ID: 902560138

View in Genome Browser
Species Human (GRCh38)
Location 1:17272216-17272238
Sequence CCGAGCATGCGCAAAGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902560132_902560138 10 Left 902560132 1:17272183-17272205 CCAGGCTGTACAGGTTGGTGGTC 0: 1
1: 0
2: 1
3: 11
4: 133
Right 902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG 0: 1
1: 0
2: 1
3: 28
4: 253
902560129_902560138 17 Left 902560129 1:17272176-17272198 CCAAGCACCAGGCTGTACAGGTT 0: 1
1: 0
2: 0
3: 24
4: 242
Right 902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG 0: 1
1: 0
2: 1
3: 28
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902560138 Original CRISPR CCGAGCATGCGCAAAGGCCC GGG Intronic
900621886 1:3591293-3591315 CCGAGCAGGGGGTAAGGCCCTGG + Intronic
900671431 1:3857215-3857237 TCGCGCACGCGCAGAGGCCCTGG - Intergenic
901183201 1:7355859-7355881 AAAAGCATGTGCAAAGGCCCTGG - Intronic
901221279 1:7585398-7585420 AAGAGTATGTGCAAAGGCCCTGG + Intronic
901781059 1:11594847-11594869 AACAGCATGTGCAAAGGCCCTGG - Intergenic
901785826 1:11623856-11623878 GAGAGCATGTGCAAAGGCCCTGG + Intergenic
901853088 1:12028482-12028504 AAGAGCAAGCGCAAAGGCCCCGG - Intronic
901864337 1:12094352-12094374 ACCAGCTTGTGCAAAGGCCCTGG + Intronic
902239784 1:15080832-15080854 CCCAGCATGCCCTAAGGCACAGG - Intronic
902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG + Intronic
903743927 1:25574134-25574156 AAGAGCAAGCGCAAAGCCCCAGG + Intergenic
904170064 1:28585451-28585473 CCAGGCAAGAGCAAAGGCCCTGG - Intergenic
904359349 1:29961842-29961864 GACAGCATGTGCAAAGGCCCTGG - Intergenic
904392160 1:30193137-30193159 GGGAGCATGTGCAAAGGCCCTGG + Intergenic
905267065 1:36761531-36761553 AACAGCATGTGCAAAGGCCCTGG - Intergenic
905802787 1:40856118-40856140 CTGGGCATGAGTAAAGGCCCAGG - Intergenic
905899008 1:41568341-41568363 CACAGCAAGTGCAAAGGCCCTGG + Intronic
912198146 1:107424260-107424282 ACCAGCAAGTGCAAAGGCCCTGG + Intronic
912452838 1:109777813-109777835 ACCAGCATGAGCAAAGGCACAGG + Intergenic
912488884 1:110050295-110050317 CCCACCATGAGCAAAGGCCCAGG - Intronic
912858601 1:113193196-113193218 AATAGCATGTGCAAAGGCCCTGG - Intergenic
916263050 1:162861613-162861635 CTGAGCATGTGGAAAGGCCTGGG - Intronic
916417578 1:164607043-164607065 CACCGCATGGGCAAAGGCCCAGG + Intronic
916581742 1:166115390-166115412 ACAAGCAAGGGCAAAGGCCCTGG + Intronic
917798642 1:178550979-178551001 CGGAGCAAGTACAAAGGCCCTGG + Intergenic
919118308 1:193308868-193308890 AAGAACAAGCGCAAAGGCCCTGG + Intergenic
921157893 1:212452444-212452466 AACAGCATGTGCAAAGGCCCAGG - Intergenic
924052394 1:240092177-240092199 CCGAGGATGCGCTGGGGCCCAGG + Exonic
924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG + Intronic
1063428099 10:5965311-5965333 CCGGGGATGGGCACAGGCCCTGG - Intronic
1064691835 10:17926564-17926586 AACAGCATGGGCAAAGGCCCTGG - Intergenic
1066132847 10:32410776-32410798 AACAGCATGTGCAAAGGCCCTGG + Intergenic
1066309371 10:34180897-34180919 CACAGCAAGTGCAAAGGCCCTGG + Intronic
1067729136 10:48796581-48796603 ACGAGCCTGCCCAGAGGCCCTGG + Intronic
1067946763 10:50694497-50694519 CTGAGAATCCCCAAAGGCCCAGG - Intergenic
1069623447 10:69852050-69852072 CACAGCAAGTGCAAAGGCCCTGG - Intronic
1070882072 10:79859490-79859512 CTGAGAATCCCCAAAGGCCCAGG - Intergenic
1071566416 10:86673588-86673610 GTGAGCATGAGCAAAGCCCCAGG + Intronic
1071648647 10:87375801-87375823 CTGAGAATCCCCAAAGGCCCAGG - Intergenic
1072552976 10:96493421-96493443 GACAGCATGTGCAAAGGCCCTGG + Intronic
1073301632 10:102474525-102474547 AACAGCAGGCGCAAAGGCCCAGG + Intronic
1073464747 10:103687907-103687929 CACAGCAAGTGCAAAGGCCCTGG - Intronic
1075420488 10:122296932-122296954 AACAGCATGTGCAAAGGCCCTGG - Intronic
1075994738 10:126868181-126868203 CACAGCACGCGCAAAGGCCCTGG - Intergenic
1077530993 11:3094636-3094658 CCTGACATGAGCAAAGGCCCTGG - Intronic
1078153181 11:8776316-8776338 CCTAGTATGCTCCAAGGCCCAGG + Intronic
1081541588 11:44038520-44038542 GGCAGCATGTGCAAAGGCCCGGG + Intergenic
1082795333 11:57374796-57374818 CCCAGCATGGGTAAAGTCCCTGG + Intergenic
1083994012 11:66263343-66263365 GCCAGCATGAGCAAAGGCACTGG + Intronic
1085519728 11:77130913-77130935 AACAGCATGTGCAAAGGCCCAGG + Intronic
1085641334 11:78195013-78195035 AAGAGCATACACAAAGGCCCAGG + Intronic
1086143115 11:83521025-83521047 AAGAGCATGGGCAAAGGCTCAGG + Intronic
1088559669 11:111100647-111100669 AATAGCATGTGCAAAGGCCCTGG + Intergenic
1089300517 11:117496005-117496027 AGGAGCATGAGCAAAGACCCTGG - Intronic
1089327884 11:117669778-117669800 AGGAACATGTGCAAAGGCCCTGG + Intronic
1091307187 11:134543794-134543816 CCCAGCATGTGCAAAGGCCCCGG - Intergenic
1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG + Intergenic
1094841608 12:34344744-34344766 CCGTGCATGCGCGAGGTCCCGGG - Intergenic
1096460040 12:51817211-51817233 CTGAGCATGCGCAAGAGCACAGG - Intergenic
1096677981 12:53235876-53235898 AAGAGTATGTGCAAAGGCCCTGG + Intergenic
1101329184 12:103743755-103743777 ATGAGCAAGTGCAAAGGCCCTGG + Intronic
1102544347 12:113643785-113643807 ACCAGCAAGTGCAAAGGCCCTGG - Intergenic
1102898805 12:116620170-116620192 CAGTGCAGGCTCAAAGGCCCTGG + Intergenic
1103041820 12:117702102-117702124 AACAGCATGTGCAAAGGCCCTGG - Intronic
1103443919 12:120981595-120981617 AAGAGCACGTGCAAAGGCCCTGG - Intronic
1103500857 12:121400497-121400519 CCGAGGAGGCGCACAGGGCCCGG - Intronic
1103708978 12:122896842-122896864 ACCAGCACGTGCAAAGGCCCTGG + Intergenic
1103935865 12:124476167-124476189 GCCAGCCTGTGCAAAGGCCCGGG - Intronic
1103937560 12:124484616-124484638 CCCAGCAGGTGCAAAGGCCCTGG - Intronic
1103948605 12:124540337-124540359 CACAGCCTGTGCAAAGGCCCAGG + Intronic
1104777507 12:131399865-131399887 CACAGCAAGTGCAAAGGCCCTGG + Intergenic
1104939593 12:132388724-132388746 AGGAGCAGGTGCAAAGGCCCTGG + Intergenic
1106546069 13:30732108-30732130 CAGAGCACGTGCAGAGGCCCGGG - Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1107534064 13:41311215-41311237 CCGCGCATGCGCACAGGATCCGG + Exonic
1109152187 13:58859342-58859364 CCGAGGAGACGCCAAGGCCCAGG + Intergenic
1112110429 13:96290924-96290946 ACCAGCAAGTGCAAAGGCCCTGG - Intronic
1113373948 13:109746473-109746495 CGCAGCAGGTGCAAAGGCCCCGG - Intergenic
1114213211 14:20633510-20633532 CGGAGCAGGCGCCAAGGCCAGGG - Intergenic
1115751616 14:36499061-36499083 AACAGCATGCACAAAGGCCCAGG - Intronic
1115975343 14:38990879-38990901 AATAGCATGTGCAAAGGCCCTGG + Intergenic
1120900141 14:89568473-89568495 CAGAGCCTGTGCAAAGACCCTGG - Intronic
1122289380 14:100671825-100671847 CCGAGCATGGGCATAGGTACTGG + Intergenic
1124430398 15:29602920-29602942 ACGTGCATGTGCAAAGACCCTGG + Intergenic
1128090031 15:64912956-64912978 CCCAGCATGGGCAAAGGCTCAGG + Intronic
1128104229 15:65031175-65031197 GGGAGCATGAGCAAAGGCACAGG - Intergenic
1128360118 15:66956092-66956114 AACAGCATGGGCAAAGGCCCGGG - Intergenic
1128764232 15:70241380-70241402 GAGAGCATGTGCAGAGGCCCTGG + Intergenic
1128911433 15:71519163-71519185 AACAGCAAGCGCAAAGGCCCTGG + Intronic
1129032305 15:72628342-72628364 CCTAGCATGTGCCCAGGCCCAGG - Intergenic
1129217591 15:74108897-74108919 CCTAGCATGTGCCCAGGCCCAGG + Intronic
1129314558 15:74733482-74733504 AGGAGCAAGTGCAAAGGCCCTGG - Intergenic
1129407068 15:75327088-75327110 CCTAGCATGTGCCCAGGCCCAGG - Intergenic
1129734752 15:77953198-77953220 CCTAGCATGTGCCCAGGCCCAGG + Intergenic
1129840838 15:78742793-78742815 CCTAGCATGTGCCCAGGCCCAGG - Intergenic
1131506564 15:93025071-93025093 CCGACCATGCACTAAGGTCCTGG - Exonic
1131771644 15:95744241-95744263 AGGAGCATGTGCAAAGGTCCCGG - Intergenic
1132204488 15:99977029-99977051 CCAAGACTGGGCAAAGGCCCCGG - Intronic
1133424070 16:5672409-5672431 ACTAGGATGTGCAAAGGCCCTGG - Intergenic
1133858064 16:9568105-9568127 CATAGCATGTGCAAAAGCCCAGG - Intergenic
1133862452 16:9609067-9609089 CACAACATGGGCAAAGGCCCTGG + Intergenic
1134005662 16:10817673-10817695 AACAGCAAGCGCAAAGGCCCTGG - Intronic
1134098373 16:11434681-11434703 CTGAGCATGCTCACTGGCCCTGG + Intronic
1134104465 16:11476069-11476091 CACAGCAGGTGCAAAGGCCCTGG + Intronic
1134107095 16:11492991-11493013 AAGAGCATGTGCAAAGGGCCTGG + Intronic
1134559145 16:15192726-15192748 ACCAGCAAGTGCAAAGGCCCTGG - Intergenic
1134672335 16:16065051-16065073 AAGAGCATGTGCAAAGGCCCTGG + Intronic
1134865703 16:17604937-17604959 AGCAGCATGGGCAAAGGCCCTGG - Intergenic
1134919681 16:18104339-18104361 ACCAGCAAGTGCAAAGGCCCTGG - Intergenic
1135040587 16:19114376-19114398 CCCAGCATGCGCACAGCGCCCGG - Exonic
1135161246 16:20098401-20098423 AGCAGCATGTGCAAAGGCCCTGG + Intergenic
1135420823 16:22304579-22304601 AAAAGCATGTGCAAAGGCCCAGG + Intronic
1135474573 16:22762908-22762930 GTGAGCATGGGCAAAGGTCCTGG - Intergenic
1135523567 16:23196256-23196278 ACTAGCAAGGGCAAAGGCCCTGG + Intronic
1135938614 16:26801851-26801873 AACAGCATGTGCAAAGGCCCTGG - Intergenic
1136088979 16:27904712-27904734 GAAAGCATGTGCAAAGGCCCTGG - Intronic
1136498746 16:30659354-30659376 CCGAGCTTGCCCCAAGGCCACGG - Exonic
1137567869 16:49544760-49544782 CCCAGCAAGGGCAAAAGCCCTGG - Intronic
1137593349 16:49707202-49707224 GAGAGCATGTGCAAAGGCCCTGG - Intronic
1138482008 16:57309703-57309725 CCCATCATGAGCAAAGGCCTAGG + Intergenic
1140250494 16:73290420-73290442 AAGAGCCTGTGCAAAGGCCCTGG + Intergenic
1141138690 16:81483233-81483255 CTGTGCATGTGCAAAGGCCATGG + Intronic
1141138701 16:81483287-81483309 CACAGCATGTGCAAAGGCCCTGG + Intronic
1141376437 16:83535181-83535203 CACAGCATGTGCAGAGGCCCTGG + Intronic
1141380884 16:83575577-83575599 AATAGCATGTGCAAAGGCCCTGG - Intronic
1141641081 16:85341923-85341945 CTGAGCATCCCCAAAGGCCCAGG - Intergenic
1141807186 16:86349520-86349542 TCCAGCATGTGCAAAGGTCCTGG - Intergenic
1141884248 16:86880908-86880930 TCCAGCAAGTGCAAAGGCCCTGG + Intergenic
1144756330 17:17682356-17682378 CGGGGCCTGCGCACAGGCCCCGG - Intronic
1146262326 17:31430183-31430205 AATAGCATGTGCAAAGGCCCTGG + Intronic
1147424649 17:40340527-40340549 GCGAGTCTGTGCAAAGGCCCTGG - Intronic
1149289241 17:55199916-55199938 CAGGGCATGCGCCAAGGCCCTGG - Intergenic
1151340796 17:73469524-73469546 CTGATCATGGGCAAAGGTCCTGG - Intronic
1152656611 17:81522882-81522904 CCCTGCATGTGCAAAGGTCCTGG + Intronic
1153243829 18:3054419-3054441 CACAGCAAGTGCAAAGGCCCAGG - Intergenic
1156293464 18:35770241-35770263 CCCAGCATGGGCACAGGCCTTGG + Intergenic
1156483347 18:37449789-37449811 CAGAGCACATGCAAAGGCCCTGG + Intronic
1157801353 18:50623902-50623924 CACAGCAAGTGCAAAGGCCCTGG - Intronic
1158259819 18:55594128-55594150 ACCAGCATATGCAAAGGCCCTGG - Intronic
1161098737 19:2409705-2409727 AACAGCATGTGCAAAGGCCCTGG + Intronic
1161154634 19:2726322-2726344 AGCAGCATGTGCAAAGGCCCTGG - Intronic
1161245837 19:3251387-3251409 CACAGCATGTGCCAAGGCCCGGG + Intronic
1161258917 19:3324809-3324831 CACAGCCTGTGCAAAGGCCCTGG - Intergenic
1161344579 19:3761682-3761704 CCGCGCATGCTCAATGGGCCAGG - Exonic
1161345424 19:3766789-3766811 CACAGCCTGTGCAAAGGCCCCGG + Intronic
1161506352 19:4645933-4645955 CACAGCCTGTGCAAAGGCCCTGG - Intronic
1161949292 19:7458888-7458910 CCACGCATGCAGAAAGGCCCAGG - Intronic
1162064916 19:8119440-8119462 AACAGCATGTGCAAAGGCCCTGG - Intronic
1162832509 19:13294984-13295006 AACAGCATGTGCAAAGGCCCTGG - Intronic
1162845297 19:13387687-13387709 GGGAACATGTGCAAAGGCCCTGG + Intronic
1162851835 19:13437083-13437105 CACAGCATGTGCAAAGTCCCTGG + Intronic
1162856504 19:13472580-13472602 AACAGCATGTGCAAAGGCCCTGG - Intronic
1163006960 19:14402899-14402921 CCCAGCATGTGCGAAGGCCCTGG - Intronic
1163704338 19:18803644-18803666 GTGAGCTTGTGCAAAGGCCCTGG + Intergenic
1164813072 19:31173598-31173620 CATAGCATGTGCAAATGCCCTGG - Intergenic
1167101176 19:47405081-47405103 AACAGCATGTGCAAAGGCCCAGG - Intronic
1167154744 19:47731105-47731127 AACAGCATGTGCAAAGGCCCTGG + Intronic
1167262880 19:48469026-48469048 CTGCGCCTGCTCAAAGGCCCTGG - Exonic
1167619620 19:50553465-50553487 AAGAGCAGGTGCAAAGGCCCTGG - Intronic
930209294 2:48617836-48617858 CCGCGCAGGCGCAAAGGGCCAGG + Exonic
932598318 2:73107818-73107840 CCGAGCAGGAGCCAAGGCCAGGG + Intronic
934972028 2:98771474-98771496 AGGAGCATGTGCAAAGGCCCTGG - Intergenic
935584889 2:104791808-104791830 GGGAGCATGTGCAAAGGTCCTGG - Intergenic
937103946 2:119293361-119293383 AAGAGCAAGTGCAAAGGCCCTGG + Intergenic
938817445 2:134918703-134918725 CCGCGCATGCGCAAGGGCGGAGG + Intronic
942069914 2:172306881-172306903 ACGAGCAAGAGCAAAGTCCCAGG - Intergenic
1168763355 20:364996-365018 CATAGCAAGGGCAAAGGCCCTGG + Intronic
1172890155 20:38258670-38258692 AACAGCATGTGCAAAGGCCCTGG + Intronic
1172896926 20:38306657-38306679 AATAGCATGTGCAAAGGCCCTGG + Intronic
1173902582 20:46601773-46601795 AAGAGCAGGTGCAAAGGCCCTGG + Intronic
1174165981 20:48583916-48583938 AAAAGCAGGCGCAAAGGCCCTGG + Intergenic
1175417421 20:58811023-58811045 AACAGCATGTGCAAAGGCCCTGG - Intergenic
1176236346 20:64055526-64055548 AGGAGCATGTGCCAAGGCCCTGG + Intronic
1177820803 21:26029039-26029061 AAGAGCAAGTGCAAAGGCCCAGG + Intronic
1178141873 21:29693515-29693537 CTGAGCATGTGGAAATGCCCAGG - Intronic
1181928378 22:26378696-26378718 GAGAGCATGTGCAAAGGTCCAGG + Intronic
1182044497 22:27263772-27263794 AATAGCATGTGCAAAGGCCCAGG + Intergenic
1182085884 22:27560955-27560977 GAGAGTATGTGCAAAGGCCCTGG + Intergenic
1182960167 22:34464625-34464647 ACAAGCATGTGCAAAGGCCCTGG + Intergenic
1183315337 22:37133894-37133916 AACAGCATGTGCAAAGGCCCTGG - Intronic
1183408889 22:37643495-37643517 CCCAGCCTGGGCAGAGGCCCCGG + Intronic
1183468013 22:37989836-37989858 TGGAGCAGGCCCAAAGGCCCAGG - Intronic
1184748292 22:46469337-46469359 CAGGAGATGCGCAAAGGCCCCGG - Intronic
1185069150 22:48646841-48646863 CCGAGGATGCGCTGAGGCCTAGG - Intronic
1185097998 22:48822091-48822113 CTGAGCAGGCGCAAAGCCCCTGG + Intronic
949482812 3:4510180-4510202 GACAGCATGTGCAAAGGCCCAGG + Intronic
950189992 3:10970016-10970038 AAGAGCTTGGGCAAAGGCCCAGG + Intergenic
950576476 3:13835092-13835114 AAGAGCATGGGCAAAGGCCGAGG + Intronic
951109885 3:18790449-18790471 AATATCATGCGCAAAGGCCCAGG - Intergenic
952252841 3:31671378-31671400 AAGAGCATGTGCAAAGGCCCTGG + Intronic
954401150 3:50320473-50320495 CCCAGCATGCGGGCAGGCCCAGG - Exonic
954794257 3:53153541-53153563 AAGGGCATGGGCAAAGGCCCAGG + Intergenic
954881095 3:53836419-53836441 AACAGCATGTGCAAAGGCCCTGG - Intronic
955054529 3:55443945-55443967 CAGGCCATGTGCAAAGGCCCAGG - Intergenic
955240220 3:57171142-57171164 AATAGCATGTGCAAAGGCCCTGG + Intergenic
955747674 3:62156139-62156161 AACAGCATGAGCAAAGGCCCTGG - Intronic
955763812 3:62318983-62319005 CCTGGCCTGCGCTAAGGCCCCGG + Intronic
961359963 3:126360789-126360811 CTGAGCATTGGCAAAGCCCCAGG + Intergenic
964764981 3:160170932-160170954 AACAGCATGTGCAAAGGCCCTGG + Intergenic
968811878 4:2803729-2803751 CATAGCTTGTGCAAAGGCCCTGG - Intronic
969103178 4:4785137-4785159 ACCAGCATTAGCAAAGGCCCAGG - Intergenic
969254121 4:5990975-5990997 AAGAGCACGTGCAAAGGCCCTGG - Intergenic
969300074 4:6292387-6292409 AACAGCATGAGCAAAGGCCCAGG + Intronic
969363503 4:6680547-6680569 TTCAGCATGGGCAAAGGCCCTGG - Intergenic
969463489 4:7341264-7341286 AACAGCATGTGCAAAGGCCCAGG - Intronic
969565185 4:7973156-7973178 AAGTGCATGTGCAAAGGCCCTGG + Intronic
970538323 4:17052718-17052740 AGCAGCATGTGCAAAGGCCCAGG + Intergenic
971236124 4:24843958-24843980 CAGAGGAAGTGCAAAGGCCCAGG - Intronic
972561507 4:40232804-40232826 AGAAGCATGTGCAAAGGCCCAGG - Intronic
975650927 4:76592170-76592192 AAGAGCATATGCAAAGGCCCTGG + Intronic
979552941 4:122011445-122011467 CCCAATATGCACAAAGGCCCTGG - Intergenic
982630182 4:157821879-157821901 CAGAGCAGGCGCTGAGGCCCAGG - Intergenic
983969823 4:173857961-173857983 AATAGCATGTGCAAAGGCCCTGG + Intergenic
985445547 4:190019379-190019401 CCGAGCGTGCCCACGGGCCCCGG - Intergenic
986335688 5:6753665-6753687 CCGAGCATCCGCAGAGCCCAAGG - Intronic
988399352 5:30741846-30741868 AAGAACATGTGCAAAGGCCCTGG - Intergenic
989678517 5:44002403-44002425 AACAGCATGTGCAAAGGCCCTGG - Intergenic
991509272 5:67358962-67358984 AACAGCATGGGCAAAGGCCCAGG - Intergenic
992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG + Intronic
997391902 5:133524098-133524120 CACAGCATGTGCACAGGCCCAGG + Intronic
998980731 5:147699063-147699085 CATAGCATGAGCAAAGGCCTGGG - Intronic
999442603 5:151614230-151614252 ACCAGCATGTGCAAAGACCCTGG + Intergenic
1001446681 5:171790690-171790712 AGTAGCATGTGCAAAGGCCCAGG + Intronic
1001549512 5:172593087-172593109 AACAGCATGCGCAAAGGCTCGGG + Intergenic
1001567955 5:172712788-172712810 CACAGCATGTGCAAAGGCCCTGG - Intergenic
1001752582 5:174142867-174142889 CTGAGCAAGACCAAAGGCCCTGG - Intronic
1002778767 6:350561-350583 CCGCGCAGGTGCACAGGCCCCGG + Exonic
1003403676 6:5811016-5811038 CACAGCAGGTGCAAAGGCCCCGG + Intergenic
1004882872 6:20025895-20025917 AGGAGCATGTGCAAAGGCCCTGG - Intergenic
1006440397 6:34050172-34050194 CTCAGCAAGTGCAAAGGCCCTGG - Intronic
1006678837 6:35782629-35782651 GCCAGCAAGCGCAAATGCCCTGG + Intronic
1006781627 6:36636389-36636411 CACAGCATGTGCAAAGGCCCTGG + Intergenic
1007502176 6:42306651-42306673 ACTGGCATGTGCAAAGGCCCTGG - Intronic
1007575563 6:42923360-42923382 GGGAGCATCCGCAAGGGCCCAGG - Intronic
1008629466 6:53349212-53349234 CAGAGCCTGCGCAATAGCCCCGG + Intergenic
1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG + Intergenic
1017534328 6:155330344-155330366 GAAAGCATGTGCAAAGGCCCTGG + Intergenic
1018728831 6:166633991-166634013 AGCAGCTTGCGCAAAGGCCCTGG + Intronic
1018908869 6:168090451-168090473 GACAGCATGTGCAAAGGCCCAGG - Intergenic
1019372123 7:667807-667829 CAGATCCTGTGCAAAGGCCCAGG + Intronic
1019441614 7:1050317-1050339 CTGAGCCTGAGCAAATGCCCTGG - Intronic
1019675555 7:2309907-2309929 CCGAGGGTCAGCAAAGGCCCTGG + Intronic
1021592630 7:22280404-22280426 CTGAGCATGGGAAAAGGGCCAGG - Intronic
1021803599 7:24332929-24332951 AACAGCATGTGCAAAGGCCCTGG + Intergenic
1021924812 7:25524001-25524023 AACAGCATGTGCAAAGGCCCTGG + Intergenic
1024005498 7:45222443-45222465 AAGAGCCTGTGCAAAGGCCCTGG - Intergenic
1025236307 7:57237037-57237059 ACCCGCATGTGCAAAGGCCCTGG - Intergenic
1026910975 7:74091814-74091836 CGGTGCATGTGCAAAGGCCTTGG + Intronic
1027050530 7:75018763-75018785 CACAGCATGTGCAAAGGCCCAGG + Intronic
1029298321 7:99558897-99558919 CCGAGAGTGCGCGGAGGCCCGGG + Exonic
1029382515 7:100222907-100222929 CACAGCATGTGCAAAGGCCCAGG - Intronic
1031055359 7:116987369-116987391 CACAGCAGGCCCAAAGGCCCAGG - Intronic
1032532600 7:132634597-132634619 AACAGCATGTGCAAAGGCCCAGG - Intronic
1032537687 7:132678270-132678292 CCCAGCATCCACAGAGGCCCGGG + Intronic
1035376723 7:158411433-158411455 CCGGGCATGTGCAAGGGCCCAGG - Intronic
1035738191 8:1904617-1904639 CGGAGCAAGCCCAGAGGCCCAGG + Intronic
1037609039 8:20460970-20460992 CACAGCAAGCGCAAAGGCCCTGG - Intergenic
1039574359 8:38611530-38611552 CCAAGCATCAGCATAGGCCCCGG - Intergenic
1041858296 8:62482675-62482697 CCCAGCATGCACAGTGGCCCTGG + Intronic
1041968149 8:63704872-63704894 CTGAGCATCTGCAAAGGCCTAGG + Intergenic
1042323021 8:67498053-67498075 CTGAGAATGGGCAAAGGCCAGGG - Intronic
1045382743 8:101643541-101643563 CCGAGAAGGAGCAAAGGCCTGGG + Intronic
1047825132 8:128565127-128565149 AATAGCATGTGCAAAGGCCCTGG + Intergenic
1048293658 8:133198854-133198876 CACAGCATGTGCAAAGGCCCTGG - Intronic
1048475476 8:134738781-134738803 GACAGCATGTGCAAAGGCCCAGG + Intergenic
1049259693 8:141632237-141632259 AACAGCATGGGCAAAGGCCCTGG + Intergenic
1049259908 8:141633363-141633385 AACAGCATGGGCAAAGGCCCTGG + Intergenic
1049260120 8:141634489-141634511 AACAGCATGGGCAAAGGCCCTGG + Intergenic
1057282325 9:93721777-93721799 GCGGGGATGTGCAAAGGCCCTGG - Intergenic
1057357136 9:94340935-94340957 CCCAGCCTCCGCAAAGGCCTCGG + Intergenic
1057650616 9:96916692-96916714 CCCAGCCTCCGCAAAGGCCTCGG - Intronic
1057834799 9:98435705-98435727 AAGAGCAGGTGCAAAGGCCCTGG - Intronic
1059435908 9:114276086-114276108 CAGAGCACATGCAAAGGCCCAGG - Intronic
1059742154 9:117162458-117162480 CAGAGCATTCTCCAAGGCCCAGG + Intronic
1060763721 9:126277215-126277237 GGGAGGATGTGCAAAGGCCCTGG + Intergenic
1060996710 9:127878140-127878162 CAGAGCCTGCCCAGAGGCCCTGG + Intergenic
1061281666 9:129601257-129601279 GAGGGCATGTGCAAAGGCCCTGG + Intergenic
1061995207 9:134179751-134179773 GCCAGCACGTGCAAAGGCCCTGG + Intergenic
1062432983 9:136534202-136534224 CCCAGCCTGAGCCAAGGCCCAGG - Intronic
1188353954 X:29166815-29166837 AGCAGCATGTGCAAAGGCCCTGG - Intronic
1189351400 X:40278513-40278535 AGTAGCATGTGCAAAGGCCCTGG + Intergenic
1195524789 X:105874257-105874279 CTGAGCATGCCCAAAGGCAGAGG + Intronic
1200074612 X:153544876-153544898 CCCAGCCTGCACACAGGCCCTGG - Intronic