ID: 902566392

View in Genome Browser
Species Human (GRCh38)
Location 1:17314407-17314429
Sequence CCATTTATGATACACCTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902566392_902566400 23 Left 902566392 1:17314407-17314429 CCAGGTAGGTGTATCATAAATGG 0: 1
1: 0
2: 0
3: 10
4: 87
Right 902566400 1:17314453-17314475 AGAGCCACTGGGGCATCTCCTGG 0: 1
1: 0
2: 0
3: 26
4: 250
902566392_902566403 28 Left 902566392 1:17314407-17314429 CCAGGTAGGTGTATCATAAATGG 0: 1
1: 0
2: 0
3: 10
4: 87
Right 902566403 1:17314458-17314480 CACTGGGGCATCTCCTGGCCGGG 0: 1
1: 0
2: 0
3: 24
4: 350
902566392_902566396 11 Left 902566392 1:17314407-17314429 CCAGGTAGGTGTATCATAAATGG 0: 1
1: 0
2: 0
3: 10
4: 87
Right 902566396 1:17314441-17314463 CAGAAATGCACCAGAGCCACTGG 0: 1
1: 0
2: 1
3: 16
4: 215
902566392_902566402 27 Left 902566392 1:17314407-17314429 CCAGGTAGGTGTATCATAAATGG 0: 1
1: 0
2: 0
3: 10
4: 87
Right 902566402 1:17314457-17314479 CCACTGGGGCATCTCCTGGCCGG 0: 1
1: 0
2: 0
3: 20
4: 221
902566392_902566397 12 Left 902566392 1:17314407-17314429 CCAGGTAGGTGTATCATAAATGG 0: 1
1: 0
2: 0
3: 10
4: 87
Right 902566397 1:17314442-17314464 AGAAATGCACCAGAGCCACTGGG 0: 1
1: 0
2: 0
3: 20
4: 168
902566392_902566398 13 Left 902566392 1:17314407-17314429 CCAGGTAGGTGTATCATAAATGG 0: 1
1: 0
2: 0
3: 10
4: 87
Right 902566398 1:17314443-17314465 GAAATGCACCAGAGCCACTGGGG 0: 1
1: 0
2: 2
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902566392 Original CRISPR CCATTTATGATACACCTACC TGG (reversed) Intronic
900803131 1:4749723-4749745 CCCTTCATGAAACACCTGCCTGG - Intronic
902566392 1:17314407-17314429 CCATTTATGATACACCTACCTGG - Intronic
904835596 1:33333642-33333664 TCATTTCTGATACACGTATCTGG + Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
912919724 1:113854296-113854318 CCCTTTAAGACCCACCTACCTGG + Intronic
915736237 1:158087382-158087404 CAATTTATTACACACCTACCAGG - Intronic
918875730 1:190040304-190040326 CAATTTATGATGCACTTATCAGG - Intergenic
1063365485 10:5487810-5487832 CCATTTATGTTACATCTCCTGGG + Intergenic
1068344208 10:55750309-55750331 TCATTTATTATACACTTACATGG + Intergenic
1071928392 10:90437309-90437331 TCAATTCTGATACATCTACCTGG - Intergenic
1074177382 10:111022802-111022824 CCATTTTTGATACCCCTCCAAGG - Intergenic
1075904017 10:126065016-126065038 CCATTTATGACACATGCACCCGG + Intronic
1079789859 11:24723129-24723151 CCCTTTATGAGTCACCAACCAGG + Intronic
1079994307 11:27279476-27279498 CCATTTATTATAAAGCTAGCTGG - Intergenic
1081039991 11:38198343-38198365 CCATTGAAGATACACTGACCAGG - Intergenic
1082950324 11:58807969-58807991 CCATTTATGATATATTCACCAGG - Intergenic
1086501706 11:87460509-87460531 CCATTTATGAAACTGCTAACTGG + Intergenic
1089385939 11:118068126-118068148 CCATGTATGATTCATCTCCCCGG + Intergenic
1090935322 11:131336672-131336694 TCATTTCTAATACACATACCTGG + Intergenic
1105022233 12:132824726-132824748 CCATTTATCACCCACCCACCCGG - Intronic
1107898873 13:44992380-44992402 ATATTTCTGATACACCTATCTGG - Intronic
1108561287 13:51646593-51646615 ACATTTATCAAACACCTACTAGG - Intronic
1110608538 13:77462119-77462141 CTGTTTATCATAGACCTACCTGG + Intergenic
1112716487 13:102192006-102192028 CCATTTATTCTAGACCTACAGGG + Intronic
1115881670 14:37926394-37926416 CCATGTATAATACACCTTCCAGG + Intronic
1116578440 14:46606219-46606241 TCATTTTTGATACACCTAATGGG - Intergenic
1117502741 14:56370115-56370137 CCATTTATGACAAACCCACTGGG - Intergenic
1120875616 14:89372366-89372388 CCATTGATGATGCACTTACAAGG - Intronic
1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG + Intronic
1122111017 14:99502626-99502648 TCAGTTATGATACCCCTACGAGG - Exonic
1122164059 14:99807875-99807897 ACATTTATGAGATACCTACTAGG - Intronic
1125396229 15:39251145-39251167 CCATTTATTAGGCACCTACCAGG - Intronic
1126574041 15:50180775-50180797 TCATTTCTGATCCAGCTACCTGG - Intronic
1126721203 15:51582106-51582128 CCATTTATTAAAAACCTACTGGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1128794658 15:70456659-70456681 CTATTTATCATAAACCTACTAGG + Intergenic
1130200001 15:81816852-81816874 CCTTAAATGATACACCCACCTGG + Intergenic
1133762974 16:8814402-8814424 GCATTTATGATGCACCTGCTAGG - Intronic
1138921226 16:61531581-61531603 GCATTAAAGATACACATACCAGG - Intergenic
1140932828 16:79643548-79643570 ACATTTATGATACAACCAGCAGG - Intergenic
1141460826 16:84177848-84177870 CCATTTATGCTACATATAACTGG - Exonic
1146780756 17:35669582-35669604 CCAGTTATGAAGCACCTACCAGG + Intronic
1147401714 17:40184286-40184308 CCATTTCTTGGACACCTACCAGG + Exonic
1149202138 17:54199184-54199206 ACATTTATGATACATGTGCCTGG - Intergenic
1151373480 17:73665928-73665950 GGATTTATGAAACACCTACTAGG - Intergenic
1155881422 18:31153791-31153813 CCATTTCTGATGCATCTTCCTGG + Intronic
1156102916 18:33620077-33620099 CCATTTATTATACTCCCACTGGG + Intronic
1157633245 18:49122158-49122180 CCATATATAACACATCTACCAGG - Intronic
1161255464 19:3306646-3306668 ACATTTATGAAGCACCTACTGGG + Intergenic
1162411062 19:10505600-10505622 CCATTTATTATTCACTTACATGG - Intergenic
1163096119 19:15058390-15058412 CCATTCATGATAGACACACCTGG - Intergenic
1164193686 19:22934486-22934508 CCATTTTTGACACATCTTCCTGG + Intergenic
925325716 2:3020398-3020420 CCATTTAGAACCCACCTACCTGG - Intergenic
925896095 2:8473434-8473456 CCATTTATGGAATACCTACTTGG + Intergenic
926025217 2:9537193-9537215 CCATTTATTGAACACCTACTTGG + Intronic
932557816 2:72841107-72841129 CCATTTATGAAGCACCTGCTGGG + Intergenic
940721680 2:157289592-157289614 GCAATTAAGATACACCTAGCTGG - Intronic
940887397 2:159001578-159001600 CCATTTATGAAACCCTTTCCTGG + Intronic
942714511 2:178876088-178876110 CCATTCTTGATAAACCTACTTGG - Intronic
944917242 2:204373614-204373636 ACATTTATTAAACACATACCTGG - Intergenic
1171115764 20:22523649-22523671 TCATTTAGGATACAACTACCAGG + Intergenic
1171238397 20:23546268-23546290 CCATTTCTGAGACAGCTCCCAGG - Intergenic
1173114541 20:40228325-40228347 CCATTCATGATGCACACACCAGG - Intergenic
1175197988 20:57258911-57258933 CCATTTGTTTTACACCTACTAGG + Intronic
1178812385 21:35895951-35895973 CCACTTATTAAACATCTACCCGG - Intronic
1181876874 22:25946351-25946373 ACATTTATTGTAAACCTACCAGG + Intronic
1183808744 22:40236401-40236423 CCATTAATAATACACCAACTTGG - Intronic
953720716 3:45352496-45352518 CCATTTATTAAGCACCTGCCTGG + Intergenic
959166050 3:102779742-102779764 CCATTTATGCTACTCCTTCCTGG - Intergenic
960291401 3:115889578-115889600 CCATTTATGTTATACATAACTGG - Intronic
964310470 3:155386577-155386599 CCATTAATGAGACACATTCCAGG - Intronic
974240950 4:59246203-59246225 GCATTTATCATTCACTTACCAGG - Intergenic
978479774 4:109176047-109176069 ACATTTATCAGACACCTACCAGG + Intronic
986170995 5:5314437-5314459 CCATTTAGAATTCACCTTCCAGG - Intronic
988557289 5:32248230-32248252 CCATTTAATCTTCACCTACCAGG + Intronic
990474344 5:56147090-56147112 TCATTTTTCATACACCTACTTGG + Intronic
998439151 5:142141818-142141840 CAATTTATTAAACACCTGCCAGG - Intronic
1002080138 5:176732859-176732881 ACATTTATCAAGCACCTACCAGG + Intergenic
1003744274 6:8981931-8981953 CCATTTGAGATCCAGCTACCTGG + Intergenic
1005238069 6:23789325-23789347 CCATCTATGTTACAGCTACTTGG - Intergenic
1007772332 6:44201713-44201735 ATATTTATGAGACACCTACCTGG + Intergenic
1011748526 6:90432390-90432412 ACATTTATTAAACACCTACTAGG - Intergenic
1012294323 6:97501680-97501702 CCATTTATCAAACACCGACCAGG + Intergenic
1016382778 6:143501967-143501989 CTATTTATGAAACCCATACCTGG - Exonic
1018742377 6:166739988-166740010 ATATTTATGGGACACCTACCAGG + Intronic
1018881889 6:167891916-167891938 CCATATATCATACACATAACTGG - Intronic
1018891652 6:167987234-167987256 AAATTTATGGTACACCCACCTGG - Intergenic
1023247287 7:38218645-38218667 GCATGTATGACACACATACCTGG + Intronic
1026794306 7:73356514-73356536 CTATTTGAGATACACCAACCTGG - Intronic
1027724045 7:81780761-81780783 TCATATATGATGGACCTACCTGG - Intergenic
1027883157 7:83868966-83868988 CCATTTATCAAACTCCTACTGGG + Intergenic
1037251645 8:16902314-16902336 TCATTTATGAGAAACCTCCCTGG - Intergenic
1038315953 8:26484535-26484557 CCACTTATGGACCACCTACCTGG + Intronic
1056709814 9:88982695-88982717 CCATTTATGATAAAACTCTCAGG - Intergenic
1059339013 9:113586925-113586947 CCATTTATGCAGCACCCACCAGG - Intronic
1188115267 X:26234778-26234800 AAATCTATGATATACCTACCAGG + Intergenic
1196745807 X:119070861-119070883 ACATTTATCAAACACCGACCTGG + Intergenic
1198676617 X:139138087-139138109 CCATTTATGAAGCACTTACTGGG + Intronic