ID: 902579483

View in Genome Browser
Species Human (GRCh38)
Location 1:17399138-17399160
Sequence TGTGAGGCCCACTTCGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902579474_902579483 0 Left 902579474 1:17399115-17399137 CCCCCAGTCTAAAAGGGTGAACC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 902579483 1:17399138-17399160 TGTGAGGCCCACTTCGGATGGGG 0: 1
1: 0
2: 0
3: 3
4: 75
902579477_902579483 -3 Left 902579477 1:17399118-17399140 CCAGTCTAAAAGGGTGAACCTGT 0: 1
1: 0
2: 0
3: 12
4: 167
Right 902579483 1:17399138-17399160 TGTGAGGCCCACTTCGGATGGGG 0: 1
1: 0
2: 0
3: 3
4: 75
902579471_902579483 15 Left 902579471 1:17399100-17399122 CCTCAGTGAGCTGCGCCCCCAGT 0: 1
1: 0
2: 2
3: 14
4: 201
Right 902579483 1:17399138-17399160 TGTGAGGCCCACTTCGGATGGGG 0: 1
1: 0
2: 0
3: 3
4: 75
902579476_902579483 -2 Left 902579476 1:17399117-17399139 CCCAGTCTAAAAGGGTGAACCTG 0: 1
1: 0
2: 0
3: 5
4: 111
Right 902579483 1:17399138-17399160 TGTGAGGCCCACTTCGGATGGGG 0: 1
1: 0
2: 0
3: 3
4: 75
902579475_902579483 -1 Left 902579475 1:17399116-17399138 CCCCAGTCTAAAAGGGTGAACCT 0: 1
1: 0
2: 0
3: 7
4: 81
Right 902579483 1:17399138-17399160 TGTGAGGCCCACTTCGGATGGGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902579483 Original CRISPR TGTGAGGCCCACTTCGGATG GGG Intronic
902321323 1:15669176-15669198 TGAGAGGCCCACTTCTTCTGGGG - Intergenic
902579483 1:17399138-17399160 TGTGAGGCCCACTTCGGATGGGG + Intronic
903405426 1:23091523-23091545 TGAGAAGCCCACTTCTGAAGGGG + Exonic
916064344 1:161124002-161124024 TGTGAGGCCCACTGGGGGTTTGG - Intronic
1065730482 10:28705566-28705588 TGTGTGGCCCACTCAGGTTGTGG + Intergenic
1066577035 10:36837279-36837301 TGTGAGGGCCACTTCGAGTATGG - Intergenic
1068277346 10:54818350-54818372 TGTGAGGGGGACTACGGATGTGG - Intronic
1070975979 10:80605988-80606010 TTTGAGGCTCACTCTGGATGAGG - Intronic
1072471319 10:95716690-95716712 CGTGAGGCCCTTGTCGGATGTGG + Intronic
1076572286 10:131440785-131440807 GGTGACGACCACTTCGGAAGCGG - Intergenic
1079100223 11:17536704-17536726 GCTGAGTCCCACTTGGGATGTGG - Intronic
1079727738 11:23897127-23897149 TGTGAGGCCCAAATTAGATGGGG - Intergenic
1081531470 11:43962879-43962901 TCTGACACCCACTTCAGATGAGG + Intergenic
1092901059 12:13059703-13059725 TCTGAGGCCCACATGAGATGTGG + Intronic
1093965817 12:25323911-25323933 TGTGTGGCCCATTTTTGATGTGG + Intergenic
1094571342 12:31644104-31644126 TGTGAGGCTCACTTGGGCTTGGG - Intergenic
1096837983 12:54363317-54363339 TGTAAGGCCGGCCTCGGATGCGG + Exonic
1097579289 12:61433925-61433947 TTTTAGGTCCACTTCTGATGGGG - Intergenic
1097907637 12:64936716-64936738 TGTGAGCATCACTTCAGATGTGG + Intergenic
1105255816 13:18743565-18743587 AGGGAGTCCCACTTCAGATGTGG - Intergenic
1111861259 13:93709776-93709798 TGTCAGGCCTATTTTGGATGTGG + Intronic
1113174538 13:107547184-107547206 TATGAGGCACTCTTCTGATGTGG - Intronic
1114482811 14:23045987-23046009 TGTGACTCCCCCTTCGTATGGGG - Intergenic
1118431750 14:65726412-65726434 TGTGAGCCCCACCAGGGATGTGG - Intronic
1122030001 14:98905263-98905285 TGTGAGGCTCACTCAGGTTGAGG - Intergenic
1122048432 14:99039461-99039483 TGTGAGGCCCACCAGGGAAGAGG - Intergenic
1123120652 14:105914873-105914895 AGTGAGGCCCAGGTCAGATGAGG + Intergenic
1126489877 15:49225320-49225342 TGTGTGGCCCACTTCTGAACAGG - Intronic
1128739498 15:70073888-70073910 TGTGAGGCCCACTTCCGGACTGG - Intronic
1133852165 16:9515695-9515717 TGAGAGGCCCACATCTGCTGAGG + Intergenic
1133924593 16:10182604-10182626 TGGGAGGCCCCCTTGGGAAGGGG - Intronic
1135526141 16:23215031-23215053 TGTGAGGCCAACTTGGGGGGAGG + Intronic
1137017030 16:35387766-35387788 AGTGAAGCCCAATTCAGATGAGG - Intergenic
1141558599 16:84852419-84852441 TGTGTGGCCCCCTTCATATGAGG - Intronic
1146398322 17:32486146-32486168 TCTGAGGCCCACTTCGGCCGCGG + Intergenic
1152325049 17:79631194-79631216 TGTGAGAACCACTGCAGATGTGG + Intergenic
1158528345 18:58235244-58235266 TGTGAGGCCCACTCTCGGTGTGG + Intronic
1162030526 19:7915361-7915383 TGTGAGCCACCCTTGGGATGGGG - Intergenic
1163861753 19:19746631-19746653 TGTGATGCCCTCTGCTGATGGGG - Intergenic
1164927139 19:32139493-32139515 TGTGAGGACCACATGGGCTGGGG - Intergenic
945029559 2:205650654-205650676 TGTGAGGCCCATTCCAGAGGGGG - Intergenic
1169090726 20:2859987-2860009 TGTGAGGCCTGCTTCACATGGGG + Intronic
1173058342 20:39637539-39637561 TGTGAGGGTGACTTGGGATGGGG + Intergenic
1175157149 20:56978829-56978851 TGTGAGGAGCACTTCAGCTGAGG + Intergenic
1181898973 22:26136833-26136855 TGTGAGCCCAACTGCAGATGTGG + Intergenic
958218103 3:90619596-90619618 TGTGAGGCCCTCTTTGGAAACGG - Intergenic
959027942 3:101263185-101263207 TGTGAGGGCCACTTAGTCTGTGG - Intronic
963833947 3:150037435-150037457 TTTGATGCTGACTTCGGATGGGG - Intronic
967436054 3:189447727-189447749 CCTGAGGCCCAATTCTGATGGGG + Intergenic
968513496 4:1005372-1005394 TTGGAGGCCCACTTTGGTTGGGG - Intergenic
968551244 4:1224501-1224523 TGTGAGGCCCACGTGTGCTGTGG + Intronic
970420579 4:15902129-15902151 TGAGAGGCCAACTTCAGAAGGGG - Intergenic
970827157 4:20289866-20289888 TCAGAGGCCCACTACGAATGAGG - Intronic
982304282 4:153913650-153913672 TCTGAGGGCCTCTTTGGATGTGG + Intergenic
982566385 4:156992307-156992329 CATGAGTCCCATTTCGGATGAGG + Intergenic
988821370 5:34889534-34889556 TGTGGGGCCCACCTCAGGTGTGG - Intronic
992951424 5:81861649-81861671 TTTGAGGCCCACTTTGCATCAGG - Intergenic
995831859 5:116362485-116362507 TGTGAGGACCACTTCGGTGCTGG - Intronic
999281495 5:150369366-150369388 TGTGAAGCCCCCTTCTGAGGTGG - Intronic
1000195931 5:158957871-158957893 TGTAAGGACCACTTCAGTTGAGG - Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1002900599 6:1406785-1406807 TGTGAGGCCCGCTGGAGATGGGG + Intergenic
1003005768 6:2380124-2380146 AGTGAAGCCCACTTGTGATGGGG - Intergenic
1006530960 6:34653451-34653473 TGGGAGGATCACTTCAGATGAGG - Intronic
1006979328 6:38134054-38134076 TGTGAGAACCACTTAAGATGGGG + Intronic
1007377718 6:41468012-41468034 TGTGAGGCCCTATTCGGTTCTGG - Intergenic
1023059651 7:36315333-36315355 TGTGCCCCCCACTTCTGATGGGG - Intergenic
1023859809 7:44211800-44211822 TGTGGTTCCCACTTGGGATGTGG - Intronic
1028907971 7:96175999-96176021 TCTGAGGCCCACTACAGATGTGG + Intronic
1053618449 9:39792863-39792885 TGTGAGATTCACTTCGGATTAGG + Intergenic
1053876624 9:42552221-42552243 TGTGAGATTCACTTCGGATTAGG + Intergenic
1053896051 9:42742483-42742505 TGTGAGATTCACTTCGGATTAGG - Intergenic
1054235074 9:62549500-62549522 TGTGAGATTCACTTCGGATTAGG - Intergenic
1054265706 9:62914566-62914588 TGTGAGATTCACTTCGGATTAGG - Intergenic
1056977578 9:91273165-91273187 CGAGAGGCCCACTTCTGATAAGG + Intronic
1060412559 9:123409673-123409695 TGTGAGGCGCAGCTGGGATGAGG + Intronic
1189745352 X:44162863-44162885 TGAGGGGCCCACTACTGATGGGG - Intronic
1195310155 X:103624749-103624771 TTTGAGCCCCAGTTAGGATGAGG + Intronic
1199676737 X:150195776-150195798 TGTGGGGCTCAGTTAGGATGGGG + Intergenic