ID: 902563958

View in Genome Browser
Species Human (GRCh38)
Location 1:17297659-17297681
Sequence CCAGCCAGTGACATTGACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902563958_902563965 25 Left 902563958 1:17297659-17297681 CCATAGTCAATGTCACTGGCTGG No data
Right 902563965 1:17297707-17297729 TCTCTGCACGAAGGTACCTGAGG No data
902563958_902563961 -7 Left 902563958 1:17297659-17297681 CCATAGTCAATGTCACTGGCTGG No data
Right 902563961 1:17297675-17297697 TGGCTGGGAACACGAACATCAGG No data
902563958_902563962 16 Left 902563958 1:17297659-17297681 CCATAGTCAATGTCACTGGCTGG No data
Right 902563962 1:17297698-17297720 ACCTACCATTCTCTGCACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902563958 Original CRISPR CCAGCCAGTGACATTGACTA TGG (reversed) Intergenic
No off target data available for this crispr