ID: 902579433

View in Genome Browser
Species Human (GRCh38)
Location 1:17398952-17398974
Sequence GTACCTATGAGGAAATGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902579425_902579433 20 Left 902579425 1:17398909-17398931 CCTCACTGTGCTGGACTGCAGAT 0: 1
1: 0
2: 1
3: 18
4: 193
Right 902579433 1:17398952-17398974 GTACCTATGAGGAAATGGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 146
902579424_902579433 23 Left 902579424 1:17398906-17398928 CCACCTCACTGTGCTGGACTGCA 0: 1
1: 0
2: 2
3: 30
4: 216
Right 902579433 1:17398952-17398974 GTACCTATGAGGAAATGGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902579433 Original CRISPR GTACCTATGAGGAAATGGGA GGG Intronic
902579433 1:17398952-17398974 GTACCTATGAGGAAATGGGAGGG + Intronic
905424824 1:37874952-37874974 ATACCCATGAGTTAATGGGAGGG - Intronic
908533531 1:65056263-65056285 GGATCTATGAGGACATGTGAAGG + Intergenic
909698590 1:78494429-78494451 GTAACAATGGGGAAGTGGGAGGG + Intronic
910727492 1:90354252-90354274 GTAACTATAAGGAAATGTGTTGG - Intergenic
915891343 1:159776927-159776949 GAACCTAAGAAGAAATGGTATGG - Intergenic
916253367 1:162761057-162761079 GTACCTAGGAGGAAGCAGGATGG + Intronic
917690611 1:177464368-177464390 GTATGTATGAGGAACTGGGGTGG + Intergenic
920264677 1:204712705-204712727 GTTCCTCTGAGGAAGTGAGATGG + Intergenic
921976920 1:221213101-221213123 GCACCTCTGAGGAAATGAGGGGG - Intergenic
1063457188 10:6192247-6192269 GTTCATATGAGAGAATGGGACGG - Intronic
1063571023 10:7214542-7214564 ATACCTATGAGGAAATTCTACGG + Intronic
1067967835 10:50933911-50933933 GTACATTTGAGGAACTGGAAAGG - Intergenic
1071949691 10:90688461-90688483 GTATCTATGTGGAAATGTGAGGG - Intergenic
1073788966 10:106920503-106920525 GTAGGGATGAGGACATGGGAGGG - Intronic
1078486574 11:11728701-11728723 GAAGCTATAAGGAAATGAGATGG + Intergenic
1080122892 11:28697678-28697700 GTGCCTATGTGGTAATGGGAGGG - Intergenic
1080878154 11:36295345-36295367 GTACTCATGAGGAGATGGTATGG - Intergenic
1082818421 11:57526378-57526400 ATCCCTATGAGCAAGTGGGATGG - Intergenic
1083257446 11:61505374-61505396 GTGCCTATGGGGACATTGGAGGG + Intergenic
1086281260 11:85192397-85192419 TTATCTATAAGGAATTGGGAGGG + Intronic
1087379811 11:97390919-97390941 GTACATATAAGAAAATGAGAAGG - Intergenic
1088684854 11:112276063-112276085 GTGCCCTGGAGGAAATGGGAAGG - Intergenic
1090344084 11:126053457-126053479 GTGCATAGGATGAAATGGGAAGG + Intronic
1091038036 11:132251547-132251569 CTACCTATGAGGAAAGGGCAAGG + Intronic
1091596704 12:1883313-1883335 GTTCCTGTGAGGAAGTGGGAGGG - Intronic
1094360188 12:29622069-29622091 ATACCTATGAGGTGAAGGGAGGG + Intronic
1094594787 12:31855346-31855368 GTACCTGTGAGGGAAAGGGAGGG - Intergenic
1096994965 12:55832755-55832777 GGAACTGTGAGGGAATGGGAGGG - Intergenic
1098197302 12:68015476-68015498 GCACATATGAGGAGATGAGAAGG - Intergenic
1100337271 12:93642960-93642982 GTGTCTATGAGGATAGGGGAAGG + Intergenic
1107279400 13:38716454-38716476 GTAGGTATGAGGAAAGGGAATGG - Intronic
1108604177 13:52020748-52020770 GTACCTGTGAAGGAATGGGGAGG - Intronic
1109446997 13:62454008-62454030 GAACCTATGCAGATATGGGAGGG + Intergenic
1110092895 13:71476251-71476273 TGCCCTATGAGGAAATAGGAAGG - Intronic
1110327105 13:74229678-74229700 GTACCTATGAAAAAATGGAAAGG - Intergenic
1110671823 13:78189589-78189611 TCACCTATGAGAAAATGTGAAGG - Intergenic
1115582813 14:34778220-34778242 CTAGCTAGGTGGAAATGGGAAGG - Intronic
1118304369 14:64642676-64642698 GTACCTAGGAAGAAACGGAAAGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124285971 15:28400550-28400572 ATACCTCTGGGGAAATGTGATGG - Intergenic
1124296729 15:28511110-28511132 ATACCTCTGGGGAAATGTGATGG + Intergenic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1125050336 15:35290539-35290561 GTACCACTGAGGACATTGGAAGG - Intronic
1125400890 15:39301645-39301667 CCACCTAAGAGGAAATGGCAGGG + Intergenic
1127587617 15:60393808-60393830 AGACCTATGAGGAAACAGGAGGG - Intronic
1128350838 15:66887300-66887322 GTGCCTATAAGCAAATGGGGTGG - Intergenic
1128845306 15:70889386-70889408 TTACCTTTGAGGAGAGGGGAGGG + Intronic
1129333389 15:74838977-74838999 GTCCCCATGAGGAAGTGGGGGGG - Intronic
1130427774 15:83818926-83818948 GTACCAGTGAAGAGATGGGAGGG + Intronic
1130896521 15:88174402-88174424 GTCCATATGAGTATATGGGAGGG - Intronic
1131912429 15:97222813-97222835 ATACCTAAAAGGAAATGAGAAGG + Intergenic
1135091461 16:19521591-19521613 GGACGAATGAGGAAGTGGGAAGG + Intronic
1135984236 16:27172379-27172401 GTACCCAGGAGGAAAAGGAAAGG + Intergenic
1137967727 16:52953286-52953308 TTACCAATGAAGAAGTGGGATGG - Intergenic
1139078976 16:63490782-63490804 TTACCCATCAGGAAAAGGGAAGG - Intergenic
1139692894 16:68652335-68652357 TGGCATATGAGGAAATGGGAAGG - Intronic
1143213541 17:5207397-5207419 GTAGCCAAGATGAAATGGGAAGG + Intergenic
1146659159 17:34653063-34653085 GACTCTCTGAGGAAATGGGAAGG + Intergenic
1147186727 17:38717052-38717074 GCACTTAGAAGGAAATGGGATGG + Intronic
1148090574 17:45020491-45020513 GTACCTAGGAGGACAGGGGAAGG - Intergenic
1149063535 17:52453178-52453200 GAACCTACCAGGAAATGGGGTGG - Intergenic
1151149993 17:72076808-72076830 GTGCCTTTGAGAAAGTGGGAGGG - Intergenic
1155357047 18:24962977-24962999 GTACCTATTAGTAAATGGACTGG - Intergenic
1162532862 19:11245875-11245897 GAACCTACAAGTAAATGGGAGGG + Exonic
1164157430 19:22605094-22605116 GCACCTGTCAGGACATGGGATGG - Intergenic
925852461 2:8095909-8095931 TTTCCTATGAGGAAAAGTGAAGG + Intergenic
926965216 2:18402241-18402263 GTAGCTATGTGGAAATTGGAAGG - Intergenic
927452162 2:23218155-23218177 GTGGCTATGAGGAACTGGGCTGG - Intergenic
928573187 2:32628417-32628439 GGAACTGTGAGGAAAAGGGATGG + Intronic
930326234 2:49922386-49922408 GTAACCATGAGGCAAAGGGATGG - Intronic
931034053 2:58216734-58216756 GTACCTGTGTGTGAATGGGAAGG - Intronic
932030582 2:68179630-68179652 GTACCTTTGCAGAAATGGGAAGG + Exonic
943212254 2:184982045-184982067 ATACATATGAGGAAAAGAGAAGG + Intergenic
943713689 2:191126548-191126570 GTACCACTGAGGAAGTGGGTGGG - Intronic
948299213 2:236889432-236889454 GTGGCTTTCAGGAAATGGGAGGG - Intergenic
1169251404 20:4064030-4064052 GGACCTAGGAGGAAATGTGAAGG + Intergenic
1169394904 20:5220522-5220544 GGACATATGAAGCAATGGGAAGG - Intergenic
1174631323 20:51960613-51960635 GTACCTGGGATGAAAAGGGAGGG - Intergenic
1175157956 20:56986000-56986022 GTACCTGTGTGGAATTTGGAAGG + Intergenic
1175449891 20:59054907-59054929 GCACCTATTAGGAACTTGGAAGG - Intergenic
1175575568 20:60058202-60058224 GCACCTGTGAGGAGCTGGGAAGG + Intronic
1177750562 21:25278098-25278120 GTACCTGTGAAGAACTGGGAAGG - Intergenic
1178348040 21:31849056-31849078 ATGCCTGTGAGAAAATGGGAAGG + Intergenic
1179087257 21:38228679-38228701 ATAACTGGGAGGAAATGGGAAGG - Intronic
1182214814 22:28707036-28707058 GTACCTATCTGAAAATGGGTGGG + Intronic
950214167 3:11146472-11146494 GTCCCTATGGGGAAATGCAAGGG + Intronic
952091390 3:29890937-29890959 GTTCTGATGAGGAATTGGGAAGG + Intronic
953593345 3:44282501-44282523 TTTGCCATGAGGAAATGGGATGG - Intronic
954020986 3:47741195-47741217 GTACTTGTGAGGAAAAGAGACGG + Intronic
954197606 3:49005851-49005873 GAACCTACGATGAAATGGTAAGG + Exonic
955824145 3:62927211-62927233 GTACCTATGAAAATCTGGGATGG + Intergenic
959384140 3:105680663-105680685 GTACTTGTGAGAAAATGGAAAGG + Intronic
960242593 3:115363158-115363180 ATATTTATGAGGAAATGGGGAGG - Intergenic
964511085 3:157452668-157452690 GTACATATGAGGAAACAGGCTGG + Intronic
964580214 3:158226118-158226140 GTTCCTCTGAGGGAATGGAATGG + Intronic
965710462 3:171551769-171551791 GTACCTGTGAGGGAAAGGGAAGG - Intergenic
968622223 4:1608985-1609007 GCACCACTGAGCAAATGGGATGG + Intergenic
971039418 4:22735038-22735060 TTACCTTTGAGGAAAAGAGAAGG - Intergenic
974389261 4:61244181-61244203 GTAAATATGATGAAAGGGGAGGG + Intronic
975008495 4:69320826-69320848 GTTCCTAGGTGGAAATGGGTGGG + Intronic
975893059 4:79052130-79052152 GTACCTCTGAGGAAAAGGTGGGG - Intergenic
976753525 4:88475001-88475023 GAAACTATAAGGAAATTGGAGGG + Intronic
979716099 4:123840497-123840519 TTACAGATGAGGAAATGGGGAGG + Intergenic
979773933 4:124563642-124563664 ATTCCTATGAGCAATTGGGAAGG - Intergenic
979839355 4:125418875-125418897 GCACATATGAGAAAATGGTAAGG - Intronic
980521683 4:133944637-133944659 TTACCTTTGAGGAAAATGGATGG + Intergenic
981542515 4:145860517-145860539 GTACCTAAGATAAAATGTGATGG + Intronic
983776082 4:171609329-171609351 GGCCTTATGAGCAAATGGGAAGG + Intergenic
985760972 5:1748503-1748525 TTACCTATGGAGAAAAGGGAGGG + Intergenic
988907606 5:35805327-35805349 GTCCCTATAAGGAATTTGGAGGG - Intronic
991496852 5:67235260-67235282 GTACCTATGTGGACATGTCATGG + Intergenic
994239741 5:97406825-97406847 GTTCCCATGTGGAAAGGGGAGGG - Intergenic
998778263 5:145627849-145627871 GCACATATAAGGAAATGGAAAGG - Intronic
999253860 5:150198719-150198741 GAACCTAGGAGGCAATGGGAGGG + Intronic
1007511065 6:42374668-42374690 CTACCTCTGAGGAGATGGTAGGG - Intronic
1009698489 6:67142589-67142611 GTACCTATGGGGAACTAGAAAGG - Intergenic
1010013757 6:71080477-71080499 TTACAGATGAGGAAATGAGAGGG - Intergenic
1023113460 7:36837790-36837812 GGACCTATAGGGAAATGGCAAGG - Intergenic
1025824364 7:64998590-64998612 ATAACTGGGAGGAAATGGGAGGG - Intronic
1025827008 7:65018763-65018785 CTATGTATAAGGAAATGGGAGGG + Intergenic
1030485036 7:110154590-110154612 CTATCTATTATGAAATGGGAAGG + Intergenic
1030573767 7:111260570-111260592 GCACCTATAAGGTAATGTGAAGG + Intronic
1033109956 7:138564881-138564903 GTAACTGGGAGGAAATGAGAGGG - Intronic
1034059646 7:148075051-148075073 TTAGCTATGAAAAAATGGGAAGG - Intronic
1034816493 7:154176284-154176306 GTATCTTTGTGGATATGGGAAGG + Intronic
1035622585 8:1045000-1045022 GTGCTTATGAGGAAATGACAAGG - Intergenic
1036279495 8:7387930-7387952 GTACATAGGAGGAAATGCAAAGG + Intergenic
1036342024 8:7923947-7923969 GTACATAGGAGGAAATGCAAAGG - Intergenic
1036637087 8:10558689-10558711 GTACCTAGGAAGAAAAGGGCTGG - Intergenic
1037143618 8:15547171-15547193 GTACCTATAATGTAATGGAAAGG + Intronic
1037498901 8:19467077-19467099 GTACCAATGGTGAAATGAGAAGG - Intronic
1040567071 8:48576919-48576941 GTAGCTATTAGGAAATGTGCTGG + Intergenic
1042896172 8:73670545-73670567 ATACCTGAGAGGAAAAGGGAAGG + Intronic
1043559825 8:81479463-81479485 GTACATGTGCAGAAATGGGATGG - Exonic
1051327046 9:15983171-15983193 GTATTTAAGAGGAAAGGGGAAGG - Intronic
1051924325 9:22305397-22305419 GTACCAATGAGGAGGTGGCAGGG + Intergenic
1053349567 9:37404140-37404162 ATCCCTAGGAGGAACTGGGAAGG + Intergenic
1055105192 9:72504843-72504865 GTACCTGTGAGGAAATCAGAGGG + Intergenic
1057053216 9:91941584-91941606 GAACCACTGAGGAAATTGGAAGG - Intronic
1057079956 9:92166492-92166514 GTACACAAAAGGAAATGGGAAGG + Intergenic
1057217259 9:93235978-93236000 GTGCCCCTGAGGAAGTGGGAGGG + Intronic
1057312813 9:93952422-93952444 GTCCATATGAGGAAATGGTGGGG + Intronic
1057837318 9:98455594-98455616 GTAGCCAAGATGAAATGGGAAGG - Intronic
1059506851 9:114807095-114807117 GTACCTATGGTGAAGTGTGATGG - Intergenic
1060364354 9:122994406-122994428 TCACCTATAAGGAAATGGAAGGG - Intronic
1061393668 9:130331762-130331784 ATTCCGATGAGGAGATGGGACGG + Intronic
1061768188 9:132896111-132896133 GTTCATGTGTGGAAATGGGACGG - Exonic
1061851182 9:133416769-133416791 GTACAGATGAGGAAATAGGCTGG - Intronic
1185943304 X:4345801-4345823 GTACTTAAAAGGTAATGGGATGG + Intergenic
1187569054 X:20482661-20482683 GTTCTTATCAGGAAATGAGAAGG - Intergenic
1190084432 X:47383068-47383090 GTGGCTATTAAGAAATGGGATGG + Intronic
1194091692 X:89586230-89586252 GTAACTGGGAGGAAATGGGAGGG - Intergenic
1194645148 X:96450302-96450324 GAATATATGAAGAAATGGGATGG + Intergenic
1195012593 X:100747868-100747890 GAAGGTATTAGGAAATGGGAAGG - Intergenic
1195867705 X:109451098-109451120 GTAGCAATGGGAAAATGGGATGG + Intronic
1196262269 X:113597301-113597323 ATCCCTATGCTGAAATGGGAGGG - Intergenic
1197140164 X:123109045-123109067 GTGCCTAGGATGAAATGAGATGG - Intergenic
1200424119 Y:3003655-3003677 GTAAATGGGAGGAAATGGGAGGG + Intergenic
1200444328 Y:3242293-3242315 GTAACTGGGAGGAAATGGGAGGG - Intergenic
1201859054 Y:18574730-18574752 ATAACTGTGAGGAAATGGGAGGG - Intronic
1201874268 Y:18745651-18745673 ATAACTGTGAGGAAATGGGAGGG + Intronic
1202100741 Y:21305126-21305148 GTACCCATGAAGAAATGTAATGG + Intergenic