ID: 902561378

View in Genome Browser
Species Human (GRCh38)
Location 1:17279728-17279750
Sequence TACCATGAGCAGGCCCCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902561378_902561382 4 Left 902561378 1:17279728-17279750 CCCCTCGGGGCCTGCTCATGGTA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 902561382 1:17279755-17279777 CTTACTAAGTAGCAGCCATGAGG 0: 1
1: 0
2: 0
3: 17
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902561378 Original CRISPR TACCATGAGCAGGCCCCGAG GGG (reversed) Intronic
901230919 1:7641349-7641371 TGCCATCAGCAGGGCCTGAGGGG + Intronic
901755684 1:11440172-11440194 TACCATGGGCAGACCACCAGGGG + Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902561378 1:17279728-17279750 TACCATGAGCAGGCCCCGAGGGG - Intronic
902986208 1:20155796-20155818 TACCAGGAACAGACCCCCAGTGG + Intergenic
912207477 1:107524343-107524365 CACCCTGAGCAGGCTCTGAGAGG - Intergenic
913550311 1:119910921-119910943 GACCATGAGCATGCCAGGAGAGG - Intergenic
917846775 1:179026257-179026279 TGCCCTGAGCCGTCCCCGAGTGG + Intronic
919876777 1:201875090-201875112 GCCCATGATCAGGCCCTGAGTGG - Intronic
920788508 1:209065577-209065599 TAGAATAAGCAGGCCACGAGAGG + Intergenic
922553672 1:226516931-226516953 AACCATGAGAAGGGCCCGATAGG - Intergenic
924029677 1:239873725-239873747 AACCATGAGAAGGACCAGAGAGG - Intronic
1067769771 10:49115135-49115157 TCCCAGCGGCAGGCCCCGAGGGG - Intronic
1078443021 11:11383165-11383187 TGCCCTGAGCAGGCCCGGAGAGG - Intronic
1079705169 11:23606914-23606936 TACAATCAGCAGGCAACGAGTGG - Intergenic
1084375437 11:68773643-68773665 TGACATGAGCAGGCCAGGAGAGG + Intronic
1084528516 11:69712670-69712692 GACCATGAGCAGACTCCGAGAGG + Intergenic
1088830456 11:113532167-113532189 TGCCACCAGCAGGCCCCGACAGG - Intergenic
1089197778 11:116704953-116704975 CACCATGAGCATGCCCCACGAGG + Intergenic
1090354472 11:126130634-126130656 TAACAGCAGCAGGACCCGAGGGG - Intergenic
1093520736 12:20047075-20047097 TACCAAGAATAGGCCCCGCGCGG - Intergenic
1103402041 12:120649697-120649719 AACCAGGAGATGGCCCCGAGGGG - Intronic
1104893596 12:132151549-132151571 GACCATGAGCAGGGCCTCAGGGG - Exonic
1107490937 13:40879412-40879434 TACCAGGAACAGACCCCCAGTGG - Intergenic
1118245903 14:64110470-64110492 TACCATGAGCAGGCACTGTATGG - Intronic
1125974366 15:43937975-43937997 TACCATGTGCAGGCTGGGAGCGG + Intronic
1132968529 16:2673348-2673370 GACTCTGAGGAGGCCCCGAGCGG - Intergenic
1133732304 16:8588368-8588390 TCCAATGAGGAGGCCCAGAGAGG - Intronic
1138203438 16:55106880-55106902 TCCCATCAGCAAGCCCTGAGAGG - Intergenic
1138230196 16:55330975-55330997 TCCCATGCGCAGGACCCGCGAGG - Intergenic
1138360566 16:56424834-56424856 TGCGAGGAGGAGGCCCCGAGGGG - Intronic
1139317069 16:66081838-66081860 TACCATGAGGAGGCCCATATTGG + Intergenic
1152424674 17:80212466-80212488 TTCCCTGAGCAGGCCTCGAATGG + Intronic
1152460464 17:80439538-80439560 TTCCCTGGCCAGGCCCCGAGTGG + Intergenic
1153752180 18:8244082-8244104 GACCATGAGCAGCACCCGACAGG + Exonic
1153959437 18:10128068-10128090 TAACATGAGCAGCCACAGAGTGG - Intergenic
1157760801 18:50263825-50263847 TACCATGAGCAGTACCCAAGGGG + Intronic
1158340695 18:56462846-56462868 CACCATGAGCAGAGCCCCAGAGG - Intergenic
1160503081 18:79411755-79411777 GGCCATCAGCAGGGCCCGAGAGG - Intronic
1163156439 19:15442438-15442460 TGCCAGGAGCAGGGCCAGAGGGG - Intronic
1163326186 19:16604812-16604834 CACCATGAGCCGGCTCCCAGGGG - Intronic
1165699938 19:37929756-37929778 TACCATGCGCTGGCCCCTGGGGG - Intronic
927810548 2:26178200-26178222 TAGCTTGAGCAGGCCCCCAGTGG - Intronic
931699470 2:64898139-64898161 TACCAGGAACAGACCCCCAGTGG - Intergenic
935139460 2:100339948-100339970 CACCATGCTCAGGCACCGAGCGG + Intergenic
936357250 2:111762182-111762204 TACCAGGAACAGACCCCCAGTGG + Intergenic
939841764 2:147197863-147197885 TTCAAGTAGCAGGCCCCGAGGGG - Intergenic
947731100 2:232432220-232432242 ACCCATGAGGAGGCCCCAAGGGG + Intergenic
948189160 2:236044945-236044967 AATCATGGACAGGCCCCGAGAGG - Intronic
1169606818 20:7331156-7331178 TTCCAAGTGCAGGCCCCAAGAGG - Intergenic
1171126783 20:22609480-22609502 TACAATGCGCAGGCACTGAGGGG + Intergenic
1172916959 20:38450428-38450450 TACCATGAGGAGGCCCCTCCAGG - Intergenic
1183346950 22:37313228-37313250 TCCCATGGGCAGGGCCAGAGTGG - Intronic
1184197898 22:42944133-42944155 TCCACTGAGCAGGCCTCGAGTGG + Intronic
1184525549 22:45020517-45020539 TACCACGAGCAGTTCCCGAGGGG - Intergenic
949988200 3:9555753-9555775 AACCAGGAGCAGCCCCAGAGGGG - Intergenic
951709020 3:25571046-25571068 GACCAGGAGCAGGCCCAGAGGGG + Intronic
954439389 3:50513385-50513407 ACCCATAAGTAGGCCCCGAGGGG + Intergenic
957022058 3:75138151-75138173 TACCAGGAACAGACCCCCAGTGG + Intergenic
959628968 3:108486513-108486535 TACCAGGAGCAGGTCTAGAGTGG + Exonic
962400762 3:135057007-135057029 TTCACTGAGCAGGCCCAGAGGGG - Intronic
963458855 3:145579814-145579836 TACCATGAGCAGGGCAGGAGAGG - Intergenic
969671111 4:8590883-8590905 TACCAAGAGAAGGCCCAGAAAGG - Intronic
973332859 4:48927308-48927330 AAGCATGAGCAGGCCCTGGGTGG - Intergenic
977974271 4:103245799-103245821 CACCATGAGCAGACCCCAACTGG + Intergenic
982644690 4:158008982-158009004 TAACAGCAGCAGGCCCTGAGAGG - Intergenic
1000335262 5:160237417-160237439 TTGCATGACTAGGCCCCGAGAGG + Intronic
1002437084 5:179238320-179238342 TCCCAGGAGCAGTCCCTGAGGGG - Intronic
1003190748 6:3872226-3872248 TATCATGAGCAGGGCCCCAAAGG + Intergenic
1005821565 6:29603606-29603628 TCCCCTGGGCAGGCCCCCAGAGG + Exonic
1021193696 7:17650895-17650917 TACTATGACCTGGCCCCGGGTGG - Intergenic
1023909616 7:44544148-44544170 TACTCTGAGAAGGTCCCGAGAGG + Intergenic
1031920842 7:127599629-127599651 TATAATGAGCAAGCCCTGAGTGG - Intronic
1037188143 8:16089747-16089769 TACCATGAGCAGTCCCCAACAGG + Intergenic
1039277931 8:35953443-35953465 TACCAGGAACAGACCCCCAGTGG + Intergenic
1041275606 8:56154931-56154953 TACAATGGGCAGACCCCAAGGGG + Intergenic
1047174229 8:122525227-122525249 TTCCATAAGAAGGCCCAGAGAGG - Intergenic
1049164876 8:141119453-141119475 CAACATGAGGAGGCCCTGAGAGG + Intronic
1049366126 8:142237736-142237758 TCCCACCAGCAGGCCCCGGGTGG + Intronic
1049558469 8:143295754-143295776 TTCCTGGCGCAGGCCCCGAGTGG + Exonic
1056605736 9:88083342-88083364 GACTTTGAACAGGCCCCGAGAGG - Intergenic
1057138949 9:92715296-92715318 GACCATGAGCAGACCCGGCGTGG - Exonic
1059591563 9:115668247-115668269 CACCATGAGCAGACCCCAACTGG + Intergenic
1060895615 9:127215356-127215378 TACCATGAGCCAGGCCAGAGAGG - Intronic
1062066220 9:134527790-134527812 TCCCATGGGCAGGCCCCGTGGGG + Intergenic
1186162885 X:6796187-6796209 GACCATAAGAAGGCCCCAAGTGG + Intergenic
1187864724 X:23713741-23713763 TACCATGCCCAGCCCCCGATTGG - Intronic
1190315340 X:49147027-49147049 TACCAGGAACAGACCCCCAGTGG - Intergenic
1192141110 X:68647742-68647764 CTCCATGAGCCGGCCCCGCGAGG - Intronic
1199894440 X:152117440-152117462 TATCATGAGCAGGGCCTCAGGGG - Intergenic
1201557363 Y:15277029-15277051 GACCATAAGAAGGCCCCAAGTGG + Intergenic