ID: 902577246

View in Genome Browser
Species Human (GRCh38)
Location 1:17386177-17386199
Sequence CCCATTAAACAGAAGCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902577246_902577252 1 Left 902577246 1:17386177-17386199 CCCCCATGCTTCTGTTTAATGGG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 902577252 1:17386201-17386223 ACAACAAATGCCTGCTTCAAAGG 0: 1
1: 0
2: 0
3: 17
4: 182
902577246_902577253 2 Left 902577246 1:17386177-17386199 CCCCCATGCTTCTGTTTAATGGG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 902577253 1:17386202-17386224 CAACAAATGCCTGCTTCAAAGGG 0: 1
1: 0
2: 1
3: 13
4: 225
902577246_902577254 10 Left 902577246 1:17386177-17386199 CCCCCATGCTTCTGTTTAATGGG 0: 1
1: 0
2: 0
3: 11
4: 154
Right 902577254 1:17386210-17386232 GCCTGCTTCAAAGGGTCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902577246 Original CRISPR CCCATTAAACAGAAGCATGG GGG (reversed) Intronic
901207170 1:7503895-7503917 CCCAGGGGACAGAAGCATGGAGG + Intronic
902577246 1:17386177-17386199 CCCATTAAACAGAAGCATGGGGG - Intronic
903329888 1:22591940-22591962 TCCAATAAACAGGAGAATGGGGG - Intronic
906050933 1:42871188-42871210 GCCATTAAACTGAAGAATAGAGG + Intergenic
910368721 1:86493519-86493541 CCCAGTGGACAGAAGCAAGGTGG + Exonic
915774459 1:158467553-158467575 CCCAGTAAACAGAAAAATGAGGG + Intergenic
917750254 1:178046653-178046675 CCCATTAAGAAGAATCTTGGAGG + Intergenic
920199577 1:204251349-204251371 CCCATGAAAGTGAAGAATGGAGG + Intronic
920651746 1:207842735-207842757 CCCATTATTCAGAAGCACGTAGG + Intergenic
923860489 1:237887791-237887813 CACATGAAACTGAAGCAAGGAGG - Intronic
1063276559 10:4574604-4574626 CCCTTTAAATATAAGGATGGAGG + Intergenic
1064223176 10:13459193-13459215 CTCACAAAATAGAAGCATGGTGG + Intronic
1064434427 10:15298893-15298915 CCAATGAAACAGAAGCATGTTGG - Intronic
1070458442 10:76641546-76641568 CCCATCAAACAGAAGACAGGAGG - Intergenic
1072856847 10:98956452-98956474 CTCATTTAAAAGAAGCATAGAGG + Intronic
1074459734 10:113626001-113626023 CCCATGACACAGCAGCTTGGTGG + Intronic
1074827247 10:117223488-117223510 CCCATTCTCCAGAATCATGGAGG + Intergenic
1076357321 10:129862612-129862634 CCTATTAAACAAAAGCACTGAGG - Intronic
1079951576 11:26811819-26811841 TTAATTAAACAAAAGCATGGAGG + Intergenic
1089985675 11:122810544-122810566 CCCATTTCACAGAAGCAAGGAGG - Exonic
1090270679 11:125383854-125383876 CCCCTTGAGCAGAAGCATGGGGG + Intronic
1091040653 11:132277850-132277872 CTCATTAAACAGTAGCACAGAGG - Intronic
1093596796 12:20972345-20972367 CCCTTCAAACAGAGGCCTGGAGG + Intergenic
1095515918 12:43005216-43005238 ACAATTAAACAGGAGCAGGGTGG + Intergenic
1096379454 12:51143659-51143681 CATTTTAAAGAGAAGCATGGAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096655746 12:53090594-53090616 CCCACAAAACAAAAGGATGGGGG - Intergenic
1097181870 12:57176215-57176237 CCCAATGAACAGAAGTGTGGGGG - Intronic
1097874499 12:64631094-64631116 GTCTTTAGACAGAAGCATGGAGG + Intronic
1099076436 12:78114458-78114480 CTCAGGAAACAGAATCATGGTGG + Intronic
1105458406 13:20562187-20562209 ACCATTAAACAGAATCATTAGGG + Intergenic
1107672167 13:42757420-42757442 CTCAGGAAACAGAATCATGGTGG + Intergenic
1108456580 13:50621094-50621116 CACATTATACAGAAACAAGGTGG - Intronic
1110981207 13:81900921-81900943 CCAATTAAACAGATGAAAGGTGG + Intergenic
1114804284 14:25816544-25816566 TCCATTTGAGAGAAGCATGGGGG + Intergenic
1121481172 14:94276021-94276043 CACATTAAAAGGAATCATGGGGG - Intronic
1124044278 15:26134161-26134183 GCCAATAAACAGAAGAAAGGGGG + Intergenic
1124200853 15:27677446-27677468 CCCATGAAGCAGAAGCAGAGGGG - Intergenic
1125264344 15:37862348-37862370 ACCATTACACAGAAGCAAGGGGG - Intergenic
1126258133 15:46652461-46652483 CCCATTAAACAGAAGGCCAGGGG + Intergenic
1131241159 15:90744747-90744769 TCCATTAAAAAGAATCAGGGAGG + Intronic
1133723440 16:8516213-8516235 CCCATTGGCCAGAAGCAGGGAGG - Intergenic
1136581236 16:31152266-31152288 CCAATTAAGCACAAGCATGCAGG - Intergenic
1138574629 16:57899789-57899811 CAAACTAAACAGAAACATGGAGG - Intronic
1140253719 16:73317257-73317279 CCCTTTAAACAGAAGCCGGGGGG + Intergenic
1141034613 16:80616532-80616554 CCCTTTAACCAGAGGCATGGAGG + Intronic
1141824906 16:86472104-86472126 CCGCTTTAACAGAAGCCTGGGGG - Intergenic
1142812492 17:2401764-2401786 CCCTTTAAACCGAAGGCTGGCGG - Intergenic
1143978722 17:10849482-10849504 CCCATGCAACAGAAGCATCCTGG - Intergenic
1152139722 17:78529378-78529400 CCCATCAAACGCAACCATGGGGG - Intronic
1154354895 18:13617073-13617095 CCCCTTAAAAAGAAAGATGGTGG + Intronic
1154478898 18:14797211-14797233 GCCTATAAACAGACGCATGGGGG - Intronic
1154479845 18:14809537-14809559 GCCTATAAACAGATGCATGGGGG - Intronic
1154958890 18:21288153-21288175 CCCACTAAAAAAAAGAATGGGGG - Intronic
1155777387 18:29782170-29782192 CCCATTAAAGGAAAGCATGCAGG - Intergenic
1156581501 18:38381993-38382015 CCAATTTAACAGAAACATGAAGG + Intergenic
1156984101 18:43328721-43328743 CACATTAATAAGAAGCATGTAGG - Intergenic
1157100211 18:44722378-44722400 CCCATTAAGCACAAGAATTGAGG - Intronic
1157211765 18:45748933-45748955 CCCATTACACACATGCATGATGG + Intronic
1158447545 18:57534180-57534202 CCCAGAAAACAAAAGAATGGAGG + Intergenic
1158819932 18:61147643-61147665 CCCATTGAATTGAATCATGGAGG + Intergenic
1159954301 18:74508480-74508502 CCCATTTACCAGAAGCAGCGGGG - Intronic
1161546481 19:4883852-4883874 CCCATTGGACAGATGCATAGCGG - Intergenic
1162288957 19:9764132-9764154 GCCTATAAACAGATGCATGGGGG + Intronic
1163722134 19:18903340-18903362 CCCATTGAGCAGCAGCAGGGTGG + Exonic
1165063877 19:33218171-33218193 CCCACCAAGCAGAAGCATGGTGG - Intronic
926378450 2:12259669-12259691 GCAATTACACAGAAGCATAGTGG + Intergenic
930431968 2:51289459-51289481 CCCTTAAAACAGAAGTGTGGAGG - Intergenic
933586071 2:84180656-84180678 CCCATTCTACACAAACATGGAGG + Intergenic
936019944 2:108987323-108987345 CCCATTTAACAGAGGCAAGTAGG + Intronic
936651957 2:114438145-114438167 ACCATTAAATATAAGCATGTTGG + Intergenic
942625555 2:177896558-177896580 CCCATTAAACAAAGGCAGGAAGG - Intronic
942677407 2:178442487-178442509 TCTATAAAACAAAAGCATGGAGG - Intronic
943079734 2:183244215-183244237 TCCATTAAATAAAAGCTTGGTGG + Intergenic
948413763 2:237785249-237785271 CACATTTAACAAAACCATGGTGG - Intronic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172463385 20:35136928-35136950 CCCACTAGACAAAAACATGGAGG + Intronic
1176800695 21:13426768-13426790 GCCTATAAACAGATGCATGGGGG + Intergenic
1176901772 21:14451028-14451050 CCGATGAAACAGAAGAATGAAGG - Intergenic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181129477 22:20722090-20722112 CTCAGGAAACAGAATCATGGTGG - Intronic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181277626 22:21696520-21696542 CACATTTAACAGAAAAATGGGGG - Intronic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1182023608 22:27100762-27100784 CCCATTAAACACTGGCAGGGCGG - Intergenic
1182453437 22:30434565-30434587 CCCATTGATCAGAACCAAGGAGG + Intergenic
1183775319 22:39960264-39960286 CCCAATGGTCAGAAGCATGGTGG + Intronic
1184380139 22:44140299-44140321 CCCATTATACAGAAAGGTGGGGG - Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
951049646 3:18079865-18079887 CTCATCAAACAGAAGAATTGGGG + Intronic
952261255 3:31742715-31742737 CAAATCAACCAGAAGCATGGAGG + Intronic
952813432 3:37425326-37425348 CCAGTTAAAGAGCAGCATGGTGG - Intronic
954758085 3:52853384-52853406 CCCATGTGACAGGAGCATGGTGG + Intronic
955245016 3:57217130-57217152 TCCACTAAAAAGAAGCTTGGAGG - Intronic
961086980 3:124076576-124076598 GACATTAAACAGAAGCACAGAGG - Intergenic
964775949 3:160277395-160277417 CCCACTAAACAGTAGTATGTGGG + Exonic
968477137 4:817114-817136 CACATTAAACAGATGCATTAAGG + Intronic
969903054 4:10367710-10367732 CCCATTAAACAGGAGTCTGTGGG + Intergenic
971810052 4:31413489-31413511 GGCAGTAAGCAGAAGCATGGAGG + Intergenic
977358292 4:95974047-95974069 GCCATTTAACAGAAGATTGGAGG - Intergenic
977694378 4:99950089-99950111 CCCGTTACACAGAGGGATGGGGG - Intronic
978571274 4:110140545-110140567 AAAATTAAAAAGAAGCATGGTGG - Intronic
978729467 4:112008305-112008327 TCCATTAAACAACAGCAAGGAGG + Intergenic
979454729 4:120914572-120914594 CTCAGGAAACAGAATCATGGTGG + Intronic
981420357 4:144542813-144542835 GCCTATAAACAGACGCATGGAGG + Intergenic
982168323 4:152636728-152636750 CCCTTTTCCCAGAAGCATGGTGG + Intronic
982584554 4:157221069-157221091 CCCATAAAACAGGAGAAAGGAGG - Exonic
982854705 4:160365594-160365616 CCCTATAAACAGACGCATGGGGG - Intergenic
985037960 4:185860463-185860485 CCCATTCAACAGAAGAGTTGTGG + Intronic
988424701 5:31050019-31050041 CTCACTAAGCAGAAGCATTGAGG + Intergenic
990730814 5:58807064-58807086 CCCATTCTACAGAAGCACAGAGG - Intronic
995099740 5:108285277-108285299 AACATTAAACAGAAGCTTGGAGG - Intronic
999163814 5:149530564-149530586 CCCATTAAAAAGGAGCATAAAGG - Intronic
999222599 5:149993508-149993530 CCTGTTAATCAGAATCATGGGGG - Exonic
1000504458 5:162097715-162097737 CCGATTGAACAGCAACATGGTGG + Exonic
1001222547 5:169914434-169914456 CCCATAAAACAGGAGCCTGTTGG - Intronic
1003592327 6:7446519-7446541 CACATTAAAGAGATTCATGGAGG + Intergenic
1003608024 6:7583150-7583172 CCCATCAAACACCAGCTTGGAGG - Exonic
1003954546 6:11149678-11149700 CCCAGGAAACAGAAGAAAGGTGG - Intergenic
1004337754 6:14779909-14779931 TCCATCAAACAGAAGGAAGGAGG + Intergenic
1005123741 6:22421148-22421170 GGCATTAAACAGAAGGATCGTGG - Intergenic
1005408682 6:25519505-25519527 CCTATTAAACACAAACATGCAGG - Intronic
1005430758 6:25754362-25754384 TCTATTAAACAGCAGGATGGTGG + Intergenic
1009773300 6:68173356-68173378 CTCAGGAAACAGAATCATGGTGG - Intergenic
1010082192 6:71876799-71876821 GCCCTTAAAAAGAAGCATGAGGG + Intergenic
1011386347 6:86802316-86802338 CTCCTTAAGCAGAAGGATGGGGG + Intergenic
1011425691 6:87226965-87226987 CCCATTAAAGCCAGGCATGGTGG - Intronic
1012654955 6:101805882-101805904 CCCATTCATCAGAAGCATACTGG - Intronic
1013391396 6:109689659-109689681 CCCAGGAAACAGCAGCAGGGAGG - Intronic
1013749799 6:113391754-113391776 ACCTTTAGACAAAAGCATGGTGG - Intergenic
1017564613 6:155670037-155670059 CCCATGAGACAGCAGCATGGTGG - Intergenic
1018485837 6:164240085-164240107 CCCATTCAACAGGACCGTGGGGG - Intergenic
1018770722 6:166969434-166969456 AACATCAAACAGAAGCATCGGGG + Intergenic
1018914293 6:168123362-168123384 CCCAATGCACAGCAGCATGGGGG + Intergenic
1018963375 6:168464789-168464811 ACAATTAAACAGAAGCATTTGGG + Intronic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1028181795 7:87733135-87733157 GCCTATAAACAGACGCATGGGGG - Intronic
1034216098 7:149406872-149406894 CCCATTATATAAAAGCAGGGAGG - Intergenic
1035256796 7:157634337-157634359 CCCATGTAACAAAAGCATGAAGG - Intronic
1037797518 8:22009049-22009071 ATCATGAAACAGAAGAATGGAGG - Intergenic
1039412683 8:37368502-37368524 CCCACAAAGCAGAAACATGGAGG + Intergenic
1042504272 8:69542911-69542933 CACATTACACAGAATAATGGGGG + Intronic
1042614534 8:70633850-70633872 CCCATTGAACAGAGGCAGTGGGG - Intronic
1045421094 8:102015931-102015953 CTCATTAAAAAGAAGAAGGGTGG + Intronic
1046690638 8:117280771-117280793 CCCATTTTACAGATGCATGGAGG + Intergenic
1048930944 8:139315094-139315116 CACAGCTAACAGAAGCATGGTGG + Intergenic
1049712137 8:144069819-144069841 CCCCAAAAACAGCAGCATGGGGG + Intergenic
1050683118 9:8137213-8137235 CCCATGAAAAGGAAGCATGCTGG + Intergenic
1056476163 9:86953275-86953297 CTCATTTAACATCAGCATGGAGG - Intergenic
1060688427 9:125633545-125633567 CCCATTACACATAATCCTGGTGG - Intronic
1185835228 X:3339565-3339587 CCCCTTAAAAACAAGCAGGGGGG - Intronic
1186464391 X:9773709-9773731 CCAAAAATACAGAAGCATGGTGG + Intronic
1187107573 X:16260088-16260110 CACCTTAAACAGAAACATGCAGG + Intergenic
1197740470 X:129888623-129888645 CTCAGGAAACAGAATCATGGTGG - Intergenic
1198797724 X:140416700-140416722 ATCATGAAACAGAATCATGGGGG - Intergenic
1199005439 X:142691301-142691323 CCCATTAAAAATGAGCAGGGCGG + Intergenic
1199322071 X:146451687-146451709 CAAATTAAACACAAGCATGCAGG + Intergenic
1201623171 Y:15982403-15982425 GCCTATAAACAGATGCATGGGGG - Intergenic