ID: 902559354

View in Genome Browser
Species Human (GRCh38)
Location 1:17267364-17267386
Sequence ATTGCAGCTCATTCTCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902559354_902559361 7 Left 902559354 1:17267364-17267386 CCCCATGGAGAATGAGCTGCAAT 0: 1
1: 0
2: 1
3: 13
4: 149
Right 902559361 1:17267394-17267416 GGTATGCTAGGTGCTGTCCACGG 0: 1
1: 0
2: 0
3: 10
4: 156
902559354_902559359 -5 Left 902559354 1:17267364-17267386 CCCCATGGAGAATGAGCTGCAAT 0: 1
1: 0
2: 1
3: 13
4: 149
Right 902559359 1:17267382-17267404 GCAATATTCCAGGGTATGCTAGG 0: 1
1: 0
2: 1
3: 10
4: 108
902559354_902559362 8 Left 902559354 1:17267364-17267386 CCCCATGGAGAATGAGCTGCAAT 0: 1
1: 0
2: 1
3: 13
4: 149
Right 902559362 1:17267395-17267417 GTATGCTAGGTGCTGTCCACGGG 0: 1
1: 0
2: 1
3: 7
4: 105
902559354_902559363 20 Left 902559354 1:17267364-17267386 CCCCATGGAGAATGAGCTGCAAT 0: 1
1: 0
2: 1
3: 13
4: 149
Right 902559363 1:17267407-17267429 CTGTCCACGGGAGATGCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902559354 Original CRISPR ATTGCAGCTCATTCTCCATG GGG (reversed) Intronic
901715583 1:11151094-11151116 AGAGCAGCTCATGTTCCATGAGG - Intronic
901875480 1:12164931-12164953 TTTCCAGCTCATTCTCTCTGGGG - Intergenic
902559354 1:17267364-17267386 ATTGCAGCTCATTCTCCATGGGG - Intronic
903879988 1:26501588-26501610 CCTGGAGCTCTTTCTCCATGTGG - Intergenic
906085756 1:43132439-43132461 ATTGGAACTCATTCACTATGTGG - Intergenic
906246036 1:44274973-44274995 AGTGCAGAGCATTGTCCATGGGG - Intronic
913486572 1:119337114-119337136 ATTGCAAGTCATTGTCCACGGGG - Intergenic
918818086 1:189217157-189217179 ATTGCAGTTAATTCTCCATCTGG - Intergenic
918898319 1:190378397-190378419 ATTGTAGGCAATTCTCCATGGGG + Intronic
920720050 1:208378841-208378863 ATTGCAGCCCAGTGTCCAGGGGG + Intergenic
921181822 1:212637380-212637402 CATGTAGCTCATTCTCCCTGTGG - Intergenic
922193265 1:223338552-223338574 CTTCCAGCTCATCCTCCTTGTGG - Intronic
924315345 1:242789709-242789731 ATACCAGCTGCTTCTCCATGAGG + Intergenic
924433910 1:244021907-244021929 ATGGCAGCTGACACTCCATGAGG - Intergenic
1063037934 10:2306280-2306302 ATTCCAGCTCTTTCTCCAGATGG + Intergenic
1063848281 10:10156102-10156124 ATTGAAACTCATGCACCATGTGG - Intergenic
1064333694 10:14418383-14418405 ATTCCACCTCACTCTGCATGTGG + Intronic
1065533987 10:26699989-26700011 ATTGCCGCTCTTTGTCCCTGTGG - Intronic
1066533132 10:36362300-36362322 GTTGCTTCTCCTTCTCCATGTGG + Intergenic
1070636170 10:78129870-78129892 ATTTCAGCAAATTCTCCATATGG + Intergenic
1071976387 10:90960074-90960096 ATTGCAGGGGAATCTCCATGAGG + Intergenic
1072261287 10:93676979-93677001 ATTGCAGCTAATTATCTGTGAGG - Intronic
1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG + Intergenic
1076272739 10:129169017-129169039 ATGACAGCTCATTGACCATGAGG - Intergenic
1077812308 11:5650519-5650541 ATTGTAGATAATTTTCCATGAGG + Intergenic
1080223110 11:29929585-29929607 ATTTCATCTCTTTTTCCATGGGG - Intergenic
1080914002 11:36636604-36636626 TTTGCATCTTATTCTACATGTGG - Intronic
1085918262 11:80918704-80918726 ATTGCAGATCATTCTGATTGTGG - Intergenic
1087277173 11:96172211-96172233 ATTGCAGGCCATTCTCCCTGTGG + Intronic
1087687117 11:101277261-101277283 AGTACAGCTCTTTGTCCATGGGG + Intergenic
1090618450 11:128539497-128539519 ACTACTGCTCATTCACCATGAGG + Intronic
1090982940 11:131739420-131739442 ATGGCAGCTCATTATCCCTGCGG - Intronic
1092947379 12:13469482-13469504 ATTGAAGATCTTTCTCCAAGAGG + Intergenic
1094311779 12:29092512-29092534 GCTTCAGCTCACTCTCCATGGGG - Intergenic
1094646293 12:32327898-32327920 TTTGCAACTCCTTCTCCATGTGG - Exonic
1095562934 12:43587034-43587056 ATTGCAATTCCTTCTCCTTGGGG - Intergenic
1102648042 12:114416305-114416327 ATTGCTGCTGCTTCACCATGTGG - Intergenic
1104864275 12:131943503-131943525 CTTGCCTCTTATTCTCCATGTGG + Intronic
1106001414 13:25726932-25726954 ACTGCACCTCCTTCTCCTTGGGG - Intronic
1106698400 13:32203384-32203406 ACTGCAGTTTATCCTCCATGTGG - Intronic
1107185246 13:37510330-37510352 ATTGCAGCTCATTCTCATCTTGG - Intergenic
1107852981 13:44589777-44589799 ATTGTAGCTCATTTTTAATGTGG + Intergenic
1108918762 13:55651166-55651188 AGTGCAGCACATTTACCATGTGG - Intergenic
1110863300 13:80367460-80367482 CTTGCCCCTCATTCTCCCTGAGG - Intergenic
1118332927 14:64827812-64827834 ATTACAGCTCAGTCTCAATATGG + Intronic
1120723038 14:87907766-87907788 GTTGCTGCTCATTCCCCCTGAGG - Intronic
1121493672 14:94377789-94377811 CCTGAAGCCCATTCTCCATGGGG - Exonic
1126708842 15:51434105-51434127 ATATAATCTCATTCTCCATGAGG - Intergenic
1127805583 15:62517001-62517023 ATTGCTGCTCCGTCACCATGTGG + Intronic
1128268051 15:66284417-66284439 TTTGCTGCTCATCTTCCATGTGG - Intergenic
1130235381 15:82128403-82128425 CTTGCAGCTCATCCTCCAGTGGG + Intergenic
1130863557 15:87912304-87912326 AATACAGCACAGTCTCCATGAGG - Intronic
1140332508 16:74071629-74071651 TTGGCATCTCATTCTCCAAGAGG + Intergenic
1145254464 17:21315054-21315076 CTTCCAGCTCACTCTCCCTGAGG + Exonic
1146467598 17:33098505-33098527 ATTGCAGCCCATCCCGCATGGGG - Intronic
1147898366 17:43767335-43767357 TGTGCAGCTCTTTCTCCAGGTGG - Exonic
1148844864 17:50523715-50523737 ACTGCAGGTCAATCTCCACGCGG + Exonic
1149329505 17:55566860-55566882 ATTGTCGCACATGCTCCATGAGG - Intergenic
1149936104 17:60808859-60808881 TATGCTGCTCCTTCTCCATGAGG - Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1152580083 17:81162002-81162024 ATTCCGGCACATTCTCCAGGAGG - Intronic
1153010455 18:534135-534157 TGGGCAGCTCATTCTCCAGGAGG - Intergenic
1153767365 18:8387158-8387180 CTTGAAGCTCATTCGCCAGGTGG + Exonic
1154312368 18:13277219-13277241 GCTGCAGTTCATTCTCCAGGAGG - Intronic
1156183317 18:34631730-34631752 TTTGTAGCTCAATTTCCATGTGG - Intronic
1156214685 18:34984387-34984409 ATTGCAGCTCATTCTGGAAGGGG - Intronic
1159732786 18:72052164-72052186 GGTGCTGCTCATTCTTCATGTGG - Intergenic
1162249029 19:9427004-9427026 ATTTCAACTAATTATCCATGGGG - Intronic
1164623313 19:29710616-29710638 ACTGCCTCTCATACTCCATGGGG - Intronic
925461519 2:4067423-4067445 TTAGCAGGTCATTCTGCATGGGG - Intergenic
926613356 2:14970145-14970167 ATTGAATCAGATTCTCCATGGGG + Intergenic
937577693 2:123444068-123444090 TTTCCAGCTCCTTCTTCATGAGG - Intergenic
940607493 2:155945146-155945168 AATGCAGCTCACTTTCCAGGAGG + Intergenic
941983267 2:171483747-171483769 ATGGCAGTTCATACTTCATGTGG - Exonic
943736532 2:191362459-191362481 AGTGTAGCTCATTCTCCCTAAGG + Intronic
945728223 2:213500112-213500134 ATTTCATATCATTCTCCATTTGG + Intronic
945775011 2:214095358-214095380 TTTGAAGCTCTTTTTCCATGTGG - Intronic
947431796 2:230035648-230035670 ATTGCATGTCATACTCCATTTGG - Exonic
947781582 2:232770168-232770190 ATTCCAGATCATTCTTCATACGG + Intronic
948879643 2:240850300-240850322 ATAGCAGCTCACTCACCACGGGG + Intergenic
1168742301 20:202136-202158 ATTGCTTCACATTATCCATGTGG - Intergenic
1169277389 20:4243096-4243118 AATGCAGATCATCCTCCCTGCGG - Intronic
1169549884 20:6691805-6691827 TTTGCTGATTATTCTCCATGTGG + Intergenic
1169896427 20:10509581-10509603 TTTGCAGCTGATTCACTATGTGG + Intronic
1169998340 20:11584844-11584866 TTTGCAACTCATTAGCCATGAGG + Intergenic
1170539610 20:17374689-17374711 ATGGGAGCTCAATCTCCCTGGGG + Intronic
1171428201 20:25061649-25061671 ATTGCCGTGCACTCTCCATGGGG - Intergenic
1171436164 20:25126250-25126272 ATTGCAGGGAATTCCCCATGAGG - Intergenic
1175398013 20:58680809-58680831 ATAGCATGTCATTCTACATGGGG + Intronic
1177325108 21:19575893-19575915 ATTGTAGATCATTTGCCATGTGG - Intergenic
1178231965 21:30796112-30796134 ATTGCCGCTCACTTCCCATGTGG + Intergenic
1178526097 21:33330736-33330758 ATTTCCTCCCATTCTCCATGTGG - Intronic
1183594200 22:38800197-38800219 ATTGTACCTCATCCTCCCTGGGG + Intergenic
951096172 3:18633998-18634020 GTTTCACCTAATTCTCCATGCGG + Intergenic
954851289 3:53602984-53603006 ACTGCATCTCACTCTCCAAGAGG - Intronic
954994790 3:54871643-54871665 AATGCAGGTCCTTCTCCACGAGG - Intronic
955795582 3:62633318-62633340 ATTGCTGCTCATGCCTCATGCGG + Intronic
957751206 3:84418468-84418490 ATTGAAGCTCATTCCACCTGAGG + Intergenic
958150735 3:89690844-89690866 ACAGCAGCTCATGCTCCATCTGG + Intergenic
959520935 3:107322219-107322241 AATGGAGCTCATTCTCACTGGGG - Intergenic
959566655 3:107839407-107839429 TTTGCTGCTCATTCTGCATAGGG - Intergenic
963729063 3:148953606-148953628 CTCGCTGCTCATTCTCCATGAGG + Intergenic
969275802 4:6135068-6135090 AGAGCTGCTCAGTCTCCATGGGG + Intronic
969546015 4:7828394-7828416 ACAGCAGCTTATTCACCATGTGG + Intronic
970416483 4:15862742-15862764 ATTCCAGCTCTTTCTCCCTTTGG + Intergenic
974093491 4:57336729-57336751 ACTCCAGCTCTTTCACCATGTGG + Intergenic
975476437 4:74828823-74828845 ATTTCAGGTCAATCTCCCTGAGG + Intergenic
977361714 4:96013874-96013896 ATTCCTACTCATTCTCTATGTGG - Intergenic
980839388 4:138239098-138239120 GTTGCAACTCACTCTCCATGGGG + Intronic
982116033 4:152099112-152099134 GCTGCTGCTCATTCTCCAGGAGG - Intergenic
988688539 5:33549249-33549271 GTTACAGCTCATGCTCAATGGGG + Exonic
988857649 5:35244888-35244910 ATCCCAGCTCCTTCTCCATTTGG - Intergenic
994965002 5:106658215-106658237 ATTTCACATTATTCTCCATGTGG + Intergenic
996026302 5:118649882-118649904 AATGCAAGTCTTTCTCCATGTGG + Intergenic
998272452 5:140719022-140719044 AGTTCAGCTCCTTTTCCATGGGG + Intergenic
998783385 5:145682996-145683018 ATTGTAGCTCATGCTCCAAAGGG + Intronic
1001965398 5:175906634-175906656 ATTGCAGCTCTGTCTCCATCGGG - Intergenic
1002018559 5:176346689-176346711 CTTGCAGCTAGTTCTTCATGTGG - Exonic
1002084889 5:176768304-176768326 AATCCAGCTCATTCTCCAGGGGG + Intergenic
1002251552 5:177932560-177932582 ATTGCAGCTCTGTCTTCATCGGG + Intergenic
1004449644 6:15733292-15733314 GTTCCACCTCATTCTCTATGAGG + Intergenic
1005634739 6:27742471-27742493 ATGGCAGATTATTCTGCATGTGG - Intergenic
1005656715 6:27946172-27946194 ATTGCACCTTAATGTCCATGAGG - Intergenic
1006313682 6:33278238-33278260 TGTGCAGCTCATTCTCAAGGTGG + Exonic
1007921273 6:45611783-45611805 ATTGCAGGAGATTGTCCATGTGG + Intronic
1009426683 6:63521772-63521794 ATTTCAGTTCATTCTGCATAAGG - Intronic
1015518204 6:134105616-134105638 GTTGTCCCTCATTCTCCATGGGG + Intergenic
1016732506 6:147441952-147441974 ACTGCATTTCATTCTTCATGAGG + Intergenic
1017886639 6:158605430-158605452 AGTTCAGATCAATCTCCATGTGG - Intronic
1019197507 6:170290971-170290993 TTTGCATCTCATTAGCCATGCGG - Intergenic
1020217079 7:6201394-6201416 ATTTCTCCTCAATCTCCATGTGG + Intronic
1027364577 7:77444163-77444185 ATTGCAGCTCTCTCTCCATGAGG - Intergenic
1027429510 7:78095665-78095687 ATCCCACCCCATTCTCCATGAGG - Intronic
1029230801 7:99066837-99066859 ATTTCAGGTCATTCTGAATGTGG + Intronic
1032664469 7:134021849-134021871 ACTGCATCTCATTCTCCTTCAGG + Intronic
1033040156 7:137910111-137910133 ATTGCTGCTCATCCTCTCTGAGG - Intronic
1034160965 7:148994016-148994038 TTTCCAGCTCACTCTCCAGGTGG - Intergenic
1034259636 7:149746709-149746731 ATTGAAGCTCATTCTACATCAGG - Intergenic
1036282254 8:7410495-7410517 ATTGCTCCTCAGTATCCATGGGG - Intergenic
1036339214 8:7901076-7901098 ATTGCTCCTCAGTATCCATGGGG + Intergenic
1039749434 8:40463577-40463599 ATTTCAGTGCCTTCTCCATGAGG + Intergenic
1041228714 8:55728005-55728027 ACTTCAGCTCATCCTCCATGGGG + Intronic
1045439818 8:102198162-102198184 ATTGCATCTAATTCTCCAAGAGG - Intergenic
1047213993 8:122862365-122862387 GTTGCAGCCCATTCTCCACGTGG - Intronic
1048420953 8:134277881-134277903 TCTGCAGCCCATTCTCCACGAGG - Intergenic
1049168544 8:141142444-141142466 GTTCCTGCTCACTCTCCATGGGG - Intronic
1050317718 9:4420210-4420232 ATTGCATCTTCCTCTCCATGTGG - Intergenic
1050369420 9:4905276-4905298 ATTGCTGCATATTCCCCATGTGG - Intergenic
1052136257 9:24914418-24914440 ATTGCAGGTCATTCTATGTGTGG + Intergenic
1052982015 9:34457161-34457183 ATTCCAGCTCAGGCTCCAGGGGG + Intronic
1054786841 9:69218290-69218312 AATGAAGCACATCCTCCATGGGG - Exonic
1054794095 9:69282436-69282458 ATTGCACTTCATTTTCAATGTGG + Intergenic
1056464761 9:86842899-86842921 AGTAGAGCTCATTCTCCAGGGGG - Intergenic
1057218280 9:93241742-93241764 CTGGCAGCTCCTTGTCCATGGGG + Intronic
1186498505 X:10031926-10031948 AGGGCAGCTCACTCTCTATGGGG - Intronic
1187479425 X:19641578-19641600 ATTGCATCTCATCGTGCATGAGG + Intronic
1189135688 X:38547086-38547108 ATTGCAGCTCATGGTACTTGTGG + Intronic
1190472925 X:50800729-50800751 ATTACAGACCATTCTCCATCTGG - Intronic
1193796229 X:85877831-85877853 CTTGCAGCTCATTTCCTATGTGG - Intronic
1195353238 X:104013950-104013972 ATTTCAGCTCATGATCCCTGAGG + Intergenic
1197153196 X:123242498-123242520 CTTGCAACTCATTTTACATGGGG - Intronic
1199668203 X:150118950-150118972 TTTCCAGCACATTCTCCCTGGGG + Intergenic
1200142023 X:153907147-153907169 ATTGGAGCTCATTTTCCACATGG + Exonic
1202051524 Y:20785888-20785910 ATTGAATCTCATTTCCCATGAGG - Intergenic