ID: 902567839

View in Genome Browser
Species Human (GRCh38)
Location 1:17325084-17325106
Sequence GAGAAATCCAGGAACTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902567839 Original CRISPR GAGAAATCCAGGAACTAAGT TGG (reversed) Intronic
901490717 1:9595077-9595099 CGGAAATCCAGGAACAATGTGGG - Intronic
902567839 1:17325084-17325106 GAGAAATCCAGGAACTAAGTTGG - Intronic
906010716 1:42522417-42522439 GGGTAATGCAGGAAATAAGTGGG - Intronic
908205376 1:61842686-61842708 AAGATATCCAGGAAGTGAGTGGG + Intronic
908322512 1:62991925-62991947 GAGAAAGCCAAGAATAAAGTAGG + Intergenic
908798206 1:67852539-67852561 GAGACAGCCAGGAAATAAGATGG + Intergenic
910233863 1:85013866-85013888 AAGAAATCAAAGAACTAAATAGG - Intronic
910643172 1:89486535-89486557 GTAAAATCCAGAAGCTAAGTGGG + Intergenic
913107104 1:115624809-115624831 CAGAAATCCAGAAAATAAATAGG + Intergenic
913270826 1:117091739-117091761 GAGAGAGCCAGGAACTACATGGG - Intronic
915020672 1:152776055-152776077 GAGAAGTCCAGGAAATAAATTGG - Intronic
915882733 1:159689277-159689299 GAGAAATCAAGTACCTAAGATGG + Intergenic
915929285 1:160048926-160048948 GAGAAACCCAGGAGCAATGTAGG - Intronic
915997005 1:160573580-160573602 GAGAAAACCCTGAACAAAGTGGG - Intronic
916395140 1:164378846-164378868 TAGAAATCTAGTAAATAAGTAGG + Intergenic
916519858 1:165553807-165553829 GAGAAATACAGGCACCAATTGGG - Intronic
918421955 1:184373203-184373225 GAGAGACCCAGGGACAAAGTCGG + Intergenic
918496806 1:185148886-185148908 GAGACATCCAGAAAAGAAGTCGG - Intronic
918569548 1:185972782-185972804 GAGAATACCAGGCACTAGGTAGG - Intronic
920260248 1:204684216-204684238 GAGAACTCCAGGACCTAGGGTGG - Intronic
921047759 1:211489745-211489767 GGGAAGGCCAGGAACAAAGTTGG - Intronic
921960313 1:221027123-221027145 GAGAAAGCCAGGGTCTATGTTGG - Intergenic
922145060 1:222935050-222935072 GAGAAAACCACAAACTAGGTGGG - Intronic
922779812 1:228243057-228243079 GAGAAATCCAGGAACAGGGCAGG + Intronic
923438347 1:233991535-233991557 GAGTAATCCAAGAACAAAGGAGG - Intronic
1062957418 10:1549431-1549453 GAGAAATGCAGGAAGGAAGGAGG + Intronic
1064167390 10:12998338-12998360 GGGAAATCCAGGAAGACAGTAGG - Exonic
1064740081 10:18424171-18424193 GGCAAATCCAAGAACTCAGTGGG - Intronic
1071393344 10:85197263-85197285 GAAAACTCCAGGAACTCAATTGG + Intergenic
1072010302 10:91297790-91297812 GAGAAATGAAAGAACTGAGTGGG - Intergenic
1072842771 10:98793930-98793952 GAGAAATCCAAGAGGCAAGTTGG + Intronic
1074309397 10:112309137-112309159 GAGACATCGAGGAACTTAGCGGG - Intergenic
1075900067 10:126035563-126035585 GAGAAAACAAGCAAATAAGTAGG - Intronic
1079088973 11:17467548-17467570 GAGAACTGAAGGAACTAACTGGG - Intronic
1080008151 11:27430997-27431019 GAGAAAACCAGGAGGTAAGAAGG - Intronic
1080377442 11:31730041-31730063 GAGAAATCCAGAAACCAGTTAGG + Intronic
1081580570 11:44348863-44348885 GAGAAATCCAGGCCCCGAGTCGG + Intergenic
1081585891 11:44383389-44383411 GAGGACTCCAGGAACTCAGTGGG + Intergenic
1085285705 11:75358934-75358956 GAGAAATCCTGGAAAGAAGAGGG + Intergenic
1085337305 11:75706007-75706029 AAGAAGGCCAGGAACTAGGTGGG + Intergenic
1089356868 11:117859633-117859655 ATGAAATCCAAGAACTAAGGAGG + Intronic
1092264979 12:6973987-6974009 GAGACATCCTGGAACTAGGCAGG - Intronic
1096422545 12:51472053-51472075 TTGAAATCTAGGAAGTAAGTAGG - Intronic
1099603363 12:84769816-84769838 GAGAAATCCAGTAACTCATTTGG - Intergenic
1100095742 12:91033466-91033488 AAGCAATTCAGGAAATAAGTTGG + Intergenic
1102619244 12:114180816-114180838 GATAAGTCCTGTAACTAAGTTGG - Intergenic
1106970535 13:35136225-35136247 GAGAAATCTAGGAATTCCGTTGG - Intronic
1107579247 13:41764592-41764614 GAGATATCAAGGAACTAAAGAGG + Intronic
1108085841 13:46792127-46792149 GATAAATACAGGAAAAAAGTTGG + Intronic
1108500610 13:51066595-51066617 GAGAAATCCAGCCACTAACCAGG + Intergenic
1108770497 13:53694697-53694719 GAGAACTCTAGGAACCAGGTAGG + Intergenic
1112905420 13:104413508-104413530 CAGAAATCCAGGAATTCAGAGGG + Intergenic
1114727053 14:24949340-24949362 GAGAAATGCAGAAACTAAAGAGG + Intronic
1116235770 14:42277362-42277384 GAAAAATCCAGAAACTAGTTAGG - Intergenic
1116449771 14:45051302-45051324 GAGAAATACAGGACCTAGGGAGG + Intronic
1117202636 14:53408138-53408160 AAGAAATTGAGGACCTAAGTAGG + Intergenic
1122124114 14:99570048-99570070 GAGGACTCCAGGAAGGAAGTGGG + Intronic
1129426059 15:75463913-75463935 GAGAAATCTAAGGACTAGGTTGG + Exonic
1132277496 15:100581858-100581880 AAGAAAACCATGAACTATGTAGG - Intronic
1133879886 16:9771564-9771586 GAGAATCCCAAGAACTAAGGTGG - Intronic
1135385490 16:22035910-22035932 GAGAAATCCAAAAACTAAGAAGG - Intronic
1136353964 16:29731444-29731466 GAGAAATCCAATAGCTAGGTTGG + Intergenic
1139088217 16:63614839-63614861 CAGAAAGCCAGGAAATATGTTGG + Intergenic
1140061642 16:71575714-71575736 AAGAAAGCCAGGAAAGAAGTTGG + Intronic
1142537649 17:630645-630667 AAGAAATGTAGGAAGTAAGTGGG - Intronic
1143731146 17:8883598-8883620 GGGAAAACCAGGAATTAATTAGG - Intronic
1150770583 17:68037526-68037548 GTGAAATCCAGAAAATCAGTAGG + Intronic
1153470010 18:5433619-5433641 GAGATAGCATGGAACTAAGTGGG - Intronic
1155033976 18:22008602-22008624 GAGAAATGGAGAAACTAAGGTGG + Intergenic
1156142127 18:34126514-34126536 TAGAAATCCAGGAACTAAGAGGG - Intronic
1158110309 18:53933383-53933405 GAGTAATACAGGTACTAAATGGG - Intergenic
1158716289 18:59882515-59882537 GAGAAAAGCAGGAACTAATCGGG + Intergenic
1159431107 18:68355128-68355150 TAGAAAGCCAGGAAGTAATTAGG - Intergenic
1160381895 18:78464774-78464796 GACAAATTCAGGAAAGAAGTAGG - Intergenic
1162410761 19:10503506-10503528 GAGACATCCAGCAACGAAATCGG - Exonic
1163341467 19:16710318-16710340 GAGAAATTCAGGAGCTTAGCTGG + Intergenic
1165397321 19:35571739-35571761 GAGAAATCCAGTCACTCAATGGG + Intergenic
1166106219 19:40599393-40599415 GAGACAGCCAGGGACTAAGTGGG - Intronic
1167960138 19:53098671-53098693 GAGAAGTTCAGAAGCTAAGTGGG - Intronic
925486222 2:4334874-4334896 GAGAAAACCAGGAACACATTAGG - Intergenic
926174466 2:10577343-10577365 GAGCAATCCAGAAACCAAGACGG + Intronic
926403906 2:12528571-12528593 GTGAAATAAAGGAAGTAAGTAGG + Intergenic
927721208 2:25383749-25383771 GAGGAATGCAGAAACAAAGTGGG + Intronic
930912996 2:56652490-56652512 GAGAAATCAAGGGATAAAGTAGG - Intergenic
931374260 2:61694119-61694141 GAGAAATGCAGGCACAAAGCAGG - Intergenic
931605848 2:64051259-64051281 CAGAAATCAAGGGACTAGGTGGG + Intergenic
933024650 2:77241106-77241128 GAAAAATCAAAGAACAAAGTTGG + Intronic
935357062 2:102211250-102211272 GAGGAATACTGGAACTAAGTAGG + Intronic
940792703 2:158045184-158045206 TAGAATTTCAGGAACTAACTTGG + Intronic
943452155 2:188057055-188057077 GAGAAATGAATGAACTAAGAAGG - Intergenic
945395794 2:209315174-209315196 GAGTAATAAAGCAACTAAGTTGG - Intergenic
945745383 2:213714170-213714192 CAGAAATCCAGGAGCTAAGTAGG + Intronic
946625911 2:221612145-221612167 CAGCAATTTAGGAACTAAGTGGG + Intergenic
946750726 2:222893605-222893627 GAGAAAAACAGGAAAAAAGTAGG - Intronic
946959503 2:224968991-224969013 GCCAAATCCAGGAAATAAGGAGG + Intronic
948796670 2:240406434-240406456 GAGAAGTCCAGTAAGTATGTTGG - Intergenic
1168792175 20:585391-585413 GAGAAATCAAGGAAGGAAGAAGG - Intergenic
1169717296 20:8634574-8634596 GAGAATTTCAGGAAATAGGTAGG - Intronic
1171502934 20:25608243-25608265 GAGAAATCCAGGAGTTTGGTTGG + Intergenic
1173400149 20:42718955-42718977 GAAATATTCAGGAGCTAAGTTGG + Intronic
1173843747 20:46175195-46175217 CAGAAATCCAGGAAATCTGTAGG - Intronic
1173983523 20:47242948-47242970 GACAAATTCAGGAATTAAGTAGG - Intronic
1174378457 20:50141442-50141464 GAGAAAACCAGTGACTAAGCAGG - Intronic
1175675311 20:60941786-60941808 GAGAAAACCAGGAACCAAGGTGG + Intergenic
1177871368 21:26576996-26577018 GAGATACCCAGGAAGAAAGTGGG - Intergenic
1178287402 21:31337174-31337196 GAGAAAACCAGAAAGTAGGTAGG + Intronic
1179634113 21:42696510-42696532 GAGAAAGCCAGGACCTGCGTGGG - Intronic
1182099482 22:27647740-27647762 GATAAACCCATGAACTAAGCAGG - Intergenic
949584618 3:5425561-5425583 CAGAAATCCAGGTGCTGAGTGGG + Intergenic
951407930 3:22324153-22324175 GAGAAATTCAAGAATTAACTTGG + Intronic
953333111 3:42071192-42071214 GTGAAAGCCAGGACCTAAGGAGG + Intronic
954287743 3:49630777-49630799 AAGAAATCCATGAATAAAGTAGG + Intronic
955992194 3:64640465-64640487 GTGAAGTAAAGGAACTAAGTAGG - Intronic
959836822 3:110928042-110928064 GAGAAATCCAGAAATTTACTAGG + Intergenic
964580863 3:158236024-158236046 GAGAACTCCATGAACTCAGGAGG + Intronic
964614635 3:158649647-158649669 GGGAAATGCAAGAAATAAGTTGG + Intronic
965696737 3:171416179-171416201 CAAAAATCCAGGAAATAACTTGG - Intronic
966684563 3:182679788-182679810 GAAAACTCCAGGAACTCAATGGG + Intergenic
966855171 3:184188897-184188919 AAGAAATCGAAGAACTCAGTTGG - Intronic
967100984 3:186215603-186215625 TAGAAATCCAGGAGATAACTGGG + Intronic
975075158 4:70197926-70197948 GTGGAATCCATGAATTAAGTGGG - Exonic
978410131 4:108416921-108416943 GAGAAATTCAGGAGAAAAGTGGG - Intergenic
982450603 4:155548208-155548230 GAAAATTCCAGGCAGTAAGTTGG - Intergenic
984010478 4:174365277-174365299 GAGAAAATAAGGAACTAATTTGG + Intergenic
986452654 5:7881605-7881627 GAGAAAGCCAAGGACTAACTGGG - Intronic
986461386 5:7975974-7975996 CAGGAATCCAGGCACTCAGTTGG - Intergenic
987544838 5:19301187-19301209 GAGGAATCCACAAACTAAGTTGG + Intergenic
988051008 5:26031215-26031237 GAGAAATCTAGAAACCAATTAGG + Intergenic
989479719 5:41916173-41916195 GGAAAATTCAGGAATTAAGTAGG + Intronic
991413421 5:66367494-66367516 GAGAAATCCTCTAACAAAGTTGG - Intergenic
993880022 5:93350931-93350953 GAACAATCCAGGAACTAATCAGG + Intergenic
994196867 5:96931451-96931473 AAGAATTCCAGGAACTAGGCTGG - Intronic
996079886 5:119246022-119246044 AATAAAACCAGGAAATAAGTAGG + Intronic
997740106 5:136245719-136245741 GAGAAGTTCTGGAACTGAGTGGG + Intronic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
998548849 5:143056897-143056919 GAGAAAGCCAGGAGCGAAGATGG + Intronic
999346502 5:150825920-150825942 AAGAAATCCAGGTACATAGTTGG + Intergenic
999489173 5:152032303-152032325 GAGCAAACCATGAAATAAGTGGG + Intergenic
1000164715 5:158636986-158637008 GAGAAATCCAGGGACTGGGGTGG - Intergenic
1001352870 5:170987863-170987885 GAGAAATACAGGAAGTAAATTGG + Intronic
1002846007 6:944816-944838 GAGCTGTCCAGGAATTAAGTTGG + Intergenic
1004159518 6:13201138-13201160 GAGCCATCCAGGAACTAGCTGGG + Intronic
1004737900 6:18426579-18426601 GAGAACACCAGGAACAAAGTTGG - Intronic
1005868236 6:29953766-29953788 GAGAAAACCAGAACCAAAGTAGG - Intergenic
1006210318 6:32387890-32387912 GAGAAATCCATGAACTTGTTTGG - Intergenic
1007326388 6:41063982-41064004 GAGAAATCCAGGGACTTGTTGGG + Intronic
1008152798 6:47975509-47975531 GAAAAATCCATGAACCAAGAAGG - Intronic
1008302867 6:49863330-49863352 TGCAAATCTAGGAACTAAGTAGG + Intronic
1008469260 6:51864966-51864988 GATAAATCCAAGAACTATGTGGG + Intronic
1008585217 6:52942609-52942631 GAACAATGCAGGAACTATGTGGG + Intergenic
1008716105 6:54291702-54291724 GGCAAATCCAGGAAATAATTTGG + Intergenic
1010099943 6:72092345-72092367 GAGCATTGCAGGAAATAAGTTGG + Intronic
1010786993 6:80015100-80015122 GAGAAATTAAGGAACTAATTTGG + Intronic
1011782272 6:90802797-90802819 GAAGAATGCAGGAACAAAGTTGG - Intergenic
1014452292 6:121595397-121595419 GAGAAATACAGGAACTAGAGAGG - Intergenic
1014698920 6:124658821-124658843 GAGAAATCTAGGAAGGAAGAAGG - Intronic
1020909247 7:14108107-14108129 GAGAAATATAAGAACCAAGTTGG - Intergenic
1021523614 7:21561757-21561779 CAGAAATCAAGGAACTGAGCAGG - Intronic
1021651407 7:22837137-22837159 CAGATCTCCAGGGACTAAGTAGG + Intergenic
1028021287 7:85777265-85777287 CACAAATCCAGTAAATAAGTGGG - Intergenic
1028827177 7:95287343-95287365 GAGAAATCGAGGAACTCTGGAGG - Intronic
1030526534 7:110661128-110661150 GAGAAACCCAGTACCTCAGTTGG + Intergenic
1031087343 7:117315873-117315895 AAGAAATCTAGGGACTAAGGTGG + Intronic
1033008284 7:137591110-137591132 GAGAAATCCAGGCACCCTGTGGG - Intronic
1039357749 8:36839924-36839946 GAGAAATCAAGGCAAAAAGTAGG - Intronic
1039953558 8:42190719-42190741 GGGAAATCGAGGGCCTAAGTTGG + Intronic
1045519362 8:102889909-102889931 GAAATATCATGGAACTAAGTGGG - Intronic
1046498744 8:115047902-115047924 GAGAAATCCAGAAATTAGTTAGG + Intergenic
1048557764 8:135497223-135497245 GAGCAGTCCAGGAATGAAGTGGG - Intronic
1048732872 8:137463204-137463226 GAGAAATCCAGTAAATAACTGGG - Intergenic
1049764239 8:144346146-144346168 GAGAAATGCATGAACTCAGGAGG + Intergenic
1050589408 9:7147148-7147170 GAGAAAACCAGGACATAAGGTGG + Intergenic
1050662472 9:7898090-7898112 TGGAAATCAAGGAACTGAGTTGG - Intergenic
1050948546 9:11558509-11558531 GTGAAATACAGAAACTAAATGGG - Intergenic
1056300325 9:85233506-85233528 GAGAAATACAGAAACTTAGGTGG + Intergenic
1057953847 9:99391566-99391588 GAGAGAAGCAGGAAATAAGTTGG - Intergenic
1058185137 9:101845803-101845825 GAGAAAGCCAGGAAAAATGTGGG + Intergenic
1058737214 9:107904802-107904824 GAGAAATCCTGGACTTAAGGGGG + Intergenic
1059432295 9:114257522-114257544 GAGAATTCCAAGAACTAAACTGG + Intronic
1059902101 9:118939417-118939439 GAGACATCCAGGACCCAAGAGGG - Intergenic
1061167756 9:128934031-128934053 GAGAAATCCATCAACAAAATTGG + Exonic
1062521973 9:136961703-136961725 GAGTCATCCAGGGACTGAGTGGG + Intergenic
1186715101 X:12243257-12243279 GAAAATTCCATGAACAAAGTAGG - Intronic
1191775384 X:64807951-64807973 GAGAAATCCAGGAACTCCAGAGG + Intergenic
1196864780 X:120060927-120060949 GAGAAAACCAGGAAATAAGATGG + Intergenic
1196878321 X:120175404-120175426 GAGAAAACCAGGAAATAAGATGG - Intergenic
1197332181 X:125167276-125167298 GAGAAATCAAGAAACTAATGGGG + Intergenic
1199155616 X:144544734-144544756 AAGAAATCCATAAACTAGGTGGG + Intergenic
1200575060 Y:4879110-4879132 GAGAAATCCGAGATCAAAGTGGG - Intergenic
1200823716 Y:7617242-7617264 GAGAAAACCTGGGACCAAGTAGG + Intergenic
1201055257 Y:9982573-9982595 TAGAAATCCTGGGACCAAGTAGG - Intergenic
1202236340 Y:22713846-22713868 GAGAAAACCTGGGACCAAGTAGG - Intergenic
1202306825 Y:23482322-23482344 GAGAAAACCTGGGACCAAGTAGG + Intergenic
1202563982 Y:26188264-26188286 GAGAAAACCTGGGACCAAGTAGG - Intergenic