ID: 902560007

View in Genome Browser
Species Human (GRCh38)
Location 1:17271346-17271368
Sequence GTTGAATCCAGGATCAGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902560007_902560021 26 Left 902560007 1:17271346-17271368 CCCACGCTGATCCTGGATTCAAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 902560021 1:17271395-17271417 AGGCACTAGGCTAGGCCCACAGG 0: 1
1: 0
2: 4
3: 37
4: 239
902560007_902560020 18 Left 902560007 1:17271346-17271368 CCCACGCTGATCCTGGATTCAAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 902560020 1:17271387-17271409 TCTGGGCTAGGCACTAGGCTAGG 0: 1
1: 0
2: 8
3: 73
4: 565
902560007_902560010 -6 Left 902560007 1:17271346-17271368 CCCACGCTGATCCTGGATTCAAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 902560010 1:17271363-17271385 TTCAACACCCATTCACCCACCGG 0: 1
1: 0
2: 1
3: 18
4: 120
902560007_902560011 0 Left 902560007 1:17271346-17271368 CCCACGCTGATCCTGGATTCAAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 902560011 1:17271369-17271391 ACCCATTCACCCACCGGATCTGG 0: 1
1: 0
2: 0
3: 4
4: 45
902560007_902560013 1 Left 902560007 1:17271346-17271368 CCCACGCTGATCCTGGATTCAAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 902560013 1:17271370-17271392 CCCATTCACCCACCGGATCTGGG 0: 1
1: 0
2: 1
3: 1
4: 60
902560007_902560023 28 Left 902560007 1:17271346-17271368 CCCACGCTGATCCTGGATTCAAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 902560023 1:17271397-17271419 GCACTAGGCTAGGCCCACAGGGG 0: 1
1: 2
2: 3
3: 24
4: 222
902560007_902560019 13 Left 902560007 1:17271346-17271368 CCCACGCTGATCCTGGATTCAAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 902560019 1:17271382-17271404 CCGGATCTGGGCTAGGCACTAGG 0: 1
1: 0
2: 1
3: 41
4: 381
902560007_902560022 27 Left 902560007 1:17271346-17271368 CCCACGCTGATCCTGGATTCAAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 902560022 1:17271396-17271418 GGCACTAGGCTAGGCCCACAGGG 0: 1
1: 0
2: 3
3: 13
4: 118
902560007_902560015 6 Left 902560007 1:17271346-17271368 CCCACGCTGATCCTGGATTCAAC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 902560015 1:17271375-17271397 TCACCCACCGGATCTGGGCTAGG 0: 1
1: 0
2: 1
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902560007 Original CRISPR GTTGAATCCAGGATCAGCGT GGG (reversed) Intronic
900206203 1:1432900-1432922 GTTGAGTCTAGGAGCTGCGTGGG + Intergenic
902560007 1:17271346-17271368 GTTGAATCCAGGATCAGCGTGGG - Intronic
905301880 1:36991177-36991199 GTTGAATCCTGGATGAGCTGCGG - Intronic
906487657 1:46244124-46244146 CTTGAACCCAGGAGCAGCCTGGG - Intergenic
922886503 1:229024762-229024784 GTTGAACCCAGGAGCAGAATGGG - Intergenic
923680553 1:236114997-236115019 GTTGAAGCCAGGACTAGCCTGGG + Intergenic
923905204 1:238376811-238376833 GTTTTATCCAAGATCACCGTTGG + Intergenic
924077424 1:240354605-240354627 GTAAAATCTAAGATCAGCGTAGG - Intronic
1068402740 10:56551474-56551496 GTTGAATCCAGACTCAGAGTAGG + Intergenic
1068531272 10:58189405-58189427 GCTGAATCCAGAGTCAGAGTGGG - Intergenic
1069878541 10:71577805-71577827 CTTGCAGCCAGGATCAGCCTGGG + Intronic
1071685760 10:87754465-87754487 GTTGAATCCAGCCTGAACGTGGG - Exonic
1075781353 10:125019206-125019228 GTTGAAGCCAGCCTCAGAGTGGG + Intronic
1076545498 10:131243207-131243229 GTGAAGTCCAGGGTCAGCGTGGG - Intronic
1077033840 11:484330-484352 GCTGATTCCAGGACCAGGGTGGG - Intronic
1081724856 11:45321109-45321131 GTTGGGGCCAGGATCAGCATGGG - Intergenic
1084586428 11:70065404-70065426 GCTGAATCCAGGAGCAGCCCCGG + Intergenic
1085799333 11:79574164-79574186 GTTGAATCCTTGAACAGTGTTGG + Intergenic
1093034171 12:14317446-14317468 CTTGAGTTCAGGATCAGCCTGGG + Intergenic
1094683746 12:32689710-32689732 GTTGAATAAGGGATCAGCTTTGG + Intronic
1101649674 12:106665094-106665116 GATGAATCCAGTATCACTGTTGG - Intronic
1103486092 12:121283602-121283624 GCTGAATTCAAGATCAGCCTGGG + Intronic
1104946004 12:132415154-132415176 GCAGAATCCAGGAGCAGGGTGGG + Intergenic
1105328521 13:19392501-19392523 GATGAATCAAGGAACAGAGTAGG - Intergenic
1108062260 13:46545109-46545131 TTTAAATCCAGGATCAGAGGAGG + Intergenic
1120948308 14:90018659-90018681 CTTGAACCCAGGACCAGCCTGGG - Intronic
1125395942 15:39248126-39248148 GTTGGATTCAGGTTCAGGGTTGG + Intergenic
1127331201 15:57941831-57941853 TGTGAACCCAGGATCAGGGTGGG - Intergenic
1133372121 16:5253077-5253099 GTAGAAACCAGGCTCAGCTTTGG + Intergenic
1137824047 16:51474549-51474571 CTTGCATCCAGGACCAGCCTGGG - Intergenic
1142365826 16:89649172-89649194 GTTGAGGGCTGGATCAGCGTGGG - Intronic
1142997201 17:3767831-3767853 CTTGAGCCCAGGATCAGCTTGGG - Intronic
1143537490 17:7549869-7549891 ATTGAATGCAGGGTCTGCGTTGG + Intronic
1149149584 17:53544465-53544487 GATGATTCCAGGATCAGAGATGG - Intergenic
1152271909 17:79329730-79329752 GGTGAATCCAGGACAGGCGTGGG - Intronic
1157446186 18:47748459-47748481 GCAGAATCCAGGAGCACCGTAGG + Intergenic
925340542 2:3132568-3132590 GTGGAATCCAGGATCTGCCTGGG - Intergenic
935327642 2:101951855-101951877 ATTGAATCCAGGATCTGCATTGG + Intergenic
942323657 2:174757212-174757234 ATTGAATCCAGGCTGAGGGTGGG - Intronic
945215033 2:207424249-207424271 GCCGAATCCAGAATCAGTGTAGG + Intergenic
1183347168 22:37314264-37314286 GTTGAATCCGGAGTCAGCCTGGG - Exonic
1184154519 22:42658434-42658456 GCTGAACCCAGGACCAGCCTGGG + Intergenic
954396812 3:50297384-50297406 GTGGAATCCAGGGGCAGCTTTGG + Exonic
970249291 4:14097154-14097176 GTTGAATCCAGAGTCAGGGCAGG - Intergenic
975799796 4:78048569-78048591 GTTGATTCAGGGATCAGCCTGGG + Intergenic
986551563 5:8961705-8961727 CTTCTATTCAGGATCAGCGTGGG + Intergenic
993243798 5:85425898-85425920 GTTGAATATAGGATCACTGTAGG - Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
999273260 5:150310747-150310769 GTTGACTCCAGGAGCAGGCTTGG + Intronic
1002955373 6:1857501-1857523 GTTGACTTCAGGATCACAGTAGG + Intronic
1004033529 6:11898262-11898284 GTTGAATCCACTATCATAGTTGG - Intergenic
1017791600 6:157804815-157804837 GTTGAATCCAGGATGTGAGCTGG + Intronic
1022778034 7:33547920-33547942 TTTGAATCTAGGATTAGAGTTGG + Intronic
1052216372 9:25971714-25971736 GGAGAATCCAGGAACAACGTTGG - Intergenic
1062291167 9:135795228-135795250 GTTGAGTTTAAGATCAGCGTGGG + Intergenic
1196832334 X:119785567-119785589 CTTGAATCCAGGAACAGGGGTGG + Intergenic
1198092990 X:133350312-133350334 CATGAATTCAAGATCAGCGTGGG + Intronic