGGG - Intergenic
1132758698 16:1498549-1498571 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1132773069 16:1575437-1575459 CACCTCAGCCTCCTGAGCGTGGG - Intronic
1132890653 16:2202813-2202835 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1132949882 16:2555420-2555442 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1132964466 16:2644747-2644769 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1133132056 16:3682745-3682767 CACATCAGCCCCCTGTAGCTAGG - Intronic
1133158168 16:3890355-3890377 CAAGTCAGCCTCCTGAGGCCAGG + Intergenic
1133159538 16:3901283-3901305 AGCCTCAGCCTCCTGAAGCTGGG - Intergenic
1133381983 16:5338768-5338790 CACTTTAGCCTCCTGAGTAGTGG + Intergenic
1133540487 16:6747926-6747948 AACTTCAGCATCATGAGGATTGG + Intronic
1133585164 16:7187082-7187104 CACTTTAGCCTCATGAGGTCAGG + Intronic
1134068036 16:11241964-11241986 CACCTCAGCCTCCTGGGTATTGG + Intergenic
1134317006 16:13127822-13127844 GACTTCAGCCTCCTGTGCTTGGG - Intronic
1134568663 16:15273137-15273159 CACCTCAGCCTCCTGAGCATAGG - Intergenic
1134733770 16:16483225-16483247 CACCTCAGCCTCCTGAGCATAGG + Intergenic
1134933730 16:18229057-18229079 CACCTCAGCCTCCTGAGCATAGG - Intergenic
1135020465 16:18958535-18958557 TGCTTCAGCCTCCTGTAGCTGGG - Intergenic
1135404110 16:22185853-22185875 CACTTCAGCCTCCAGAGTAGTGG + Intronic
1136036097 16:27541726-27541748 CACTTCAGCCTCAACATGCTGGG - Intronic
1136199301 16:28676867-28676889 CACTTCAGCCTCCCTAAACTGGG - Intergenic
1136589711 16:31210553-31210575 CACCTCAGCCTCCTGAGTAACGG - Intergenic
1136594314 16:31237170-31237192 CACCTCAGCCTCCTGAGTACTGG + Intergenic
1137597407 16:49734077-49734099 AACTTCTGCCTCCTGGGCCTTGG - Intronic
1139602689 16:67996150-67996172 CACTTCAGCCTCCCGAGTCTGGG + Intronic
1139964780 16:70739271-70739293 TACTGCTGCTTCCTGAGGCTGGG + Intronic
1141990895 16:87608921-87608943 CACCTCAGCCTCCTGAGTGGTGG - Intronic
1142711955 17:1728243-1728265 AGCCTCAGCCTCCTGGGGCTGGG - Exonic
1143143254 17:4755236-4755258 CATTTCAACCTCCTGAGGACAGG + Intergenic
1143177657 17:4965770-4965792 CACCTCAGCCTCCCGAGAATTGG + Intronic
1143229301 17:5338452-5338474 TGCCTCAGCCTCCCGAGGCTGGG - Intronic
1143779402 17:9221461-9221483 CCCTTCACCCTCCTGAGGCTGGG + Intronic
1144045005 17:11447541-11447563 TACTTCAGCCTCCACAGGTTTGG + Intronic
1144847493 17:18227500-18227522 CATCTCAGCCTCCTGAAGCTGGG + Intronic
1145350793 17:22081301-22081323 CACCTCAGCCTCCTGAAGGCTGG - Intergenic
1145763923 17:27444990-27445012 CACCTCAGCCTCCTGAGTAATGG + Intergenic
1146151256 17:30474650-30474672 CACTTCAGCCTCTTGAGTAGCGG + Intergenic
1147006907 17:37410628-37410650 CAGTTGAGCCACCTGGGGCTAGG + Intronic
1147591190 17:41684410-41684432 CTCCTCAGGCTCCTGGGGCTGGG + Intergenic
1148142607 17:45339152-45339174 CACCTCAGGCTCCTGAGTCTGGG - Intergenic
1148451433 17:47780783-47780805 CACTCCAGCCTCAGGAGTCTGGG - Intergenic
1148599577 17:48884025-48884047 CACCTCAGCCTCCTGAGGCCCGG + Intergenic
1149623475 17:58063287-58063309 CACTTAAGACTCCTTAGGCATGG + Intergenic
1150131398 17:62671183-62671205 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1150153348 17:62829297-62829319 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1150195542 17:63294358-63294380 CATTTCAGCCTCCTGTAGCTGGG - Intronic
1150322832 17:64230697-64230719 CACTTCACCTCCCTGAGCCTGGG + Intronic
1150332504 17:64305605-64305627 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1150631796 17:66885225-66885247 CTCTTCACCCTGCTGAGCCTCGG + Exonic
1151102559 17:71572564-71572586 AACTTCTGCCTCCTGAGTCATGG - Intergenic
1151761786 17:76108260-76108282 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1152039027 17:77891312-77891334 CACCTCAGCCTCCCAAGTCTTGG + Intergenic
1152114818 17:78378931-78378953 CATTTCTGCCTCCCGGGGCTCGG + Intronic
1152550935 17:81029796-81029818 CACCTCAGCCTCTAGTGGCTAGG + Intergenic
1152630529 17:81408832-81408854 GACTGCAGGCTCCTGAGTCTGGG + Intronic
1152742319 17:82023693-82023715 CAGGACAGCCTCCTGGGGCTCGG - Exonic
1152765104 17:82132666-82132688 CACCTCAACCTCCTGAGTCTGGG + Intronic
1152773425 17:82185034-82185056 CACATCACCATCCTGATGCTGGG - Intronic
1153004131 18:482227-482249 TGCCTCAGCCTTCTGAGGCTGGG + Intronic
1154149086 18:11891926-11891948 CACTTCAGCCTCCTGAGTAGCGG + Intronic
1155092771 18:22527440-22527462 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1155645120 18:28068163-28068185 CAAATCAGCCTCCTGAAGCAAGG + Intronic
1155954737 18:31947371-31947393 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1156205701 18:34883423-34883445 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1156324093 18:36057496-36057518 CACTTCAGCCCCCTGAGTACTGG - Intronic
1157067247 18:44366519-44366541 CATTTAAGTCTCCTGAAGCTGGG + Intergenic
1157391196 18:47304785-47304807 CACTTCAGCCACTTCAGCCTGGG + Intergenic
1157501891 18:48196527-48196549 CAAACCACCCTCCTGAGGCTAGG + Intronic
1157552293 18:48590165-48590187 GGCTTCTGCCTCATGAGGCTTGG - Intronic
1157587949 18:48817179-48817201 CGCGTCAGCCTCCCGGGGCTGGG - Intronic
1158573279 18:58614670-58614692 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1158872491 18:61701787-61701809 AGCCTCAGCCTCCTGAGTCTAGG + Intergenic
1158950141 18:62486776-62486798 CACTGCAGCCTCCTGGGCTTAGG - Intergenic
1159053250 18:63441277-63441299 GGCTTCAGCCTCCTCAGGCTGGG + Intergenic
1159063661 18:63543708-63543730 TGCCTCAGCCTCCTGAGGCAGGG + Intergenic
1159293095 18:66446850-66446872 CACCTCAGACTCATGAGGATAGG - Intergenic
1159510071 18:69386513-69386535 CACCTCAGCCTCCTAAAGTTGGG - Intergenic
1160655273 19:263623-263645 CACTTCAGCCTCTCAAGGTTGGG + Intergenic
1160693138 19:469329-469351 CACCTCAGCCTCCTAACTCTGGG + Intronic
1160886870 19:1354298-1354320 CACTGCAGCCTCCTCCTGCTGGG - Intergenic
1161118610 19:2512935-2512957 GACTGCAGCCTCCTGTGGTTGGG - Exonic
1161261973 19:3342946-3342968 CACCTCAGTCTCCTGAGTATAGG - Intergenic
1161295482 19:3517946-3517968 CACCTCAGCCTCCTGAGTCCTGG + Intronic
1161391078 19:4020706-4020728 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1161515998 19:4696983-4697005 CACCTCAGCCTCCTGAGTAGAGG - Intronic
1161694137 19:5756165-5756187 CACGTCAGCCTCCTGAGTAGCGG - Intronic
1161867069 19:6840891-6840913 CACTTCAGCCTCGAGTAGCTGGG + Intronic
1161878661 19:6931682-6931704 TGCCTCAGCCTCCCGAGGCTGGG - Intronic
1161915322 19:7224057-7224079 CACCTCAGCCTCCAGTAGCTGGG + Intronic
1161920507 19:7262173-7262195 CAAATAAGCCTCCTAAGGCTGGG + Intronic
1162579073 19:11517139-11517161 CACTTCATCTTCCTGAGCCTTGG - Intronic
1162641642 19:12014820-12014842 CACCTCAGCCTCCTAAAGCCTGG + Exonic
1162759016 19:12877351-12877373 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1163383050 19:16981245-16981267 CACTTCAGCCCCCTGAGTAGCGG - Intronic
1163471449 19:17499697-17499719 TGCCTCAGCCTCCTGAGTCTGGG - Intronic
1163486047 19:17586731-17586753 CATTTCAGCCTCCCGAGGCTGGG - Intergenic
1163706396 19:18816397-18816419 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1163757744 19:19116573-19116595 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1164223981 19:23225490-23225512 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1164611247 19:29633361-29633383 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1165196201 19:34105748-34105770 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1165241013 19:34467356-34467378 CACTTCAGCCTCCTGAGTAGCGG - Intronic
1165527143 19:36365844-36365866 CACCTCAGCCTCCTGAGTACTGG - Intronic
1165551808 19:36593287-36593309 CACCTCAGCCTCCAGAGTATCGG + Intronic
1165861115 19:38909984-38910006 CACCTCAGCCTCCTGAGAGCTGG + Intronic
1166034900 19:40161025-40161047 CACTTCAGGAGGCTGAGGCTAGG - Intergenic
1166098878 19:40559043-40559065 CACTTCAGCCTCGAGTAGCTGGG + Intronic
1166181307 19:41111132-41111154 CACCTCAGCCTCCTATAGCTAGG + Intergenic
1166199737 19:41229197-41229219 CACCTCGGCCTCCTAAGGCTGGG + Intronic
1166392519 19:42417371-42417393 TACTTCAGCCTCCTGAGTAGTGG + Intronic
1167017986 19:46854077-46854099 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1167261173 19:48459124-48459146 TGCCTCAGCCTCCCGAGGCTGGG - Intronic
1167653949 19:50751117-50751139 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1167693606 19:51001773-51001795 AATCTCAGACTCCTGAGGCTAGG + Intronic
1167756892 19:51418316-51418338 TGCCTCAGCCTCCTGAGTCTGGG + Intergenic
1167835863 19:52069185-52069207 CACCTCAGCCTCCTGAGAGCTGG + Intronic
1168622472 19:57890438-57890460 AACCTCCGCCTCCTGAGACTGGG + Intronic
925159989 2:1677004-1677026 CACATCTGCGTCCTGGGGCTCGG + Exonic
925408211 2:3622250-3622272 CACTGCAGCCTCCAGATCCTGGG - Intronic
925782768 2:7398099-7398121 CACCTCAGCCTCCAGAGGGCTGG + Intergenic
925881791 2:8358874-8358896 CACTTCAGCCTCCTGAGTAGTGG - Intergenic
925964056 2:9046721-9046743 CACCTCAGCCTCCCAAGTCTGGG + Intergenic
926024046 2:9524374-9524396 CACCTCAGCCTCCTCTAGCTGGG - Intronic
926356017 2:12041304-12041326 CACTTCAACCTGCTGAGCCTGGG - Intergenic
926518146 2:13875794-13875816 CACTTCAGCCTCCCAGTGCTGGG - Intergenic
926898940 2:17728319-17728341 CACCTCAGCCTCCTGAGAGCTGG - Intronic
927122606 2:19981629-19981651 CACCTCAGCCTCCTGAGTACTGG + Intronic
927450555 2:23205969-23205991 CACTGCAGTCTCCTGCTGCTGGG + Intergenic
927769208 2:25843686-25843708 CATCTCTGCCTCCTGAAGCTGGG - Intronic
928295651 2:30080680-30080702 CACCTCAGCCTCCTGAGTAACGG - Intergenic
929470103 2:42183039-42183061 CACCTCAGCCTCCTGATACCTGG - Intronic
929557990 2:42937354-42937376 CACTGCAGCCTTCAGAGGCAGGG - Intergenic
930859082 2:56051126-56051148 CGCTTCAGCCTCCGGTGGCAGGG + Intergenic
931852436 2:66265386-66265408 CACTGGAGTCTCCAGAGGCTGGG - Intergenic
932262213 2:70336519-70336541 CCCTTCAGCCTCCAGTAGCTGGG - Intergenic
932337829 2:70941029-70941051 CACCTCAGCCTCCTGAGAGCTGG + Exonic
932427952 2:71654975-71654997 CACCTTAGCCTCCTGTAGCTGGG - Intronic
932629539 2:73327441-73327463 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
932753498 2:74388254-74388276 CCCCTCAGCCTCCTGAGTATAGG - Intronic
932769531 2:74492814-74492836 CTCCTTAGCCACCTGAGGCTTGG - Intronic
933310589 2:80656991-80657013 TGCTTCAGCCTCCTAAGGCTGGG - Intergenic
933675246 2:85050034-85050056 CACCTCAGCCTCCTGAGTAGCGG - Intronic
934058031 2:88268992-88269014 CACCTCAGCCTCCTGAGTATCGG + Intergenic
934572075 2:95379136-95379158 CACCTCAGCCTCCTGGGGGATGG - Intronic
934696800 2:96405903-96405925 CAGTCCAGCCTCCTGGGTCTCGG - Intergenic
935077759 2:99762236-99762258 CGCCTCAGCCTCCTGAGTCCTGG + Intronic
935117079 2:100145923-100145945 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
935131065 2:100261291-100261313 CATTTCCCCCTCCTGAGTCTGGG - Intergenic
935647245 2:105349343-105349365 TGCTTCAGCCTCCTGTAGCTGGG + Intergenic
935652330 2:105392893-105392915 CACTTCAGCCTCCACATCCTAGG + Intronic
936025483 2:109028155-109028177 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
936251661 2:110872658-110872680 CCCTGCAGCCTCCTGGAGCTGGG - Intronic
936603515 2:113924181-113924203 CACCTCAGCCTCCTGAGTAGCGG + Intronic
937108004 2:119337167-119337189 CACCTCAGCCTCCTGAGTGCTGG + Intronic
937224110 2:120358288-120358310 CACACCAGTCTCCTGAGACTGGG + Intergenic
937750344 2:125469832-125469854 CACTTCAGCCTGCTGCCTCTTGG + Intergenic
937842573 2:126538391-126538413 CACATCAGTCTCCTGAGGAAAGG - Intergenic
937898053 2:126993584-126993606 TGCCTCAGCCTCCTGAGGCTGGG - Intergenic
937909552 2:127068812-127068834 CAGTTCAGCCACCTGGGGCCAGG + Intronic
937922762 2:127143522-127143544 CACCTCAGCCTCCCGGTGCTGGG - Intergenic
938041786 2:128082238-128082260 CACTTCAGCCTCTCCAGCCTGGG - Intergenic
938115078 2:128597106-128597128 CACTGGAGCTCCCTGAGGCTGGG - Intergenic
939734983 2:145833086-145833108 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
940323103 2:152398007-152398029 CGCCTCAGCCTCCCAAGGCTGGG - Intronic
940347991 2:152647100-152647122 CACCTCAGCCTCCTGAGAAGTGG - Intronic
940518469 2:154712715-154712737 CACTTCGGCCTCCTGAGTATTGG - Intronic
940922970 2:159330608-159330630 CACTACAGCCTCCGAAGTCTGGG - Intronic
940962610 2:159801771-159801793 CACTTCAGCCTCCCAAGTGTTGG - Intronic
941922735 2:170868282-170868304 CACTGCAGCCTCCAGATCCTGGG + Intergenic
941962724 2:171269583-171269605 CACTTCAGCCTCCCAAAGTTTGG + Intergenic
942360217 2:175164930-175164952 CACTGCAGCCTCCTGCTCCTAGG + Intronic
942897098 2:181070272-181070294 CTCCTCAGCCTCCTAATGCTGGG - Intronic
943145879 2:184044277-184044299 CACCTCAGCCTCCTATAGCTGGG + Intergenic
943754111 2:191540486-191540508 CACTTCAGCTTCCTGAGTGGTGG + Intergenic
944047290 2:195427739-195427761 CCCCTCAGCCTCCTGAGCCAGGG - Intergenic
944156238 2:196610571-196610593 CACTGCAGCCTCCTGCTCCTGGG + Intergenic
945048195 2:205800160-205800182 CACCTCAGTCACCTGAGGCCAGG - Intergenic
945470994 2:210227816-210227838 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
945621667 2:212147102-212147124 CACCTCAGCCTCCTGAGTAGTGG + Intronic
945930325 2:215848653-215848675 CACTTCAGCCCACTGAGTCTTGG + Intergenic
946597922 2:221326981-221327003 CACCTCAGCCTCCTGAGACGGGG - Intergenic
947463607 2:230323361-230323383 CACTGCAGCCTCCTAAGGGCTGG - Intergenic
947512499 2:230769842-230769864 CACCTCAGCCTCCCGAGTCCCGG - Intronic
947775768 2:232708074-232708096 CACCTCAGCCTCCTGAGTATAGG + Intronic
948261621 2:236608051-236608073 TGCTCCAGCCTCCTGGGGCTGGG + Intergenic
948307364 2:236959239-236959261 CACTTCAGCCTCCCGAGTATAGG + Intergenic
948810499 2:240473008-240473030 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1169052361 20:2591589-2591611 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1169131923 20:3170373-3170395 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1169133697 20:3182685-3182707 CACCTCAGCTTCCTGTAGCTGGG + Intergenic
1169217488 20:3801993-3802015 CGCTCCAGCCTCTTGAGGATGGG - Exonic
1169387420 20:5162973-5162995 CACTTTAGTCTCCAGAGCCTAGG + Intronic
1169535728 20:6537919-6537941 AACCTCAGCCTGCTGAGCCTGGG + Intergenic
1170200505 20:13738425-13738447 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1170948428 20:20912403-20912425 CACCTCAGCCTCCTGAGAAAGGG + Intergenic
1171055122 20:21899001-21899023 CACTTCTGCCACATGATGCTTGG + Intergenic
1171458101 20:25283123-25283145 GGCCTCAGCCTCCTGAGGCTGGG - Intronic
1172222405 20:33283042-33283064 GACTCCAGCTTCCTGAGGTTTGG - Intronic
1172257213 20:33529623-33529645 CATCTCAGCCTCCTGAGGTGTGG - Intronic
1172713430 20:36945147-36945169 TGCTTCAGCCTCCTGAGTGTAGG + Intronic
1172734925 20:37119352-37119374 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1173182322 20:40814638-40814660 CACTGCAGCCCCATGAGGCTGGG - Intergenic
1173292447 20:41726786-41726808 CTCTTCTGCCTGCTGAGGGTCGG - Intergenic
1173627911 20:44487326-44487348 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1173904583 20:46616812-46616834 CACCTCAGCCTTCTTAGGCTGGG + Intronic
1173963728 20:47094916-47094938 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1174585742 20:51606761-51606783 TACCTCAGCCTTCTGAGTCTGGG - Intronic
1174620774 20:51872943-51872965 CACTTTAGCTTTCTGAGCCTCGG - Intergenic
1174753495 20:53135711-53135733 CACTTCAGCCTCCAGAAGTGAGG + Intronic
1175150969 20:56933989-56934011 TACTTCAGCCTCCCAAAGCTGGG + Intergenic
1175953300 20:62595253-62595275 CACTACAGCCTTCCGTGGCTGGG - Intergenic
1176191056 20:63809847-63809869 CACTTCATCCTCCAGAGTCGCGG - Intronic
1178251782 21:31010213-31010235 CACTTCAGCCTCCTGAGTAGCGG - Intergenic
1178300290 21:31447320-31447342 CACCTCAGCCTCCTGAGAGCTGG - Intronic
1178339136 21:31770866-31770888 CACTTCAGCTCCCTGAGGCCTGG + Intergenic
1178945487 21:36943703-36943725 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1178985980 21:37303515-37303537 CACCTTGGCCTCCTGAAGCTGGG + Intergenic
1179059561 21:37966958-37966980 CACTTCAGCCTCCCGCGGCAGGG - Intronic
1180040715 21:45277922-45277944 CTCTGCAGCCACGTGAGGCTTGG + Intronic
1180083372 21:45496832-45496854 CACTTCACCTTGCTGAGCCTGGG - Intronic
1180576976 22:16786159-16786181 CACCTCAGCCTCCTAAAGGTAGG - Intronic
1181041048 22:20192771-20192793 CAGGTCCTCCTCCTGAGGCTGGG - Intergenic
1181305599 22:21915760-21915782 CCTTTGAGCCTCCTGGGGCTGGG + Intergenic
1181510748 22:23387705-23387727 CACCTCAGCCTCCTGTGTATTGG - Intergenic
1181870057 22:25891019-25891041 CACTTAGGTCTCCTAAGGCTTGG + Intronic
1182442130 22:30370789-30370811 CCCTTCAGCCTCCTCCAGCTGGG - Exonic
1182455632 22:30448419-30448441 CAGTCCTGCTTCCTGAGGCTAGG + Intronic
1182625322 22:31641564-31641586 CACCTCAGCCTCCCAAAGCTGGG - Intronic
1183280452 22:36929399-36929421 CAGTCCAGCCTCCTGAGCCCAGG + Exonic
1183516429 22:38269462-38269484 CACCTCAGCCTCCCAAAGCTTGG + Intronic
1183743437 22:39680413-39680435 CCCTGCAGCCACCTGAGGCTGGG - Intronic
1183754461 22:39747235-39747257 CTCCTCAGCCTCCCGAAGCTGGG + Intronic
1184008548 22:41729217-41729239 CATTTCAGCCTCCTGAGTAGCGG - Intronic
1184199253 22:42954507-42954529 CACTTGAGCCTTCTGAAGCTTGG + Intronic
1184399987 22:44268083-44268105 CACTTTACCCTCCTGATGTTCGG + Intronic
1185238789 22:49729704-49729726 CACCTCAGCCTCCCGAGTCACGG + Intergenic
1185272223 22:49934860-49934882 CCCTGCAGCCTCCTCAGGCCAGG - Intergenic
1185334157 22:50264064-50264086 CACAGCAGCTTCCTGAGGCTGGG - Exonic
949860734 3:8502471-8502493 TACTTCAGCCACCTGAGGACAGG - Intronic
949894946 3:8761932-8761954 CACTACTGTCTCCTGGGGCTGGG + Intronic
949898448 3:8790076-8790098 CACTTCAGTCTCCCGTAGCTGGG - Intronic
950045555 3:9946850-9946872 CAGTTCAGGCGCCTGGGGCTCGG - Exonic
950675060 3:14549730-14549752 TACTTCAGTCCCATGAGGCTGGG + Intergenic
951209996 3:19964725-19964747 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
952282178 3:31934520-31934542 TGCCTCAGCCTCCTGAAGCTGGG + Intronic
952456863 3:33480949-33480971 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
952509771 3:34041363-34041385 TGCCTCAGCCTCCTGAAGCTGGG - Intergenic
952912820 3:38204948-38204970 CACTTTAGCCTGCAGAGGCACGG + Intronic
952919092 3:38272500-38272522 CAATTCTGACTCCTGAGCCTGGG + Intronic
952965380 3:38617827-38617849 CACAGCAGTGTCCTGAGGCTGGG - Intronic
953898103 3:46819413-46819435 CACCTCAGCCTCCTGAGTACCGG - Intergenic
953946908 3:47157147-47157169 CACTTCAGCCTTCTGAGTAGCGG - Intronic
953975912 3:47381460-47381482 CACTTCCTCCTTCTGACGCTCGG + Intronic
954000883 3:47555914-47555936 AACCTCAACCTCCTGAGGCCAGG - Intergenic
954826241 3:53375972-53375994 CACCTCAGCCTCCCAAGTCTGGG - Intergenic
955151607 3:56372612-56372634 CACCTCAGCCTCCTGAGTAGCGG - Intronic
955392548 3:58531872-58531894 CAACCCAGCCTCCTGGGGCTGGG + Intronic
955835331 3:63048236-63048258 CACCTCAGCCTCCTGAGTGCTGG - Intergenic
956118450 3:65941903-65941925 CACCTCAGCCTCCTGAAGCTGGG + Intronic
956217172 3:66860614-66860636 CACTTCAGCCTCCTGAGTAGCGG + Intergenic
956464607 3:69506647-69506669 TGCCTCAGCCTCCTGAGTCTGGG + Intronic
956506940 3:69951209-69951231 CACCTCAGCCTCCCGTAGCTGGG + Intronic
957803683 3:85119161-85119183 CACCTCAGCCTCCCAAGGGTTGG - Intronic
958572701 3:95909236-95909258 CACTACAGCTTCCTGAAGCCCGG + Intergenic
958786545 3:98602869-98602891 TGCTTCAGCCTCCTGAAGCTGGG - Intergenic
959171552 3:102849735-102849757 CACTTCAGCCTCCAGAGTAGCGG + Intergenic
959302063 3:104615446-104615468 CACTTCAGCCTCCTGATAGCTGG + Intergenic
960037111 3:113112916-113112938 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
960623038 3:119654514-119654536 CACTACAGCCTTCTGAGGAGGGG - Exonic
960732268 3:120740373-120740395 CACCTCAGCCTCCTGAGTAGCGG + Intronic
961184124 3:124899738-124899760 CACTTCAGCCTCCTGAGTGGTGG - Intronic
961256591 3:125559707-125559729 CACCTCAGCCTCCTGAGTTGGGG + Intronic
961330859 3:126137109-126137131 CTCCTCAGCCTCCTTAGGGTGGG + Intronic
961648706 3:128406697-128406719 CACCTCAGCCTCCTGAGTAGTGG - Intronic
962181052 3:133206874-133206896 CACTTAAGTCTGCTGAAGCTGGG + Intronic
962370991 3:134820517-134820539 CTTTTTAGCCTCCAGAGGCTGGG + Intronic
962445393 3:135459354-135459376 CACTTCAGCATCTTGTGGATGGG - Intergenic
962755813 3:138464808-138464830 AACTTCAGGCTCCTGATGTTTGG - Intronic
962791777 3:138817836-138817858 CACTTCAGCCTCTGGTGACTCGG - Intronic
963040814 3:141068519-141068541 CACATCAGACTCCAGAGCCTTGG - Intronic
963131519 3:141862669-141862691 CACTTCAGTCTCTTGAGTCCAGG - Intergenic
963791122 3:149583450-149583472 TGCCTCAGCCTCCCGAGGCTGGG + Intronic
963825355 3:149947478-149947500 CACTGCAACCTCCTGCCGCTGGG + Intronic
963926610 3:150957770-150957792 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
964494373 3:157272531-157272553 CACTGCAGCCTCCAGATCCTGGG + Intronic
965096346 3:164232145-164232167 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
965379160 3:167966943-167966965 CACTTCAGTCTGCAGAGGTTCGG - Intergenic
965382366 3:168005829-168005851 CTCTTCTGACTCCTGAGTCTGGG - Intergenic
965435563 3:168646615-168646637 CACTGAAGGCACCTGAGGCTAGG + Intergenic
965801836 3:172502474-172502496 CACCTCAGCCTCCTGAGTCATGG + Intergenic
966964677 3:184978646-184978668 CACCTCAGCCTCCCAAAGCTGGG + Intronic
966994075 3:185263195-185263217 CACTTCAGCAGTCTGAGGCGGGG - Intronic
967019594 3:185511144-185511166 CACCTCAGCCTCCTGAGTAGTGG + Intronic
967202370 3:187083388-187083410 CACCTCAGCCTCCTAAGTATCGG - Intergenic
968058027 3:195707999-195708021 CACTTCAGCTTCCTGCGTCTGGG + Intergenic
968296718 3:197582128-197582150 CATTTCTGCTCCCTGAGGCTGGG + Intergenic
968653710 4:1769882-1769904 CCCTTCAGCCCCCCGAGGCAGGG + Intergenic
969263050 4:6045754-6045776 TGCTTCAGCCTCCTGCAGCTGGG - Intronic
969357058 4:6634734-6634756 TGCTTCAGCCTCCTGTAGCTGGG - Intergenic
969432499 4:7163936-7163958 TGCCTCAGCCTCCTGAGTCTGGG - Intergenic
970115041 4:12685550-12685572 CACATCAGAATCCTCAGGCTGGG - Intergenic
971349762 4:25845380-25845402 CACCTCAGCCTCCTGAGTAGCGG - Intronic
971750275 4:30638242-30638264 TGCTTCAGCCTCCTGAAGCTGGG - Intergenic
971762872 4:30790807-30790829 CACCTCAGCCTCCTGAGAGCTGG - Intronic
972150442 4:36082967-36082989 CCCTCCAGCTTCCTGATGCTTGG - Intronic
972665659 4:41162739-41162761 CACCTCAGCCTCCTGAGTGCTGG - Intronic
972751386 4:41992225-41992247 CACCTCAGCCTCCTGAGTACAGG - Intronic
973742126 4:53928086-53928108 AGCTTCAGACTCCTGAGCCTGGG + Intronic
973896751 4:55421412-55421434 CACCTCAGCCTTCTGAGTCTGGG + Intronic
974511561 4:62848993-62849015 CACTTCATGCTGCTGAGCCTTGG - Intergenic
974942333 4:68484418-68484440 CACTTCAGTCTCCTGAGTAGCGG + Intronic
975142807 4:70935755-70935777 AACTTCTGCCTCCTGAGCTTAGG + Intronic
975872067 4:78790759-78790781 CATCTCAGCCTCCTGAGGTGTGG - Intronic
976293933 4:83450850-83450872 CACTTCAGCCTCCCAAGTCGTGG - Intronic
976610365 4:87024702-87024724 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
976725290 4:88210301-88210323 CACCTCAGCCTCCAGTGGCTGGG + Intronic
976753220 4:88471587-88471609 CACCTCAGCCTCCTGGTGTTGGG + Intronic
977199276 4:94096756-94096778 CACCTCAGCCTCCTGGGGCCTGG + Intergenic
977582110 4:98736446-98736468 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
977599747 4:98923427-98923449 CATTTCAGCCTCCTGAGGCTAGG + Intronic
977783093 4:101002037-101002059 CACTGCAGCCTCCTGCCTCTAGG + Intergenic
977900624 4:102418120-102418142 CACCCTAGCCTCCTGAGGCTGGG - Intronic
978850032 4:113323871-113323893 CACTAAAGCATCCTGAGGCAAGG - Intronic
979512276 4:121567856-121567878 CACTTAAGTCTGCTGAAGCTGGG - Intergenic
979786501 4:124721744-124721766 CACCTCAGCCTCCTGAGAGCTGG + Intergenic
982027371 4:151264180-151264202 CACCTCAGCCTCCCAAAGCTGGG - Intronic
982116948 4:152105766-152105788 CACTTCAGCCTCCTGAGTAGCGG - Intergenic
982776626 4:159448435-159448457 CACTTCAGCCTCCACATACTGGG - Intergenic
982828382 4:160028101-160028123 CACTTCAGCCTGCTGTGGTGAGG + Intergenic
983265375 4:165502291-165502313 CACCTCAGCCTCCTGTAGCTAGG + Intergenic
983281815 4:165690391-165690413 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
984612673 4:181858198-181858220 CACCTCAGCCTCCTGAATTTTGG + Intergenic
984799115 4:183696643-183696665 CACCTCAGCCTCCCAAAGCTGGG + Intronic
985681058 5:1256122-1256144 CACTTCAGCCTCCCAAGTATTGG + Intronic
986328915 5:6703118-6703140 CACTGCAGCCTCCTGAGCCTGGG + Intergenic
986378498 5:7159415-7159437 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
987655424 5:20800169-20800191 CACTTTTGCCTCCTGGGTCTCGG - Intergenic
988578743 5:32450685-32450707 TACCTCAGCCTCCTGTAGCTGGG - Intergenic
988768134 5:34403733-34403755 CACTTTTGCCTCCTGGGTCTCGG + Intergenic
988842303 5:35094939-35094961 CACCTCAGCCTCCTGAGTAGTGG + Intronic
990316167 5:54585176-54585198 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
991017245 5:61945309-61945331 GAGGCCAGCCTCCTGAGGCTGGG - Intergenic
992042838 5:72853325-72853347 CACCTCAGCCTCCTGAGTAGCGG - Intronic
992075682 5:73190752-73190774 CACACCAGCCTCCTGTGACTAGG + Intergenic
992732315 5:79684368-79684390 CACCTCAGCCTCCTGAGTGCTGG + Intronic
992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG + Intergenic
992810972 5:80388191-80388213 CACCTCAGCCTCCTGTAGCTAGG - Intergenic
992863213 5:80933016-80933038 CATCTCAGGCTCCTGAGGATAGG + Intergenic
993157507 5:84244390-84244412 CATTTCAGCCTCCTGAGTAGCGG + Intronic
993996021 5:94724357-94724379 CACTTCAGCCTCTTGAGTAGCGG + Intronic
994092309 5:95820235-95820257 CACCTCAGCCTCCCGTGGCTGGG - Intronic
995464957 5:112441946-112441968 CACTGCAGCCTGCTGGGGGTTGG + Intergenic
995502912 5:112828147-112828169 CACTTCAGCCTCTCGAGGCTGGG + Intronic
995576808 5:113545494-113545516 CACCTCAGCCTCCAGAGCTTTGG + Intronic
995741774 5:115363534-115363556 CACTGCAGTCTGCTGAGGCAAGG - Intergenic
996529842 5:124517028-124517050 AACTGCACCATCCTGAGGCTGGG + Intergenic
997624947 5:135325188-135325210 GGCTTCAGCCACCTGAGGCCAGG - Intronic
997708420 5:135981212-135981234 CACCTCAGCCTCCTGAGTGCTGG + Intergenic
998076080 5:139237508-139237530 CACCTCAGCCTCCTGAGTAGCGG + Intronic
998221017 5:140279575-140279597 CGCTTCAGCCTCCCGTAGCTGGG + Intronic
998403336 5:141859592-141859614 GACATCAGCCTTCTGAGTCTGGG - Intronic
998558799 5:143151840-143151862 TGCCTCAGCCTCCTGAGCCTGGG - Intronic
998968979 5:147570700-147570722 CACTGCAGCCTCCTGAGTAGCGG - Intergenic
999387881 5:151168167-151168189 CACTTCAGCTTCCTGAGTATTGG - Intergenic
999999827 5:157127140-157127162 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1000169494 5:158687893-158687915 CACTTCATCTTACTGATGCTGGG - Intergenic
1000308094 5:160014587-160014609 CACCTCAGCCTCCTGAGTGGTGG - Intronic
1000312961 5:160062690-160062712 CACATCAGACTCCTGAGGAGGGG - Intronic
1001394381 5:171405011-171405033 CACTACAGCCTCCAGCTGCTGGG + Intronic
1001421082 5:171587704-171587726 CACTTCAGCCTCCTGTGTAGTGG - Intergenic
1001605119 5:172954317-172954339 CACCTCAGCCTCCCGGTGCTGGG - Intergenic
1001808053 5:174605821-174605843 CACCTCAGCCTCCTAAGTGTTGG - Intergenic
1001819938 5:174702567-174702589 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
1002329747 5:178433238-178433260 CACGACCGCCTCCTCAGGCTCGG + Intronic
1002542218 5:179913783-179913805 CACACTAGCCTCCTGAGGCCTGG - Intronic
1004420516 6:15465335-15465357 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1004516062 6:16323268-16323290 CGCCTCAGCCTCCTAAAGCTGGG - Intronic
1004871334 6:19907395-19907417 AACTTTAGAATCCTGAGGCTTGG - Intergenic
1004957682 6:20748238-20748260 CACTTCAGCCTCTTGAGTTGCGG - Intronic
1004976675 6:20974863-20974885 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1005054876 6:21720120-21720142 TGCCTCAGCCGCCTGAGGCTGGG - Intergenic
1005103735 6:22200972-22200994 CACCTCAGCCTCCCAAAGCTAGG + Intergenic
1006541882 6:34746652-34746674 CACTTCAGGGCCCTGAGGTTTGG + Intergenic
1006963732 6:37960959-37960981 CACCTCAGCCTCCTGACTATAGG - Intronic
1006992497 6:38227505-38227527 CCCTTCCGCCTGATGAGGCTGGG + Intronic
1007485900 6:42180459-42180481 CACCTTAGCCTCCTGAGTATTGG - Intergenic
1007826660 6:44605903-44605925 CACTTAGGCCTTCTGAGGATTGG + Intergenic
1008381488 6:50843198-50843220 CACTTCAGCCTCATCACGCACGG + Exonic
1008758884 6:54830490-54830512 CACCTCATCCTCATGATGCTTGG + Intergenic
1009823815 6:68840470-68840492 AACTTCTGCCTCCTGGGCCTAGG + Intronic
1010173745 6:73002007-73002029 CACCTCAGCCTCCTGAGAGCTGG - Intronic
1010685242 6:78846800-78846822 CACTTCAGCCTGCAGTTGCTTGG - Intergenic
1010807723 6:80258633-80258655 CACATCAGCAACCTGGGGCTGGG - Intronic
1012082365 6:94776966-94776988 CACTGCATCCTCTTGAAGCTGGG + Intergenic
1013354285 6:109333581-109333603 AACCTCAGCCTCCTGAAGCTAGG + Intergenic
1014401569 6:120996596-120996618 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1014898503 6:126933539-126933561 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1015388763 6:132656124-132656146 AACTGCAGCCTCTGGAGGCTGGG - Intergenic
1016412077 6:143793839-143793861 CACTGCAGCCTCCTGCTCCTGGG - Intronic
1016798702 6:148146146-148146168 TACTTCAGCCTCCTGAGTGGCGG - Intergenic
1018345253 6:162892870-162892892 CACCTCAGCCTCAGGAGCCTCGG + Intronic
1018345264 6:162892910-162892932 CACCTCAGCCTCAGGAGCCTCGG + Intronic
1018345274 6:162892953-162892975 CACCTCAGCCTCAAGAGCCTCGG + Intronic
1018345286 6:162892996-162893018 CACCTCAGCCTCAGGAGCCTCGG + Intronic
1018345297 6:162893036-162893058 CACGTCAGCCTCAGGAGCCTCGG + Intronic
1018658066 6:166059164-166059186 CATTTCAGACTGCTGAAGCTTGG - Intergenic
1019334033 7:474485-474507 CACTCCAGCACCCTGAGACTGGG + Intergenic
1019780412 7:2936647-2936669 CACTTCAGCCTCCTGGGTAGCGG - Intronic
1019807879 7:3141931-3141953 CACCTCAGCCTCCTGAGGCTGGG - Intronic
1019969302 7:4527386-4527408 CACTTCAGCCTCCTCAGCCTTGG + Intergenic
1020014434 7:4822591-4822613 AGATTCAGCCTCCTGAGGGTCGG - Intronic
1021745089 7:23732195-23732217 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1023050878 7:36250106-36250128 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1023058634 7:36309480-36309502 TACTCCAGACACCTGAGGCTGGG - Intergenic
1023297972 7:38736413-38736435 CACTTCAGCTTTCTGGAGCTTGG - Intronic
1023356472 7:39371989-39372011 CACTTCAGCCTCCAAATTCTGGG + Intronic
1023916801 7:44596073-44596095 CACTTCAGCCTACTGCCTCTTGG + Intergenic
1023971721 7:44996549-44996571 CACTTCAGCCTCCCAAGTATTGG - Intergenic
1024960523 7:54969926-54969948 CCCATCAGCCTGCTGAGGGTGGG + Intergenic
1025970029 7:66314397-66314419 CACCTCAGCCTCCTGCAGCTGGG - Intronic
1026150011 7:67779971-67779993 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1026888743 7:73969887-73969909 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1027245307 7:76363101-76363123 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1027872933 7:83732412-83732434 GACGTCAGCGTCCTTAGGCTAGG + Intergenic
1027970370 7:85072802-85072824 GACTTCATCCTCCTGAGTATTGG + Intronic
1028759570 7:94480473-94480495 CACCTCAGCCTCCTGAGTAATGG + Intergenic
1028759816 7:94483460-94483482 CACCTCAGCCTCCTGAGTAATGG + Intergenic
1028926016 7:96357870-96357892 CACCTCAGCCTCCGGAAGCTGGG + Intergenic
1029155260 7:98512887-98512909 CACGTCAGCCTCCTGAGGTATGG + Intergenic
1029194783 7:98797668-98797690 CACTGCAGCCTCCTGCTCCTGGG + Intergenic
1029218450 7:98969470-98969492 CACTTCAGCTCCTTGAGGCAGGG + Intronic
1029498576 7:100912642-100912664 CACCTCAGCCTCCCAATGCTGGG - Intergenic
1030014168 7:105201729-105201751 CATCTCAGCCTCCTGAGTCTTGG - Intronic
1030014176 7:105201768-105201790 CATCTCAGCCTCCTGAGTCCTGG - Intronic
1030361759 7:108602645-108602667 CACTTCAGCCTCCTGAGTACAGG + Intergenic
1030497963 7:110323523-110323545 CACATCAGCCTCCTGAGTATGGG + Intergenic
1030681015 7:112433931-112433953 CACTTCAGCCTCCTGAGTAGCGG + Intronic
1030683042 7:112452274-112452296 CTCCTCAGCCTCCTGTAGCTAGG + Intronic
1030940746 7:115646114-115646136 CACCTCAGCCTCTTGAAGCTGGG - Intergenic
1032039570 7:128548105-128548127 CACTTCAGCCTCCTGGTACATGG + Intergenic
1032380394 7:131473898-131473920 CACCTCAGCCTCCTGAAGTGCGG - Intronic
1032690824 7:134284861-134284883 CACTTCTGCCTCCTAACTCTTGG - Intergenic
1033239468 7:139665149-139665171 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1033369244 7:140694168-140694190 TGCCTCAGCCTCCTGAGACTGGG - Intronic
1034349140 7:150405229-150405251 CACAGCAGCCCCGTGAGGCTGGG - Intronic
1034983805 7:155495534-155495556 CACTTCAGGCTGCTCAGGCAGGG - Intronic
1035020309 7:155796917-155796939 CAGTTCAGCCTCGGGGGGCTGGG - Intergenic
1036388857 8:8307274-8307296 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1037067004 8:14594059-14594081 CACGTCAGCCTCCTGAGTAGTGG - Intronic
1037464878 8:19150113-19150135 CATTTCAGCCTCCTTAGCCTGGG - Intergenic
1037583356 8:20259975-20259997 CACTGCAGCCTCCAGCTGCTGGG + Intronic
1038616084 8:29096411-29096433 CACTTCAGCCTCCTGAGTAGAGG + Intronic
1038913094 8:31989131-31989153 TGCCTCAGCCTCCTGAGTCTGGG - Intronic
1039048874 8:33474692-33474714 CACCTCAGCCTCCTGAGTGGCGG - Intronic
1039591864 8:38756778-38756800 CGCTTCTGCCTCCTGAGACTAGG - Intronic
1039865009 8:41492546-41492568 TACTTCAGCCTCCTGAGTAGCGG - Intronic
1040427838 8:47307332-47307354 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
1040743056 8:50604300-50604322 CACCTCAGCCCCCTGTAGCTGGG - Intronic
1040900840 8:52415429-52415451 CACTTCAGCCTCCTAAGTAGTGG - Intronic
1041115902 8:54536573-54536595 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1041926144 8:63238638-63238660 TGCCTTAGCCTCCTGAGGCTGGG + Intergenic
1042251906 8:66764582-66764604 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1042673289 8:71287720-71287742 CACATCAGCTTCCTGAGGCCAGG + Intronic
1043376430 8:79654866-79654888 CACCTGGGCCTCCTGAGACTGGG - Exonic
1043932627 8:86108253-86108275 CACCTCAGCTTCCTGAGTATGGG + Intronic
1044604967 8:94040516-94040538 CACTTCAGCCTCCTCAGTACTGG + Intergenic
1045227857 8:100267788-100267810 TGCTTCAGCCTCCCGAGTCTGGG + Intronic
1045268715 8:100643629-100643651 CACTTCATCTCCCTGAGTCTGGG - Intronic
1045308845 8:100982860-100982882 CACCTCAGCCTCCCAACGCTGGG - Intergenic
1046275904 8:111959315-111959337 CACTTCAGCCTCCTGTAGCTGGG + Intergenic
1046652840 8:116857857-116857879 CACTTCAGCCTCAAGTAGCTGGG - Intronic
1046811625 8:118539394-118539416 TAGTTCAGCCTCCTGATCCTGGG - Intronic
1046997660 8:120542403-120542425 CACCTCAGCCTCCAAAAGCTGGG - Intronic
1047440924 8:124877837-124877859 CACTTGAGCTTCCTGAATCTTGG + Intergenic
1047527111 8:125643090-125643112 CACTTGATCTTCCTGAGGCAGGG + Intergenic
1047614301 8:126550575-126550597 CACCTCAGCCTCCTGAGTGCTGG + Intergenic
1048017851 8:130513380-130513402 CACCTCAGCCTCCCAAGGCTGGG - Intergenic
1048685105 8:136896150-136896172 CACCTCAGCCTCCTGAGAGTTGG + Intergenic
1049212300 8:141392305-141392327 AACAGCGGCCTCCTGAGGCTCGG - Intronic
1050193733 9:3057850-3057872 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1050302443 9:4273477-4273499 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1050456304 9:5837971-5837993 CACCTCAGCCTCCTGAGTACAGG - Intergenic
1051248360 9:15134837-15134859 CACTTCAGCCTCCCGAGTACCGG - Intergenic
1051521387 9:17992556-17992578 CACTTGAGTCATCTGAGGCTAGG + Intergenic
1051673115 9:19532194-19532216 TACCTCAGCCTCCTGAGGTAGGG + Intronic
1051871045 9:21738079-21738101 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1052456414 9:28705028-28705050 CACCTCAGCCTCCTGTATCTGGG + Intergenic
1052785650 9:32825803-32825825 CACTTGATCCTGCTGAGGCACGG - Intergenic
1052810484 9:33054265-33054287 CACTTCAGCCTTCTGAGTACGGG + Intronic
1054151387 9:61608609-61608631 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1054724185 9:68633934-68633956 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1055930409 9:81554379-81554401 CACTCCAGCCTCCTTATGCCAGG - Intergenic
1056103651 9:83325438-83325460 CACCTCAGCCTCCTATAGCTAGG + Intronic
1056758786 9:89399962-89399984 CACTCCAGCCTCGTGTGCCTGGG + Intronic
1057616625 9:96596743-96596765 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1057638696 9:96796371-96796393 CACTTCAGCCTCAGGAGGTGGGG - Intergenic
1058436127 9:104965120-104965142 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1058450276 9:105090061-105090083 CAAGTCAGCCTCCTGAGGGTTGG + Intergenic
1058457983 9:105155947-105155969 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1058789669 9:108430121-108430143 CACCTCAGCCTCCAGTAGCTTGG - Intergenic
1059008358 9:110428953-110428975 CACTTCAGCCTCCTGAGTGCAGG - Intronic
1059173795 9:112151046-112151068 TGCCTCAGCCTCCTGGGGCTAGG + Intronic
1060106202 9:120875075-120875097 AACCTCAGCCTCCTGAGACAGGG - Intronic
1060177023 9:121504680-121504702 CACCTCAGCCTCTTGAGTATTGG + Intergenic
1060470829 9:123946815-123946837 CACCTCAGCCTCCTGAGCTACGG - Intergenic
1060472693 9:123961688-123961710 CACGCCAGCCCTCTGAGGCTTGG + Intergenic
1060647157 9:125290876-125290898 TACCTCAGCATCCAGAGGCTGGG - Intronic
1060648244 9:125301181-125301203 CACCTCAGCCTCCTGAGTGCTGG + Intronic
1060665695 9:125430946-125430968 GGCCTCAGCCTCCTGAGTCTAGG + Intergenic
1060804636 9:126566968-126566990 CACTTCAGCCTCTTGAGGTTGGG + Intergenic
1060879265 9:127106540-127106562 CACTTTGTCCCCCTGAGGCTCGG - Intronic
1060932740 9:127498941-127498963 TGCCTCAGCCTCCTGAGTCTGGG - Intronic
1061188733 9:129069928-129069950 GACTTCAGCAAGCTGAGGCTTGG - Exonic
1061624619 9:131834480-131834502 CACTTCTGCCTCCTGTCTCTTGG + Intergenic
1061864939 9:133487357-133487379 CACTGCAGCATGCTGGGGCTGGG + Intergenic
1062477643 9:136736600-136736622 CACCTCAGCCTCCTGAGGAGCGG + Intergenic
1062533216 9:137010698-137010720 CACATCATCCTCCACAGGCTTGG + Exonic
1186645119 X:11498620-11498642 CATTTCAGCCTCCTGAACTTTGG + Intronic
1186763818 X:12750386-12750408 CAAATCAGCATCCTGAGGATAGG - Intergenic
1187318429 X:18219790-18219812 CACCTCAGCCTCCTGAGGAGCGG - Intronic
1187343362 X:18441299-18441321 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1187525592 X:20051434-20051456 CACTTCAGCCTCAAGTAGCTGGG - Intronic
1188331843 X:28882392-28882414 CACCTCAGCCTCCCAAAGCTGGG - Intronic
1189062065 X:37764954-37764976 CACTTCGGCACGCTGAGGCTGGG - Intronic
1189355356 X:40306331-40306353 GACTTCATCTTCCTGAGCCTTGG + Intergenic
1190078019 X:47332978-47333000 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1190226155 X:48546951-48546973 CACATGAGTTTCCTGAGGCTGGG - Intronic
1190306619 X:49086705-49086727 CGCTTCAGCCTCCTGAGTAGTGG + Intronic
1190822980 X:53991752-53991774 CACTTCAGCCTCCAGAGTGCTGG - Intronic
1191842848 X:65525226-65525248 GGCTTCAGCCTCCTCAGGCAGGG + Intronic
1192116432 X:68416154-68416176 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1192153468 X:68726225-68726247 CCCCTAAGCCTCCTGGGGCTGGG - Intergenic
1192154207 X:68731696-68731718 CATCTCAGCCTCCTGTAGCTAGG + Intergenic
1192677112 X:73209626-73209648 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1193118055 X:77794643-77794665 CACCTCAGCCTCCTGAGTGCTGG - Intergenic
1193894793 X:87099983-87100005 CACTTCAGCCTACAGTGGCAGGG - Intergenic
1193976758 X:88129740-88129762 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1195838826 X:109150018-109150040 CATGTAAGCCTCCTAAGGCTTGG - Intergenic
1196606212 X:117660326-117660348 CACTTCAGCCTCCCAGTGCTGGG + Intergenic
1196950926 X:120875210-120875232 CACCTCAGCCGCCTGATGGTGGG - Exonic
1197596501 X:128470341-128470363 CCATTCAGCCTGCTGAGGCAAGG - Intergenic
1197918306 X:131560286-131560308 GTCTTCTGCCTTCTGAGGCTTGG + Intergenic
1198134386 X:133732976-133732998 CACCTCAGCCTCGTAAAGCTGGG + Intronic
1198312511 X:135436042-135436064 CACATCAGCCTCCTCCAGCTGGG - Intergenic
1199115300 X:143985221-143985243 CATTTCAGCCCCTTGATGCTAGG + Intergenic
1199393203 X:147305909-147305931 CACTTCAGCCCACTGTGGCAAGG - Intergenic
1199763829 X:150926125-150926147 CTCTAGAGCCTCCTGAGGGTGGG + Intergenic
1199769516 X:150965536-150965558 CACCTTAGCCTCCTAATGCTGGG + Intergenic
1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG + Exonic
1199851587 X:151727813-151727835 CACTTCAGGCCTCTCAGGCTTGG + Intergenic
1199995782 X:153025302-153025324 CACCTCAGCCTCCTGAGAAGTGG + Intergenic
1200781084 Y:7216328-7216350 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1201265098 Y:12198691-12198713 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1201527460 Y:14952678-14952700 CACTTCAGCCTCCAAATCCTGGG - Intergenic