ID: 902561871

View in Genome Browser
Species Human (GRCh38)
Location 1:17282705-17282727
Sequence CTGTGCAATGAGAAGGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902561871_902561877 25 Left 902561871 1:17282705-17282727 CCAGTTACCTTCTCATTGCACAG 0: 1
1: 0
2: 0
3: 23
4: 169
Right 902561877 1:17282753-17282775 GCTGTCTAAAACACAAACCTAGG 0: 1
1: 0
2: 2
3: 14
4: 177
902561871_902561876 3 Left 902561871 1:17282705-17282727 CCAGTTACCTTCTCATTGCACAG 0: 1
1: 0
2: 0
3: 23
4: 169
Right 902561876 1:17282731-17282753 AGGGTGAGTAGCTATTGACAAGG 0: 1
1: 0
2: 0
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902561871 Original CRISPR CTGTGCAATGAGAAGGTAAC TGG (reversed) Intronic
902561871 1:17282705-17282727 CTGTGCAATGAGAAGGTAACTGG - Intronic
903041007 1:20530619-20530641 CTGTGCACTGAGAATCTGACAGG - Intergenic
905294670 1:36946693-36946715 CTGTGAAATGAGAAGGTGCATGG - Intronic
905532050 1:38687584-38687606 CTGTGTAAGGAGAGGGTAAGGGG - Intergenic
908179291 1:61588245-61588267 CTGTTACATGGGAAGGTAACAGG - Intergenic
911436159 1:97860612-97860634 TTGTGCACTGAGAATGTCACTGG - Intronic
912389238 1:109290471-109290493 CTATGCAATTAGAATGTTACTGG - Intergenic
913389621 1:118295898-118295920 CTGTGGAGAGAGAAGGTACCAGG - Intergenic
919394267 1:197024585-197024607 CTGTGCAATCAAAAGGAAAGTGG - Intergenic
920715723 1:208338299-208338321 CTGTGCAATGATAAGTTTCCTGG - Intergenic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
924193022 1:241575617-241575639 CTGTGGGCTGAGAAGATAACTGG + Intronic
1063032087 10:2245537-2245559 CTGTGCAATGTGAAGTCTACAGG - Intergenic
1063178674 10:3575549-3575571 CTGTGCAATGATAATTTTACAGG + Intergenic
1064080157 10:12301891-12301913 CTGGGCAAGGAGCAGGTTACAGG + Intergenic
1065853126 10:29807447-29807469 CTGTGGCTGGAGAAGGTAACCGG - Intergenic
1066471765 10:35705223-35705245 CTGTGCAATGAGAAGACCCCAGG - Intergenic
1067863469 10:49878068-49878090 CGGTGCACTGAGAAGGACACAGG + Intronic
1069262510 10:66415494-66415516 CTGTGAACTGAGCAGGTAAGTGG - Intronic
1069818810 10:71215020-71215042 CTGGGCAATGAGAAGGCTGCAGG - Intronic
1072407871 10:95171294-95171316 CTGTGCAATCTGAAAGAAACAGG + Intergenic
1073477735 10:103765365-103765387 CTGTGCAATTTGAGGGTGACTGG - Intronic
1073961779 10:108939459-108939481 CTGTGTAATGAGAACATGACTGG + Intergenic
1077889689 11:6410357-6410379 CTGGGCACTGACTAGGTAACTGG - Intronic
1079157822 11:17964939-17964961 CTGTACAAGGAGCAGGAAACAGG + Intronic
1083051714 11:59783021-59783043 ATGTGCAATGAGAAGGCACTGGG + Intronic
1085331302 11:75653822-75653844 GTGTGCAATGAGAAGGGCAAAGG + Intronic
1088076687 11:105857715-105857737 CTTTTCAATGAGAAGGTCATTGG - Intronic
1088712662 11:112522739-112522761 TTGAGCAATTAGAAGGGAACTGG - Intergenic
1089744621 11:120608006-120608028 CTGGGCAATGAGGAGGTCATGGG + Intronic
1089806724 11:121097275-121097297 CTGTAGACTGAAAAGGTAACAGG - Intergenic
1093391981 12:18634732-18634754 CTGGGCAATGACAGGGTGACAGG + Intronic
1093558480 12:20508126-20508148 CAGTGCAATGAGAATGTGCCTGG - Intronic
1094603893 12:31934083-31934105 CACAGAAATGAGAAGGTAACTGG - Intergenic
1095487277 12:42698455-42698477 TTGTGCAATGATAAGGAAATGGG - Intergenic
1102918225 12:116771641-116771663 CTGTGCAGAGACAAGGTAACAGG + Intronic
1105339385 13:19505746-19505768 TGGAGCAATGAGGAGGTAACAGG - Intronic
1106497472 13:30293711-30293733 CTGTGTAGGGAGAAGGGAACAGG - Intronic
1107364495 13:39655865-39655887 CTGGACAACGACAAGGTAACCGG + Exonic
1107517546 13:41145761-41145783 CTGTGCAGTGAGGAGGAACCTGG + Intergenic
1111012012 13:82325820-82325842 TCCTGCAATGAGAAGGGAACTGG - Intergenic
1112194479 13:97211756-97211778 TTGTGCAAAGAGAAGGCATCTGG - Intergenic
1113207532 13:107934325-107934347 TTGTTCAATGGGAAGATAACTGG - Intergenic
1118171065 14:63389022-63389044 CAGTGCTATGGGAAGGTCACCGG + Intronic
1118629423 14:67689216-67689238 CTGTGAGATGGGAAGGAAACTGG - Intronic
1118701468 14:68438011-68438033 CTGTACAATGAGTAGGGATCGGG + Intronic
1120431327 14:84419369-84419391 CTGTGCAAGGAGAAAGTAGCAGG - Intergenic
1120524411 14:85561068-85561090 CTGTGCAATAGAAAGGTAATGGG - Intronic
1121341747 14:93109384-93109406 CTCAGCAATGAGAAGCGAACAGG + Intronic
1121830325 14:97045912-97045934 CTGCTCAGTGAGAAGGAAACGGG - Intergenic
1122083053 14:99280190-99280212 CTGAGCTGTGAGAAGGTGACAGG + Intergenic
1125324655 15:38524571-38524593 CTTTGCAATCAGGAGGTTACTGG + Intronic
1125879715 15:43183577-43183599 CTGGGTCATGAGAAGGTAACTGG - Intronic
1126317364 15:47384519-47384541 CTGTGCAATGAGCAGTGAGCAGG + Intronic
1127581770 15:60345381-60345403 CTTTGCAAAGAGAAGGAAAAGGG - Intergenic
1129060090 15:72853846-72853868 GTGTGGAATGAGAAGGGAAGAGG - Intergenic
1132097237 15:98996727-98996749 CTGGGCAAGCAGAAGGTAAAGGG - Intronic
1132543946 16:524521-524543 CTGTGCAGTGGGATGGTCACTGG + Intergenic
1135313361 16:21422484-21422506 CTGTGCAATCTGAAAGGAACAGG + Intronic
1135366285 16:21854762-21854784 CTGTGCAATCTGAAAGGAACAGG + Intronic
1135445530 16:22516402-22516424 CTGTGCAATCTGAAAGGAACAGG - Intronic
1136152508 16:28360204-28360226 CTGTGCAATCTGAAAGGAACAGG + Intronic
1136194238 16:28640977-28640999 CTGTGCAATCTGAAAGGAACAGG - Intronic
1136210573 16:28755077-28755099 CTGTGCAATCTGAAAGGAACAGG - Intronic
1136310028 16:29401187-29401209 CTGTGCAATCTGAAAGGAACAGG + Intronic
1136323472 16:29502989-29503011 CTGTGCAATCTGAAAGGAACAGG + Intronic
1136438157 16:30242958-30242980 CTGTGCAATCTGAAAGGAACAGG + Intronic
1137865655 16:51893449-51893471 CTGTGCAAAGAGCAGATTACAGG + Intergenic
1137904426 16:52305879-52305901 CTTTCCAATGGGAAGGAAACTGG - Intergenic
1139857714 16:69993589-69993611 CTGTGCAATCTGAAAGGAACAGG + Intergenic
1142117306 16:88365809-88365831 CTCTGCCATGATAAGGTAAATGG - Intergenic
1142680982 17:1548491-1548513 CCATGCAATGAGCAGGTTACTGG + Intronic
1148077925 17:44949986-44950008 CTCTGCAATGATAAGGGTACAGG - Intergenic
1151001775 17:70385108-70385130 ATGAACAATGAAAAGGTAACGGG + Intergenic
1154119156 18:11636842-11636864 CTGTGCAATCTGAAAGGAACAGG + Intergenic
1158359748 18:56658559-56658581 ATGTGAAAACAGAAGGTAACTGG - Intronic
1159717643 18:71846856-71846878 CTGTGCAATGAGCAGTTTAGAGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1163156476 19:15442578-15442600 CTGGGGAATGAGAAGGGGACAGG - Intronic
1164070735 19:21765981-21766003 CTGTGCCTAGAGAAGGTAAAAGG + Intronic
1166264559 19:41670880-41670902 AAGTGCAATGAGAAGGAAATAGG - Intronic
1166920459 19:46225915-46225937 CAGTGCTATCAGGAGGTAACAGG + Intergenic
925005786 2:442147-442169 CTGTGCTGTGAGATGGTCACTGG + Intergenic
925005799 2:442240-442262 CTGTGCTATGAGATGGTCACTGG + Intergenic
925005811 2:442333-442355 CTGTGCTATGAGATGGTCACTGG + Intergenic
925005826 2:442426-442448 CTGTGCTGTGAGATGGTCACTGG + Intergenic
925005853 2:442613-442635 CTGTGCTATGAGATGGTCACTGG + Intergenic
925005880 2:442800-442822 CTGTGCTATGAGATAGTCACTGG + Intergenic
925005892 2:442893-442915 CTGTGCTATGAGATGGTCACTGG + Intergenic
925005907 2:442986-443008 CTGTGCTGTGAGATGGTCACTGG + Intergenic
925360823 2:3278836-3278858 CTGTGCAGGGAGGAGGTCACGGG + Intronic
927061653 2:19428588-19428610 CTGTGAAATGAGAATTTAAAAGG - Intergenic
927697748 2:25249619-25249641 CTGTGCAATGGGAGAATAACTGG - Intronic
928243900 2:29610687-29610709 CTGTGAAAGGAAAAGGTCACTGG + Intronic
928570987 2:32608437-32608459 CTGGGCAACGAGAACGAAACGGG - Intronic
930494174 2:52117978-52118000 CTGTGCACTGAGAAGGGAAAGGG - Intergenic
931761016 2:65417032-65417054 CTGTGCACTTAGAAGCCAACAGG - Intronic
931835333 2:66093032-66093054 ATCTGCTAGGAGAAGGTAACTGG + Intergenic
937352932 2:121178468-121178490 CTGTGCAGTCAGAAGGTGCCTGG + Intergenic
937491990 2:122379397-122379419 CTCTGCAATGAAAAAGTAACTGG + Intergenic
939119775 2:138102308-138102330 CTGTGGAGGCAGAAGGTAACAGG - Intergenic
940716492 2:157230848-157230870 GTGTGCAAGGAGAAGGAAGCAGG - Intergenic
943162808 2:184277512-184277534 CTGTGCATTGTGAAGGAAGCAGG + Intergenic
944353418 2:198757204-198757226 CTTTGCAATAAGGAGGTAACTGG - Intergenic
945556961 2:211288777-211288799 CTGTGCAAAGAAAAGTAAACTGG - Intergenic
945577014 2:211544013-211544035 CTGTGCAGTGAGACTTTAACTGG - Intronic
946792518 2:223315690-223315712 ATTTGCAATGCGAAGCTAACAGG - Intergenic
948091998 2:235302468-235302490 GTGTGCACTGAGGTGGTAACTGG - Intergenic
1169005229 20:2201102-2201124 CTGTGAAATGCTCAGGTAACTGG + Intergenic
1169648824 20:7843915-7843937 CTGAGCAATCAGAAGGTATCAGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1172032889 20:31994155-31994177 CTGGGCACTGAGAAGGGAACAGG + Intronic
1172101796 20:32488318-32488340 CTGTGCATTGCGATGGTACCAGG - Intronic
1173404570 20:42753535-42753557 CTGTTCAATGTGAAGGAGACTGG + Intronic
1173518700 20:43683277-43683299 CTGTGCCCTGTGAAGGTCACAGG - Intronic
1177286367 21:19056718-19056740 CTGTGCACTGACAATGTACCTGG + Intergenic
1177731433 21:25031822-25031844 CTGTGCAATGAGAAACAAAATGG - Intergenic
1178735128 21:35142225-35142247 CTGAGGCATGAGGAGGTAACAGG + Intronic
1179354208 21:40643452-40643474 CTGTGCACTGAGAAGCTCTCAGG + Intronic
1181362972 22:22352963-22352985 CTGTGCAGTGAGAGAGGAACAGG - Intergenic
1181365778 22:22376037-22376059 CTGTGCAGTGAGAGAGGAACAGG - Intergenic
1181913262 22:26257357-26257379 CTGTAAAATGAGAAGTTAAATGG - Intronic
1185250604 22:49799694-49799716 CTGTCCACTGAGAAGGGAGCAGG - Intronic
949265819 3:2155282-2155304 CTCTGCAATCAGAAGGTAAGAGG - Intronic
951595987 3:24318617-24318639 CTGGGCATTGAGAAAGCAACAGG - Intronic
953581623 3:44162505-44162527 CTGTGCAATAAGAGAGGAACAGG + Intergenic
956173519 3:66452116-66452138 CTGTGAAATAACAAGGGAACTGG + Intronic
957216149 3:77321979-77322001 CTGAGCAATCAGGAGATAACAGG + Intronic
957590912 3:82196689-82196711 CTGTTCAATGACAAGTTCACAGG + Intergenic
965211479 3:165795475-165795497 CTGTGCATAGAGAATGTAAGAGG + Intronic
966294475 3:178403053-178403075 CTATGAAATGAGAAGGAAAGGGG - Intergenic
966389608 3:179438238-179438260 CTGTGGAATGAGAATGATACTGG - Intronic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
973534667 4:51868419-51868441 CTGGGCACTTACAAGGTAACAGG - Intronic
975902133 4:79165474-79165496 CTGTGCAAAGGGAGAGTAACAGG - Intergenic
979134401 4:117090934-117090956 CTGTCCAATGACAAGGAAGCAGG + Intergenic
985819867 5:2152320-2152342 CTGTGCAATGAGAGTGTAAATGG - Intergenic
985819870 5:2152355-2152377 CTGTGCAATGAGAGTGTAAATGG - Intergenic
985819873 5:2152390-2152412 CTGTGCAATGAGAGTGTAAATGG - Intergenic
985819876 5:2152425-2152447 CTGTGCAGTGAGAGTGTAAATGG - Intergenic
985819879 5:2152460-2152482 CTGTGCAGTGAGAATGTAAATGG - Intergenic
985819882 5:2152495-2152517 CTGTGCAGTGAGAGTGTAAATGG - Intergenic
985819888 5:2152565-2152587 CTGTGCAGTGAGAGTGTAAATGG - Intergenic
986301982 5:6484513-6484535 CTTTGCAACGAGTAGGAAACTGG - Intronic
992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG + Intergenic
993635067 5:90333131-90333153 CTGTGAAATGAGAATGTTAAAGG - Intergenic
997781606 5:136665021-136665043 CTTTTCACTGAGAAGGAAACTGG - Intergenic
999305780 5:150518510-150518532 TTGTGAAATGAGGAGGTGACTGG - Intronic
1002829956 6:811194-811216 CTCTGCAATATGAAGGTATCAGG + Intergenic
1006553481 6:34845292-34845314 CTGAGCAAAGAGAAGAAAACTGG - Intronic
1006637676 6:35472211-35472233 CTTTGCAATCAGAAGGAAAAGGG + Intergenic
1010559868 6:77335273-77335295 CTGAGCAAAGAGAACGAAACTGG - Intergenic
1012964225 6:105656135-105656157 CTGGGCAATGAAAGGGTAGCTGG - Intergenic
1017248086 6:152249388-152249410 CTGTGCTATGGGAAGGTAAAAGG + Intronic
1017470249 6:154732271-154732293 CTGGCTACTGAGAAGGTAACAGG - Intergenic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021828266 7:24574918-24574940 CTGTGCAATGATAGGGTAGTGGG + Intronic
1024996288 7:55275326-55275348 CTGTGCAGTGGGAAGGGAAAGGG - Intergenic
1030333143 7:108294640-108294662 TTGTGCAATGGGAAGGAAAATGG + Intronic
1031895758 7:127346823-127346845 CTGTGAAAGGAGAGGGGAACTGG + Intronic
1031972269 7:128073452-128073474 GTGTGCAGAGAGAAGGTAGCGGG - Intronic
1032540352 7:132697707-132697729 ATGTGCAAGGAGAAGGGAAAGGG + Intronic
1032737029 7:134702040-134702062 CTGTGAGATGACAAGGTCACAGG + Intergenic
1034116894 7:148591524-148591546 CTAGGCAAGGAGAAGGGAACAGG - Intronic
1036505003 8:9347290-9347312 CTCTGCAGTGAGAAGTTAAGTGG - Intergenic
1037403992 8:18522365-18522387 CTGTGGAATGAAATGTTAACTGG - Intergenic
1038125752 8:24671037-24671059 ATGTACAATGATAAGGAAACAGG + Intergenic
1041378098 8:57222791-57222813 TTCTGCAATGAGAAGGGAACTGG + Intergenic
1043767513 8:84155418-84155440 CTGTGGGATGAGAAGCCAACAGG - Intergenic
1045175463 8:99718994-99719016 CTGTGCATTAAAAAGGAAACTGG - Intronic
1047367222 8:124222648-124222670 CAGTGGAAGGAGAGGGTAACAGG - Intergenic
1051332746 9:16040117-16040139 CTGTGGAGTGAGGGGGTAACAGG - Intronic
1052015088 9:23453784-23453806 TTTTACAAAGAGAAGGTAACAGG + Intergenic
1055709616 9:79045630-79045652 CTTTGGAATGAGAAGGTACTTGG + Intergenic
1055979962 9:81991671-81991693 CTGAGAAATGAGATGTTAACAGG - Exonic
1057828334 9:98388302-98388324 CTGTGAAATGAGGAGTTATCCGG + Intronic
1058150713 9:101460634-101460656 CTGTGTAATTAGAAAGTAACTGG + Intergenic
1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG + Intronic
1059958249 9:119540852-119540874 CTTTGTAATGAGATTGTAACTGG - Intergenic
1060716323 9:125933169-125933191 CTCTGCACTGAGAAGGCAAGGGG + Intronic
1061547851 9:131315143-131315165 CTGTGCTTTGGGAAGGTCACTGG + Intergenic
1188875016 X:35418770-35418792 CTGTGCTTAGAGAAGGTAACTGG + Intergenic
1195244177 X:102980815-102980837 CTGGGCAGGGAGAAGGCAACTGG - Intergenic
1195872098 X:109497360-109497382 CTGAGCAAAGAGAACGAAACTGG - Intergenic
1195890252 X:109685660-109685682 CAGTGAAATGAGAAAGAAACTGG + Intronic
1197258127 X:124286383-124286405 CTGGGCAATAAAAAGGTCACTGG - Intronic
1197534345 X:127668817-127668839 GCTTGTAATGAGAAGGTAACTGG - Intergenic
1197853377 X:130888970-130888992 CTGGGCAATGAGGATGTAACAGG - Intronic
1197941788 X:131797817-131797839 CTGTACCAGGAGAAGGGAACTGG - Intergenic
1199426531 X:147707989-147708011 GAGTGCAATTAGAAAGTAACTGG - Intergenic
1199898386 X:152148592-152148614 CTGTTCAATGATAAGGCAGCGGG - Intergenic
1202015866 Y:20406031-20406053 TTCTGCAATGAGAAGAAAACTGG + Intergenic