ID: 902577106

View in Genome Browser
Species Human (GRCh38)
Location 1:17385312-17385334
Sequence GACCAGAATGGAGGTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902577101_902577106 19 Left 902577101 1:17385270-17385292 CCAGCATCTCAGGTGCAAGAGTG 0: 1
1: 0
2: 0
3: 14
4: 134
Right 902577106 1:17385312-17385334 GACCAGAATGGAGGTTTTCCAGG 0: 1
1: 0
2: 0
3: 16
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902577106 Original CRISPR GACCAGAATGGAGGTTTTCC AGG Intronic
902577106 1:17385312-17385334 GACCAGAATGGAGGTTTTCCAGG + Intronic
904480458 1:30789904-30789926 GACCGGGAAGGAGGTTGTCCAGG + Intergenic
910699162 1:90053581-90053603 GACCAGGATGGGGGTTCTCTAGG + Intergenic
911683983 1:100752535-100752557 GAATAGAATGGTGGTTTTCAGGG - Intergenic
913571511 1:120124936-120124958 TCCAAGAATGGAGGTTTTTCTGG - Intergenic
914292432 1:146286557-146286579 TCCAAGAATGGAGGTTTTTCTGG - Intergenic
914553476 1:148737340-148737362 TCCAAGAATGGAGGTTTTTCTGG - Intergenic
914926130 1:151889744-151889766 TAACAGAAAGGAGGTTTCCCTGG + Intronic
915001841 1:152601073-152601095 CATCAGGATGGAGCTTTTCCTGG - Exonic
915976652 1:160395386-160395408 GAGCACAAAGGAGGTTCTCCGGG + Intergenic
1062763504 10:45173-45195 GACAGGAATGGTGCTTTTCCAGG - Intergenic
1062920504 10:1275290-1275312 GAGCAGAATGGAGATATTGCTGG + Intronic
1064298197 10:14097720-14097742 GACCAGAATGAGTGTTTTACTGG - Intronic
1068879873 10:62036702-62036724 GACCCAAATGGAGGTATTCAGGG + Intronic
1070259265 10:74838696-74838718 GACAAAAATGGAGATTATCCAGG - Exonic
1070508270 10:77136846-77136868 GACTGGAATACAGGTTTTCCTGG + Intronic
1072250348 10:93577409-93577431 GACCTGGATGGAGGTTGGCCTGG - Intronic
1074663149 10:115687286-115687308 GAGTAGAATGGTGATTTTCCAGG - Intronic
1075849756 10:125577149-125577171 AACCAGGAAGGAAGTTTTCCAGG + Intronic
1079545357 11:21626960-21626982 GACCACAATGGAGGTTTACAGGG + Intergenic
1082617771 11:55382242-55382264 GACTAGAATGGTGGTTTCCAGGG - Intergenic
1082623186 11:55449626-55449648 GACTAGAATGGTGGTTTCCAGGG - Intergenic
1084470527 11:69356675-69356697 GCCCAGCATGGAGGTCTTCGGGG - Intronic
1088286801 11:108198695-108198717 GCTCAGAATGGAGGTTTTTATGG - Intronic
1089687348 11:120163476-120163498 GAGCAAAATTGAGGTTTCCCAGG - Intronic
1092004657 12:5059153-5059175 GAACAGAGAGGAGGTTTACCTGG + Intergenic
1093820634 12:23613834-23613856 AAGCAGAATGGTGGTTTTCAGGG + Intronic
1095170840 12:39034112-39034134 GACCATAATGGAGATTTTCATGG + Intergenic
1096804232 12:54130558-54130580 GACCTGAAAGGTGGTTTTCTGGG - Intergenic
1097100808 12:56587827-56587849 GAGCAGAATGGCTGTATTCCTGG - Intronic
1098483994 12:70999782-70999804 GACAAAAATTGATGTTTTCCTGG - Intergenic
1100478400 12:94954993-94955015 GAAAAGAAGGGAGGATTTCCGGG + Intronic
1102550035 12:113684955-113684977 GATTTGAATGCAGGTTTTCCTGG - Intergenic
1102619859 12:114185734-114185756 ACCCAGACTGAAGGTTTTCCTGG - Intergenic
1104600236 12:130148428-130148450 GACCAGAAGAGATGGTTTCCTGG + Intergenic
1106646663 13:31641884-31641906 GACCAGAATGGTGGTTGCCAGGG + Intergenic
1108871179 13:54988191-54988213 GGCCAGATTGGAGGTTCTCCAGG + Intergenic
1109399147 13:61802142-61802164 GAACAGAATGGTGGTTTCCAGGG + Intergenic
1112117424 13:96371636-96371658 GAGCAGAATGGTGGTTTCCAGGG - Intronic
1118109812 14:62705558-62705580 AACCATAATGGAAGTTTTCAGGG - Exonic
1118571597 14:67200116-67200138 GATCAGAATGGAGGCCTTCGGGG - Intronic
1120071608 14:80109552-80109574 GACTAGAATCAAGGTTTTGCTGG + Intergenic
1121838885 14:97116428-97116450 GATCAGAATGGAGGCGTCCCAGG + Intergenic
1124214467 15:27795147-27795169 ACCCAGATTGAAGGTTTTCCTGG - Intronic
1127379511 15:58419009-58419031 GGCCAGAGCAGAGGTTTTCCTGG + Intronic
1127529647 15:59830954-59830976 GTCCAGAATGCAGGTTTTTGAGG + Intergenic
1130917008 15:88313034-88313056 GATAAGAATGGAGGTTCTCTGGG + Intergenic
1131217249 15:90548400-90548422 GTCCAGCAAGGTGGTTTTCCTGG + Intronic
1131733175 15:95303691-95303713 GATCAAAATGGAGGATTTGCTGG + Intergenic
1132435155 15:101794419-101794441 GAGCAGAATGTAGGGTTTTCAGG + Intergenic
1133175540 16:4011343-4011365 CCCCAGAATGGAGGCTTCCCAGG - Intronic
1135492593 16:22922829-22922851 GAAGAGAATGGAGACTTTCCTGG + Intergenic
1136087085 16:27893044-27893066 CACCATTATGGAGGCTTTCCCGG - Intronic
1139365991 16:66433965-66433987 GCCCAGAGTGGAGATATTCCCGG + Intronic
1143490684 17:7283734-7283756 GACCAGCATGGCCCTTTTCCTGG - Exonic
1145789084 17:27613647-27613669 GGGCAGGATGGAGGTTCTCCAGG + Intronic
1147759447 17:42787995-42788017 GGCAAGAATGGTGGATTTCCAGG - Intronic
1149535409 17:57429793-57429815 CACCAGAATGCTGGTTCTCCAGG - Intronic
1150297742 17:64022633-64022655 GACCAGAAGGTAGCTTGTCCTGG - Intergenic
1151364264 17:73606914-73606936 AACCAGAAGGGTGGTTTTCCAGG + Intronic
1152956413 18:45504-45526 GACAGGAATGGTGCTTTTCCAGG - Intergenic
1155372433 18:25115906-25115928 GAGCATTATTGAGGTTTTCCTGG - Intronic
1156567627 18:38213395-38213417 GAGTAGAATGGTGGTTTTCAGGG - Intergenic
1157317398 18:46603811-46603833 GACAAGCATGGATGTTTCCCAGG - Intronic
1157862186 18:51151495-51151517 GTCCAAAATGGAGGTGTTGCAGG - Intergenic
1158199024 18:54919595-54919617 GGCCAGAATGGAGATTTTGATGG - Intronic
1160230138 18:77042262-77042284 GACCGAACAGGAGGTTTTCCAGG - Intronic
1161197658 19:2996043-2996065 GACCAGATTGGAGCTGCTCCGGG - Intergenic
1161495154 19:4582305-4582327 GCCCAGAAAGGAGTTTTTCGAGG + Intergenic
1162328624 19:10013347-10013369 GTCCAGAATTGAGGGTCTCCGGG + Exonic
1165250023 19:34523575-34523597 GAGCAGAATGGTGGTTTCCAGGG - Intergenic
1166061413 19:40327986-40328008 GATCAGACTGAAGGTTTTCAAGG + Intronic
1166222432 19:41374259-41374281 CACCAGACTGGAGGATTCCCTGG - Intronic
1166764724 19:45245787-45245809 GACCAGGAGGGAAGTTTTGCTGG + Intronic
1167222173 19:48206900-48206922 GACAAGTGTGGAGGCTTTCCTGG + Intronic
1167736565 19:51297979-51298001 GAGCAGAATGGAGGTTGCCCAGG - Intergenic
1167736670 19:51298649-51298671 AAGCAGAATGGGGGTTTCCCGGG - Intergenic
1168676352 19:58280588-58280610 GACCAGAATGGAGAGCTTCAAGG + Exonic
925271504 2:2612709-2612731 GAGTAGAATGGTGGTTATCCTGG + Intergenic
926760934 2:16278476-16278498 GACCAGAATGCAGGGCTTCATGG - Intergenic
927046245 2:19281752-19281774 GAGTAGAATGGTGGTTTTCCAGG - Intergenic
927089505 2:19699821-19699843 CACCAGAAGGGAGGTGTTACTGG - Intergenic
927342661 2:22000075-22000097 GATGTGCATGGAGGTTTTCCAGG + Intergenic
927499269 2:23571420-23571442 GAACAGAATGGGGGTTCTGCTGG - Intronic
929601718 2:43208608-43208630 GGCCAGGCTGGAGGTCTTCCAGG + Intergenic
931009829 2:57897766-57897788 GAGCAGAATTGAGCATTTCCTGG + Intergenic
932197507 2:69797195-69797217 GACAAGAATAGAGGTTTCCTCGG + Intronic
934759787 2:96848170-96848192 GACCAGACTGGGGCTCTTCCTGG + Exonic
936134195 2:109875266-109875288 GAGAAGAAGGGAGCTTTTCCAGG - Intergenic
936210502 2:110496219-110496241 GAGAAGAAGGGAGCTTTTCCAGG + Intergenic
941137343 2:161733939-161733961 GACCAAAACAAAGGTTTTCCAGG - Intronic
943317166 2:186404013-186404035 GACTAGAATGGTGGTTATCAGGG - Intergenic
944820797 2:203428827-203428849 GGCCAGAATAGAGCTTTGCCAGG + Exonic
947322306 2:228934732-228934754 GAGTGGAATGGAGGTTTTCAGGG + Intronic
948224556 2:236299000-236299022 GAGGAAAATGGAGGTTTCCCGGG - Intergenic
1169618469 20:7477185-7477207 GACCAGCATGGATATTTCCCTGG - Intergenic
1171441004 20:25162909-25162931 GAGTAGAATGGTGGTTTTCATGG - Intergenic
1172034952 20:32004039-32004061 CACCAGAATGCAGGATTCCCAGG - Intergenic
1172186158 20:33032342-33032364 GACCATAATGGAGGTGTTTCTGG + Intronic
1173016100 20:39227221-39227243 GGCAAGAATGGGGGTTTTCCTGG - Intergenic
1173332451 20:42086585-42086607 GAACACTATGAAGGTTTTCCTGG - Intronic
1174615026 20:51828929-51828951 GCCCAGCACGGAGGGTTTCCAGG - Intergenic
1177742337 21:25169163-25169185 GAGCAGAACTGAGGTTTTTCAGG - Intergenic
1177761721 21:25409160-25409182 GAGTAGAATGGTGGTTTTACAGG + Intergenic
1178597784 21:33970432-33970454 AACCAGAGTGGAGTTTTTACAGG + Intergenic
1178644422 21:34373748-34373770 GAGCAAAATCGAGGTTTTTCTGG + Intergenic
1182130148 22:27844727-27844749 GCCCAGGATAGAGGGTTTCCTGG - Intergenic
1183258404 22:36777949-36777971 GACCAGAGGGGAGGTTATCTTGG - Intergenic
949560916 3:5201756-5201778 GAGCAGAAAGGAGGCTTCCCAGG - Exonic
952135966 3:30420060-30420082 GAGAAGAATGGTGGTTTTCAGGG + Intergenic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952623591 3:35376351-35376373 GACCAGAATGGAAGTTTGATTGG + Intergenic
953401056 3:42617699-42617721 GAACAGAATAGATATTTTCCTGG + Intronic
956361399 3:68451933-68451955 GTTCTGCATGGAGGTTTTCCTGG + Intronic
958525939 3:95259024-95259046 GAGTAGAATGGTGGTTTTCAGGG - Intergenic
960567517 3:119149468-119149490 GAACAGCAGGGAGGTTTTTCAGG - Intronic
962567978 3:136683083-136683105 AAACAGAATGGAGGATTGCCAGG + Intronic
962835615 3:139185876-139185898 GACCATAATGGAGGGATTCCAGG - Intronic
963627119 3:147687685-147687707 AACCAGAAAGGAGATTTTCAGGG + Intergenic
965444265 3:168755076-168755098 GAGCAGAATGGTGGTTTCCAGGG - Intergenic
969509483 4:7609642-7609664 GACCAGAATGGAAGGGTCCCAGG + Intronic
970909931 4:21263076-21263098 GATCAGAATTCAGGTTTTCATGG + Intronic
971627570 4:28942209-28942231 GAAAAGAAAGGAGATTTTCCAGG + Intergenic
972441170 4:39093567-39093589 GACCAGAAAGGTCTTTTTCCAGG + Intronic
972574916 4:40342901-40342923 GACCAGAAGGGAAGTTAGCCAGG + Intronic
975450572 4:74520408-74520430 GCCCAGAATGGAGCTTTTCATGG + Intergenic
976276165 4:83280795-83280817 GACCTGAATTCAGGTTGTCCTGG + Intronic
976396993 4:84566624-84566646 AACCAGAATGTAGGCTTGCCAGG - Intergenic
979838437 4:125404745-125404767 GAGTAGAATGGTGGTTTTCCAGG - Intronic
981832695 4:149020719-149020741 GAGACGAATGCAGGTTTTCCAGG - Intergenic
982828260 4:160027286-160027308 GCCCATAAGGGAGTTTTTCCAGG + Intergenic
984201871 4:176732499-176732521 GACCAAACTAGAGGTTTTCAGGG + Intronic
986334559 5:6743769-6743791 GACCTGAATGAAGTTTTTACAGG + Exonic
987046622 5:14115097-14115119 GACCAGAATGTAGCTTCTGCAGG + Intergenic
989476344 5:41878294-41878316 GAGCAGAATGGTGGTTGTCAGGG + Intergenic
991132626 5:63141950-63141972 GAGCAGAACTGAGGTTTTCCTGG + Intergenic
999346574 5:150827102-150827124 GAGCAGAATGGTGGTTTCCTGGG + Intergenic
999878187 5:155831815-155831837 GAGGAGAATGGAGGTTCTCCAGG + Intergenic
1002870467 6:1162634-1162656 AACGAAAATGGAAGTTTTCCTGG - Intergenic
1003091757 6:3109807-3109829 GAGTAGAATGGTGGTTGTCCGGG - Intronic
1004175264 6:13334356-13334378 GAGCAGAATGGAGGTTATTAGGG - Intergenic
1006626849 6:35403746-35403768 GAACAGAATGGAGCTAGTCCAGG + Intronic
1007267112 6:40604941-40604963 GACCAAAATGGTGGTTTTCAGGG - Intergenic
1008057021 6:46955764-46955786 GAACACAATGGAGGTAGTCCAGG - Intergenic
1008445545 6:51585912-51585934 GAACAAAATGGAGGTTTTTAGGG - Intergenic
1010013445 6:71076246-71076268 GTGTATAATGGAGGTTTTCCTGG + Intergenic
1010181019 6:73086512-73086534 GACTTGAAGGGAGGCTTTCCAGG - Intronic
1012150057 6:95738135-95738157 GAATAGAATGGTGGTTTTCATGG + Intergenic
1012558925 6:100554341-100554363 GACCAGAATGGATTTGTACCTGG + Intronic
1017635772 6:156441668-156441690 GACCACCATCCAGGTTTTCCTGG - Intergenic
1017738866 6:157387066-157387088 GACAAGTTTGGAGGTGTTCCTGG + Intronic
1018601938 6:165553272-165553294 GAAATGAATGGAGGTTATCCAGG + Intronic
1021020007 7:15586471-15586493 CAACACAATGGAGTTTTTCCAGG - Intergenic
1024621448 7:51161143-51161165 GAACAGATTTGAGCTTTTCCAGG + Intronic
1028820278 7:95201853-95201875 TATCTAAATGGAGGTTTTCCTGG - Intronic
1030926165 7:115457475-115457497 GAGCAGAATGGTGGTTGTCAGGG + Intergenic
1035334711 7:158120527-158120549 GAGCAGAAAGGAGCTTTGCCAGG - Intronic
1038043303 8:23745244-23745266 GTCTAGACTGGAGGTTTTCCTGG - Intergenic
1038201042 8:25412961-25412983 TAGCACAATGCAGGTTTTCCTGG - Exonic
1038379134 8:27075730-27075752 GAACAGAAAGGAGGCTTCCCTGG - Intergenic
1039151359 8:34510146-34510168 GAGCAGAAATGAGGTTTCCCTGG - Intergenic
1041704434 8:60830889-60830911 GCCCCTAATGGAGGTTTTCTTGG + Intronic
1041740232 8:61150250-61150272 GACCAGAAGTGAGGCATTCCTGG - Intronic
1046825122 8:118681200-118681222 GACTAGAATGGTGGTTATCTGGG + Intergenic
1049767658 8:144362455-144362477 GCCCAGACTAGAGGCTTTCCGGG - Intergenic
1050922972 9:11229377-11229399 GTCCAGAAGGGAGGTTATCTCGG + Intergenic
1052680783 9:31689491-31689513 GAACAGAGTGGATGTGTTCCTGG + Intergenic
1056180204 9:84075662-84075684 GCCACGAATGGAGGATTTCCTGG + Intergenic
1057553869 9:96072273-96072295 GACAAGGATGGAGATTTACCAGG + Intergenic
1058792407 9:108463389-108463411 GAGTAGAATGGTGGTTTTCAGGG + Intergenic
1061829004 9:133278678-133278700 AACCAGAATGGAGGTCTCCCTGG - Intergenic
1062072119 9:134561817-134561839 GATCAGACTGGAGGGCTTCCTGG + Intergenic
1186437048 X:9551856-9551878 GATCAGATTGGAGGGTCTCCGGG - Intronic
1189554051 X:42123856-42123878 GACCAGATTTGAGGCTTTGCAGG + Intergenic
1190559968 X:51677479-51677501 GACCAGGATCAAGGTTTTTCTGG - Intergenic
1190564323 X:51715842-51715864 GACCAGGATCAAGGTTTTTCTGG + Intergenic
1191970356 X:66807695-66807717 GAGTAGAATGGTGGTTTTCAGGG - Intergenic
1196567321 X:117224108-117224130 GAAGAGAATGGTGGTTTTCAGGG - Intergenic
1199666095 X:150097661-150097683 GACCTGAATGAAGAGTTTCCAGG - Intergenic
1199683919 X:150248150-150248172 GAATAGAATGGTGGTTTTCAAGG + Intergenic
1201254496 Y:12093477-12093499 AACAAGTATAGAGGTTTTCCAGG - Intergenic