ID: 902566441

View in Genome Browser
Species Human (GRCh38)
Location 1:17314676-17314698
Sequence GACCTTGGGCTGCTTCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902566441_902566448 19 Left 902566441 1:17314676-17314698 CCTGTCAGAAGCAGCCCAAGGTC 0: 1
1: 0
2: 2
3: 14
4: 166
Right 902566448 1:17314718-17314740 TCGAGGCTGCCTGCTGCTCCTGG 0: 1
1: 0
2: 5
3: 24
4: 255
902566441_902566449 24 Left 902566441 1:17314676-17314698 CCTGTCAGAAGCAGCCCAAGGTC 0: 1
1: 0
2: 2
3: 14
4: 166
Right 902566449 1:17314723-17314745 GCTGCCTGCTGCTCCTGGCCTGG 0: 1
1: 0
2: 11
3: 57
4: 640
902566441_902566452 30 Left 902566441 1:17314676-17314698 CCTGTCAGAAGCAGCCCAAGGTC 0: 1
1: 0
2: 2
3: 14
4: 166
Right 902566452 1:17314729-17314751 TGCTGCTCCTGGCCTGGCCTGGG 0: 1
1: 1
2: 2
3: 68
4: 604
902566441_902566451 29 Left 902566441 1:17314676-17314698 CCTGTCAGAAGCAGCCCAAGGTC 0: 1
1: 0
2: 2
3: 14
4: 166
Right 902566451 1:17314728-17314750 CTGCTGCTCCTGGCCTGGCCTGG 0: 1
1: 1
2: 11
3: 111
4: 791
902566441_902566444 2 Left 902566441 1:17314676-17314698 CCTGTCAGAAGCAGCCCAAGGTC 0: 1
1: 0
2: 2
3: 14
4: 166
Right 902566444 1:17314701-17314723 TGCCTCTCTCACTCCCTTCGAGG 0: 1
1: 0
2: 3
3: 31
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902566441 Original CRISPR GACCTTGGGCTGCTTCTGAC AGG (reversed) Intronic
900438051 1:2640806-2640828 GACCTGGGGCTGCTTCTTCAAGG + Intronic
900673631 1:3870718-3870740 TCCCTGGGGCCGCTTCTGACTGG - Intronic
901440266 1:9273424-9273446 GACCTTGCCCTGCTTCTGCGTGG - Intergenic
901574974 1:10193404-10193426 CACCCTGGGTTGCTTTTGACAGG + Intergenic
902566441 1:17314676-17314698 GACCTTGGGCTGCTTCTGACAGG - Intronic
904447382 1:30586135-30586157 GGGCTTGGGGTGCATCTGACTGG - Intergenic
904996825 1:34637884-34637906 GACCATGGGCTGGTTCTGGCCGG - Intergenic
905851226 1:41276609-41276631 GACTGTGGGCTACTTCAGACAGG - Intergenic
906113094 1:43337740-43337762 GACGTGGGGCTGTATCTGACAGG + Intergenic
908269011 1:62404866-62404888 CACCCTGGGCTGCCTCTCACAGG + Intergenic
911285356 1:95984967-95984989 TTCCATGGGCTGCTACTGACTGG + Intergenic
915313651 1:155016699-155016721 GGCCTTGTGCTGCTTCAGTCTGG - Exonic
915530259 1:156499143-156499165 GACCTTGGGCTGCTCTGGCCTGG - Intronic
916422017 1:164646497-164646519 GACCTGTGGATGCTTCTGATGGG + Intronic
921055822 1:211541711-211541733 GACCATGGGTTGCTTCTGGTGGG - Intergenic
922768347 1:228167653-228167675 GGCCTGGGGCTGCTTTTGTCTGG + Intronic
922950716 1:229556913-229556935 GACTTTGAGCTGCTTGAGACGGG - Intronic
922978729 1:229806650-229806672 GACCGTGGGCTGGTTCTGGCTGG - Intergenic
924700547 1:246447732-246447754 GAGATGGGGCTGCTTCTAACTGG - Intronic
1062847279 10:717747-717769 GGCCATGGGCTGCCTCTGTCCGG - Intergenic
1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG + Intergenic
1067136713 10:43615047-43615069 GAATGTGGGCTGTTTCTGACTGG + Intronic
1067804824 10:49385286-49385308 AGCCTGGGGCTGCTTCTGAGTGG - Intronic
1068517049 10:58037917-58037939 TACCTTTGGCTTCTTCTGGCTGG - Intergenic
1070642052 10:78177319-78177341 ATCCTTGGGCTGCTTTTGACGGG + Intergenic
1074386691 10:113022184-113022206 GCCCTTGGGCAGCTGCTGCCAGG + Intronic
1076233261 10:128839358-128839380 AGCCCTGGCCTGCTTCTGACAGG - Intergenic
1076395356 10:130134892-130134914 CACTTGGGGCTCCTTCTGACTGG - Intergenic
1076638317 10:131897793-131897815 GACCTTGGACTGGTTCTGGCCGG + Intergenic
1077142366 11:1030216-1030238 CACCTTCGGGTGCTTCTGCCCGG - Exonic
1078517632 11:12037464-12037486 GGTCCTGGGCTGCTTCTGTCTGG - Intergenic
1078927121 11:15885072-15885094 GAGCAGGGGCTGCTTCTTACAGG - Intergenic
1080557498 11:33430742-33430764 CTCCCAGGGCTGCTTCTGACAGG - Intergenic
1083736381 11:64683836-64683858 GACCCTCGGCTGCTTCTTCCTGG - Intronic
1084877851 11:72146807-72146829 AACCATGGGCTGGTTCTGGCTGG + Intergenic
1085033130 11:73284554-73284576 GCCCTGGGGCTGCTTCTGCCTGG - Intronic
1090557360 11:127890830-127890852 GACCAGGGCCTGCTGCTGACTGG - Intergenic
1090667227 11:128922611-128922633 GGCGTTGGTCTTCTTCTGACTGG - Intergenic
1090788883 11:130072443-130072465 AACCTTGGTGTGCTTCTGATAGG + Intronic
1091035445 11:132228721-132228743 GCCCCTGTGCTGCTTCTGAGCGG + Intronic
1092970864 12:13693533-13693555 AACCCAGGGCTGCTTCTCACAGG + Intronic
1093805637 12:23430035-23430057 GAACAGGGGCTGCTTCTGCCAGG - Intergenic
1095426027 12:42075485-42075507 GACCATGGGCTGGTTCTGGATGG + Intergenic
1098114062 12:67155874-67155896 GACCATGGACTGGTTCTGGCTGG - Intergenic
1098546965 12:71722040-71722062 GACCATGGGCTGTTTCTGGCCGG + Intergenic
1101901313 12:108792906-108792928 GACCTTGGGCAGCCCCTCACTGG - Intronic
1103336984 12:120197050-120197072 CTGCTTGGGCTGCTTCTGACAGG - Intronic
1104241707 12:126996306-126996328 GACCATGGACTGGTTCTGGCTGG - Intergenic
1107124525 13:36831951-36831973 GACGTTAGGATGCTTCTGAAAGG + Intergenic
1108889997 13:55245201-55245223 GACCTGTGGCTGCTACTGCCTGG - Intergenic
1112302316 13:98241243-98241265 GTCCTTGGGGTGCTGCTGGCAGG + Intronic
1113058807 13:106299066-106299088 GATCTTGGGCTTCTACTGCCCGG + Intergenic
1113508959 13:110836695-110836717 GACCATGGCCTGGTTCTGGCTGG - Intergenic
1113727923 13:112618806-112618828 GAACTTGGACTTCTGCTGACCGG - Intergenic
1115880387 14:37910543-37910565 GACCTTGGGCTGCCTCCCAATGG - Intronic
1117247288 14:53898860-53898882 TATCTTCGGATGCTTCTGACTGG + Intergenic
1117548006 14:56808982-56809004 GACCTTCGGATGGTTCTTACTGG + Intronic
1117636465 14:57749654-57749676 GGGCTTGGGCAGCTTCTGAGAGG - Intronic
1118715079 14:68553768-68553790 GACCTTTGGCTGGATCTGTCAGG - Intronic
1118772614 14:68952260-68952282 AGCCCTGGGCAGCTTCTGACAGG + Intronic
1119989169 14:79175681-79175703 AACCGTGGGCTGCTTCAGAGTGG + Intronic
1121339411 14:93096246-93096268 GAGCTGTGGCTGCTGCTGACAGG - Intronic
1122267885 14:100555128-100555150 ACCCTTGGGATGCCTCTGACGGG + Intronic
1122918825 14:104871276-104871298 GAGCTTGGGATGCCTCTGAGAGG - Intronic
1122984941 14:105207698-105207720 CACCTTGGGCAGGTTCTGCCTGG - Intergenic
1123477431 15:20599420-20599442 GACCCAGGGCTGTCTCTGACAGG - Intergenic
1123640585 15:22400962-22400984 GACCCAGGGCTGTCTCTGACAGG + Intergenic
1132359402 15:101200369-101200391 GAGCCTGGCCTGCTTCTCACAGG + Intronic
1132747723 16:1443925-1443947 GACCTGGGGCTCCTCCTGGCAGG - Exonic
1132953250 16:2576873-2576895 GCCCGTGGGCCGCTTCTGAGTGG - Intronic
1132961102 16:2623295-2623317 GCCCGTGGGCCGCTTCTGAGTGG + Intergenic
1133631808 16:7629148-7629170 GGCCCTGGGCTGCTTCTCCCTGG + Intronic
1135208575 16:20503897-20503919 GCTCTTGGGCTGCTGCTGAGAGG - Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143253227 17:5537781-5537803 AAACCTGGGCTGCTTCTGAGGGG - Intronic
1143416735 17:6756167-6756189 GACATAGGGCTGTTTCTGAAGGG + Intronic
1143735359 17:8908446-8908468 AACCTTGGGCATCTTCTTACAGG + Intronic
1144575961 17:16429687-16429709 GAGCTTGGGGTGCTTGGGACAGG + Intronic
1146765788 17:35520309-35520331 AACCATGGACTGCTTCTGGCTGG + Intronic
1149881645 17:60297975-60297997 GACCATGGACTGGTTCTGGCTGG + Intronic
1150815841 17:68391216-68391238 GACTTTGGGCTGCATGTGCCAGG + Intronic
1151227892 17:72660260-72660282 GACCTCGGGCTGCCTCTGATGGG - Intronic
1151402373 17:73864258-73864280 GGCCTTGGCCTGCTGCTGGCCGG - Intergenic
1152739067 17:82011233-82011255 GACCTTGGGCTGCTGCCGCCCGG - Intronic
1155057034 18:22194147-22194169 GAGCTTGGGCTGCTACAGATTGG - Intronic
1156180266 18:34595790-34595812 GACTTTGGTTTGCTTCTGCCAGG + Intronic
1156813486 18:41280542-41280564 GACCATGGACTGCTTTTGGCAGG - Intergenic
1156850357 18:41718784-41718806 GACCTTGTGCTGCATTTTACTGG - Intergenic
1158346829 18:56524433-56524455 GATCTTGGGCAGCTGCTGATAGG - Intergenic
1158807648 18:60994207-60994229 GACCTTGGGCTTCTTCTAGTGGG + Intergenic
1162863646 19:13527136-13527158 GACATGGGGCTGCTTCTGCTGGG + Intronic
1164500096 19:28812013-28812035 GACCTTGGACTGTTTTTGAGTGG + Intergenic
1165286782 19:34849396-34849418 AACCATGGGCTGGTTCTGGCTGG - Intergenic
1165876752 19:39013251-39013273 CCCCTCTGGCTGCTTCTGACAGG - Intronic
1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG + Intronic
1168380034 19:55912497-55912519 CACCTTCGGCTGCTTCAGACAGG + Exonic
924986063 2:271054-271076 GACCTTGGGCTGCTAATGCCTGG + Intronic
925600595 2:5605091-5605113 GGCCCTGGGAGGCTTCTGACAGG - Intergenic
926541064 2:14182423-14182445 GGCCTGGGGCAGGTTCTGACCGG - Intergenic
928414871 2:31083774-31083796 GACCTTGGGCTGCCTAGCACAGG - Intronic
928819565 2:35343548-35343570 GACCATGGGCTCCTTCTGTGGGG - Intergenic
932214493 2:69958240-69958262 GACCATGTGGTGCTTCTTACTGG - Intergenic
934967837 2:98738249-98738271 CACCTTGGGCTGCTTGTAGCTGG - Intergenic
940987663 2:160064383-160064405 GACATTGGGCTACCTCTCACTGG + Intergenic
942133961 2:172906998-172907020 GGCCTGGGGCTGCTCCTGCCTGG - Intronic
944572538 2:201059113-201059135 GACTTTGGACTGTGTCTGACTGG + Intronic
946990884 2:225328273-225328295 GACCATGGACTGGCTCTGACTGG - Intergenic
1170791418 20:19512337-19512359 GACTTTGGGCAGCTTCTGGGTGG + Intronic
1172310518 20:33914625-33914647 GACCATGGGTTGCTTCTGACTGG + Intergenic
1175982301 20:62744831-62744853 GGCATTCGGCTGCTTCTGAGAGG + Intronic
1176085176 20:63292641-63292663 GACCCTGGGCTGCTCCCAACTGG - Intergenic
1177290222 21:19101793-19101815 GACCTTGTACTTCTTCTTACTGG + Intergenic
1179302823 21:40127933-40127955 GGCCTTGGGATGCCTCTGTCTGG + Intronic
1179504332 21:41830920-41830942 GACCTGGGGCTGCTGCTGCAGGG - Intronic
1182255864 22:29037890-29037912 GGCCTTTGGCTGCTTCTGGGAGG + Intronic
1184477947 22:44731596-44731618 GACCTTGGGCAGGTGCTGCCAGG + Intronic
1184839844 22:47046222-47046244 GACGGTGGACTGTTTCTGACAGG + Intronic
950613810 3:14143017-14143039 TTCCTAGGGCTGCTTCTGAGTGG + Exonic
950655089 3:14431597-14431619 GATCTTGGGCTGGTTCTGGATGG + Intronic
952384916 3:32833446-32833468 GTCCTTAATCTGCTTCTGACTGG + Intronic
952509949 3:34042943-34042965 GACATTGGGCTGCTACTAAAAGG + Intergenic
953308532 3:41853753-41853775 GACCATGGACTGGTTCTGGCCGG + Intronic
953359430 3:42281802-42281824 GACCATGGACTGGTTCTGGCTGG + Intergenic
953745980 3:45574411-45574433 GACCATGGGCTAGTTCTGGCTGG + Intronic
954073321 3:48158911-48158933 AAGCTTGGGCTGCTGCTGGCTGG + Exonic
956203247 3:66729280-66729302 GTCCATGGGCAGCATCTGACTGG - Intergenic
957042209 3:75344434-75344456 GGCCTGGTGCTGCTTCTGATCGG + Intergenic
961324775 3:126103617-126103639 AGCCAAGGGCTGCTTCTGACTGG + Exonic
961366025 3:126399953-126399975 GATCATGGCCTGCTTCTGAGGGG + Intronic
961412191 3:126730514-126730536 GACCCTGGGGTGCCACTGACAGG + Intronic
962920539 3:139946534-139946556 GACCTTGGGATGCTACTGGGAGG + Intronic
966155926 3:176916582-176916604 CACTTTGTGCTGTTTCTGACTGG - Intergenic
973553098 4:52054676-52054698 GACCATAGGCTGGTTCTGGCCGG - Intronic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
979543542 4:121914332-121914354 AACCTTGGATTTCTTCTGACAGG + Intronic
980347942 4:131647581-131647603 TACCTGGGGCTGATTCTGAAGGG + Intergenic
982752701 4:159181463-159181485 GGCCTTGGGCAGATTATGACAGG + Intronic
984157443 4:176209391-176209413 CAGGTTGGGCTGCTTCAGACGGG + Intergenic
985608977 5:876043-876065 GCCCTTGGGGTGCTGCTGGCGGG - Intronic
997362465 5:133303804-133303826 CACCTTGGCATGCTTCTGAAAGG - Intronic
998090532 5:139364847-139364869 GAAATTGTGCTGCTTCTGGCCGG + Intronic
998261597 5:140635831-140635853 GACATGGGGCTGGTTCTTACAGG + Intergenic
998853710 5:146375085-146375107 AACCTTGGGCTGGTTATCACTGG + Intergenic
1000666396 5:164003065-164003087 GTCCTGGGGCTGGTTCTGATTGG + Intergenic
1001020502 5:168178540-168178562 CACCTTGGACAGCCTCTGACAGG - Intronic
1004104635 6:12654546-12654568 GCCTTTGGGCAGCTTCTGAGAGG + Intergenic
1004449364 6:15730754-15730776 CACCTTGGGACGCTTCTGAAGGG - Intergenic
1005981812 6:30842428-30842450 GACCATGGACTGGTTCTGGCTGG + Intergenic
1007350403 6:41269258-41269280 GACCTTCGGTTGCTTCTCATTGG - Intronic
1010168302 6:72942801-72942823 GACCTTGGCCTGCATCTACCTGG + Intronic
1010830460 6:80522105-80522127 GAATGTGGGCTGCTTCAGACAGG - Intergenic
1013111610 6:107069211-107069233 GACCTTGCGCTGCTGCTGGTAGG + Exonic
1014775902 6:125509597-125509619 TTCCTTGGGCTGCTTATGAAGGG - Intergenic
1015309595 6:131751728-131751750 GACCACGGACTGGTTCTGACTGG + Intergenic
1017721453 6:157246108-157246130 GACCTTGGGCAGCTGCCGGCAGG + Intergenic
1019019554 6:168906616-168906638 GACCATGGACTGGTTCTGGCTGG - Intergenic
1019181419 6:170189385-170189407 GACCTGGGGCTGCTTGGGACAGG - Intergenic
1019225785 6:170506907-170506929 GACCGTGGACTGCTTCTGGCCGG - Intergenic
1022468635 7:30668025-30668047 GCCCTCGGGCTGCTGCTGCCTGG + Intronic
1024100047 7:46022580-46022602 GGCCATGGGCTGGTTGTGACTGG + Intergenic
1024730419 7:52247593-52247615 GAACTTGCCCTGTTTCTGACAGG - Intergenic
1029649907 7:101884480-101884502 GACCTTGTGCTGTTTGGGACAGG + Intronic
1032804017 7:135338369-135338391 GACCATGGACTGGTTCTGGCCGG + Intergenic
1032838773 7:135697686-135697708 GAACTTGGACTGCATCTGAAAGG - Intronic
1036705617 8:11044138-11044160 GACCGTGGACTGGTTCTGGCTGG + Intronic
1036824694 8:11967035-11967057 GACCATGGGCTGGTTGTGAGTGG - Intergenic
1038231079 8:25700848-25700870 GACCATGAACTGGTTCTGACTGG + Intergenic
1038537063 8:28360945-28360967 TTCCTTGGGCTGCTCCTGGCAGG + Exonic
1040499620 8:47995376-47995398 GGCCTTTGGCTGCTTCATACAGG + Intergenic
1040865073 8:52040657-52040679 GACCTTGGACTCCTGCTGGCAGG - Intergenic
1042017672 8:64333733-64333755 AATATTGGGCTGCTTCTGAAGGG + Intergenic
1053147048 9:35718927-35718949 GGGATTGGGCAGCTTCTGACTGG - Intronic
1056721036 9:89072252-89072274 GACCTTGAGCTGCTTATGACAGG + Intronic
1057392464 9:94651202-94651224 GCCCTTTGGCTTCTCCTGACTGG + Intergenic
1057822396 9:98342606-98342628 GACCATGGTCTGCATCTGGCTGG + Intronic
1057904962 9:98976271-98976293 TTCCTGGGGCTGCATCTGACCGG - Intronic
1059217207 9:112575186-112575208 GACTGGGGGCTGCTGCTGACTGG - Exonic
1059324461 9:113495851-113495873 GTCCTAGGGATGCTTCTGTCAGG + Intronic
1059893370 9:118831682-118831704 GATCTTGGTCTGTTTCTGACTGG + Intergenic
1061964219 9:134004124-134004146 GACCTTGGGGTTCTTCTCAAGGG - Intergenic
1195959634 X:110372137-110372159 GATCTTGGGCTTCTTATGATTGG + Intronic
1197067073 X:122246111-122246133 GACCTTGGGCAGTTCCTGAAAGG + Intergenic
1197618178 X:128717747-128717769 GACCATGGACTGGTTCTGGCTGG - Intergenic