ID: 902580596

View in Genome Browser
Species Human (GRCh38)
Location 1:17405117-17405139
Sequence ACTAGGATCTTTGTGGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 341}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902580588_902580596 17 Left 902580588 1:17405077-17405099 CCAGGGGCAGGCTGGGGGAGCAG 0: 1
1: 0
2: 5
3: 78
4: 778
Right 902580596 1:17405117-17405139 ACTAGGATCTTTGTGGTTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 341
902580585_902580596 23 Left 902580585 1:17405071-17405093 CCTCAGCCAGGGGCAGGCTGGGG 0: 1
1: 0
2: 7
3: 107
4: 742
Right 902580596 1:17405117-17405139 ACTAGGATCTTTGTGGTTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 341
902580580_902580596 29 Left 902580580 1:17405065-17405087 CCCTGTCCTCAGCCAGGGGCAGG 0: 1
1: 0
2: 5
3: 42
4: 445
Right 902580596 1:17405117-17405139 ACTAGGATCTTTGTGGTTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 341
902580582_902580596 28 Left 902580582 1:17405066-17405088 CCTGTCCTCAGCCAGGGGCAGGC 0: 1
1: 0
2: 6
3: 40
4: 378
Right 902580596 1:17405117-17405139 ACTAGGATCTTTGTGGTTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902580596 Original CRISPR ACTAGGATCTTTGTGGTTCC AGG Intergenic
900699759 1:4038995-4039017 TCTAGAATCTTTATGGTTTCAGG - Intergenic
902366623 1:15979236-15979258 TCTAGAATTTTTGTGGTTTCAGG + Intergenic
902580596 1:17405117-17405139 ACTAGGATCTTTGTGGTTCCAGG + Intergenic
907821914 1:57978445-57978467 TCTAGGATTTTTATGGTTCTGGG - Intronic
909234837 1:73139605-73139627 TCTAGAATTTTTATGGTTCCAGG + Intergenic
909535626 1:76733031-76733053 CCTAGGAGTTTTGTGGTTTCAGG + Intergenic
911249862 1:95563138-95563160 ACTAGGATCACTGAGGTTCTTGG - Intergenic
911322316 1:96429778-96429800 TCTAGAATCTTTATGGTTTCAGG + Intergenic
912033017 1:105273732-105273754 TCTAGGATTTTTATGGTTTCAGG + Intergenic
912129160 1:106580209-106580231 TCTAGTATCTTTATGGTTTCAGG + Intergenic
912301789 1:108525232-108525254 GCTAGGATTTTTGTAGTTTCAGG + Intergenic
912684573 1:111752172-111752194 ATTGGGATCTTTGTGGATCAGGG + Intronic
913338129 1:117729483-117729505 TCTAGAATTTTTGTGGTTTCTGG - Intergenic
913384064 1:118240403-118240425 TCTAGAATCTTTATGGTTTCAGG - Intergenic
915044776 1:153003162-153003184 TCTGGAATCTTTGTGTTTCCAGG - Exonic
915821213 1:159025782-159025804 TCTAGAATCTTTATGGTTTCTGG + Intronic
915855241 1:159376817-159376839 TCTAGAATCTTTATGGTTTCAGG + Intergenic
916382127 1:164223561-164223583 TCTAGGATTTTTATGGTTTCAGG - Intergenic
916526563 1:165615855-165615877 CCTAGAATCTTTATGGTTTCAGG + Intergenic
918684737 1:187400370-187400392 TCTAGGATTTTTATGGTTTCAGG - Intergenic
919255099 1:195110674-195110696 TCTAGGATTTTTGTGGTTTTAGG - Intergenic
919431082 1:197492530-197492552 TCTAGGATTTTTATGGTTTCAGG - Intergenic
921497193 1:215856065-215856087 TCTAGAATTTTTGTGGTTTCAGG - Intronic
921592409 1:217020101-217020123 ACCAGGACCTTTGTGATTCAGGG - Intronic
923926348 1:238631479-238631501 TCTAGAATCTTTATGGTTTCAGG + Intergenic
924250337 1:242126689-242126711 TCTAGAATCTTTGTGGTTTCAGG - Intronic
924882905 1:248182289-248182311 TCTAGAATCTTTATGGTTTCAGG + Intergenic
924894582 1:248322262-248322284 TCTAGAATCTTTATGGTTTCAGG - Intergenic
924935816 1:248769009-248769031 TCTAGAATCTTTATGGTTTCAGG - Intergenic
924955353 1:248921252-248921274 TCTAGGATTTTTATGGTTCTAGG + Intergenic
1064975143 10:21106298-21106320 TCTAGGATTTTTATGGTTTCAGG + Intronic
1064975605 10:21111619-21111641 TCTAGGATTTTTATGGTTTCAGG - Intronic
1065373234 10:25011612-25011634 TCTAGGGTCTTTATGGTTGCAGG - Intronic
1066190508 10:33051183-33051205 TCTAGGATTTTTGTGGTTTCAGG + Intergenic
1067801366 10:49361505-49361527 CCTAGGGTCTTTGAGCTTCCTGG + Intergenic
1068474517 10:57507761-57507783 CTTAGGAGCTCTGTGGTTCCTGG + Intergenic
1068836192 10:61556676-61556698 TCTAGAATTTTTGTGGTTTCAGG - Intergenic
1071361573 10:84851492-84851514 TCTAGGATCTATGTGATTCCAGG - Intergenic
1071933390 10:90499098-90499120 TCTAGGATTTTTATGGTCCCAGG + Intergenic
1072868439 10:99089284-99089306 TCTAGAATCTTTATGGTTTCAGG + Intronic
1073923388 10:108484604-108484626 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1074272862 10:111972120-111972142 ACTGGGATCCATGTGGGTCCTGG - Intergenic
1076099943 10:127768764-127768786 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1078948699 11:16102904-16102926 TCTAGAATCTTTATGGTTTCAGG - Intronic
1079542904 11:21597161-21597183 TCTAGGATTTTTGTGGTCCCAGG - Intergenic
1080672115 11:34390122-34390144 TCTAGGATGTTTGTAGTTTCAGG + Intergenic
1080702190 11:34653293-34653315 ACTATGATGTTTTTGTTTCCCGG - Intronic
1081317897 11:41652608-41652630 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1082647015 11:55739370-55739392 CCTAGGATTTTTATGGTCCCAGG - Intergenic
1083256403 11:61498758-61498780 CCTGGGGTCTTTGTGGTCCCAGG - Intergenic
1083458152 11:62792589-62792611 ACTAGGATCTCTGGGCCTCCAGG - Intronic
1086997464 11:93374390-93374412 TCTAGAATCTTTATGGTTTCAGG + Intronic
1087602439 11:100333813-100333835 TCTAGAATCTTTATGGTTTCAGG - Intronic
1087616969 11:100497431-100497453 TCTAGGATTTTTATGGTTTCAGG - Intergenic
1087996624 11:104817106-104817128 ACTAGGCTCTTTGTGAATGCTGG - Intergenic
1088824998 11:113486103-113486125 TCTAGCATCTTTATGGTTTCAGG - Intergenic
1089549184 11:119257659-119257681 TCTAGAATTTTTGTGGTTTCAGG + Intronic
1090851495 11:130574723-130574745 ACTAGGACTTTTTTGGTTGCAGG + Intergenic
1091070788 11:132561027-132561049 CCTAGAATTGTTGTGGTTCCAGG + Intronic
1091167130 11:133489106-133489128 TCTAGGATTTTTATAGTTCCAGG - Intronic
1091213932 11:133888016-133888038 ACAAGGAACTTGGTGGCTCCTGG + Intergenic
1092438118 12:8469813-8469835 TCTAGAATTTTTATGGTTCCAGG - Intronic
1092871165 12:12807208-12807230 GCTGGGATGTTGGTGGTTCCTGG - Intronic
1093278260 12:17155914-17155936 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1093290716 12:17318104-17318126 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1094728034 12:33142876-33142898 TCTAGGGTTTTTGTGGTTTCAGG + Intergenic
1095500638 12:42834550-42834572 TCTAGAATTTTTGTGGTTTCAGG + Intergenic
1095557827 12:43528686-43528708 TCTAGGATTTTTATGGTTTCAGG - Intronic
1096093868 12:48921628-48921650 ACTAGGAACACTGTGGTCCCAGG + Intronic
1096340757 12:50796788-50796810 TCTAGGATTTTTATGGTTTCAGG - Intronic
1097656140 12:62365664-62365686 TCTAGGATTTTTGTGGTTTTAGG + Intronic
1099317912 12:81107674-81107696 ACGGAGATTTTTGTGGTTCCTGG - Intronic
1099486487 12:83234449-83234471 TCTAGGGTTTTTGTGGTTTCAGG + Intergenic
1099910689 12:88829574-88829596 TCTAGGATTTTTATGGTTCTGGG - Intergenic
1101106940 12:101449870-101449892 ACTAGAATTTTTATGGTTTCAGG + Intergenic
1101202661 12:102453083-102453105 ACTAAGAACTGTGGGGTTCCAGG - Intronic
1101298180 12:103448322-103448344 TCTAGAATCTTTATGGTTTCAGG - Intronic
1102434984 12:112915230-112915252 TCTAGAATCTTTATGGTTTCAGG + Intronic
1103167275 12:118781012-118781034 ATTGCCATCTTTGTGGTTCCAGG + Intergenic
1104524534 12:129506738-129506760 TCTAGAATTTTTGTAGTTCCAGG - Intronic
1105002572 12:132700768-132700790 CCTAGGATCTTTATGGTGTCAGG + Intronic
1105509344 13:21038182-21038204 CCTGGGATCTTGGTGGCTCCTGG - Intronic
1106362183 13:29041068-29041090 TCTAGAATTTTTGTGGTTTCAGG + Intronic
1109974389 13:69812353-69812375 TCTAGGATTTTTATGGTTTCAGG - Intronic
1110325787 13:74213771-74213793 ACTAGGATATTTGGGCTTCAAGG - Intergenic
1110747928 13:79078414-79078436 ACTAGGAATTTTTTGGTTTCAGG - Intergenic
1111791012 13:92854995-92855017 TCTAGTATTTTTGTGGTTTCAGG + Intronic
1113191935 13:107759007-107759029 CCTGAGATCTTGGTGGTTCCTGG - Intronic
1115392826 14:32872704-32872726 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1116248981 14:42456971-42456993 ACTATGATGTTTTAGGTTCCTGG - Intergenic
1118679162 14:68221565-68221587 TCTAGAATCTTTATGGTTTCAGG - Intronic
1120162218 14:81158255-81158277 TCTAGGATTTTTATGGTTTCAGG - Intergenic
1120487732 14:85135852-85135874 CCTAGGAGTTTTGTGGTTTCAGG - Intergenic
1121812019 14:96899857-96899879 AGTAGGAGCTTTTTTGTTCCCGG + Intronic
1122818280 14:104326140-104326162 CCTGGAATCTTTGTCGTTCCTGG + Intergenic
1123148683 14:106159579-106159601 TCTAGGATTTTTATGGTTTCAGG + Intergenic
1125283855 15:38072028-38072050 AATAGGATCTTTTTGTTTACCGG + Intergenic
1125981017 15:44001515-44001537 TCTAGGATTTTTATGGTTTCAGG + Intronic
1126184268 15:45815654-45815676 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1126190975 15:45878342-45878364 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1126239930 15:46429930-46429952 ACTAGGATTTTTATGGTTTTAGG - Intergenic
1126742515 15:51791885-51791907 TCTAGGATTTTTGTGGTCCTAGG - Intronic
1126977686 15:54202696-54202718 TCTAGAATCTTTATGGTTTCAGG - Intronic
1127269368 15:57386887-57386909 AAAAGGATCTTTCTGGTTCTTGG + Intronic
1127316641 15:57801321-57801343 ACTAGGAGCTTTATGGTTTCAGG + Intergenic
1128139435 15:65287954-65287976 ACTAGGGGCCTTGTGGTTCTAGG - Intronic
1132136710 15:99348383-99348405 TCTAGGAGCTTTATGGTTTCAGG + Intronic
1135905201 16:26505723-26505745 ACTTGTATCTTGGTGGTTCTTGG - Intergenic
1135997040 16:27258242-27258264 ACTGTGATCTTTGTGGTTTACGG - Intronic
1136681543 16:31968044-31968066 TCTAGGATTTTTATGGTTTCAGG - Intergenic
1137002593 16:35242710-35242732 ATCAGGATTTTTGTGGTTTCTGG - Intergenic
1137016484 16:35380873-35380895 ATCAGGATTTTTGTGGTTTCTGG - Intergenic
1137242428 16:46667643-46667665 TCTAGGAGCTTTATGGTTTCAGG + Intronic
1137739652 16:50755971-50755993 TCTAGAATCTTTATGGTTTCAGG + Intronic
1137957489 16:52846991-52847013 TCTAGGATCTTTATGGTTTTAGG - Intergenic
1138192557 16:55027149-55027171 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1138632064 16:58304947-58304969 TCTAGGATTTTTATGGTTTCAGG + Intronic
1138837370 16:60455123-60455145 TCTAGGATTTTTATGGTTCTAGG + Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142160393 16:88554574-88554596 ACGAGGACCTTTGTGGTTCAGGG + Intergenic
1143142129 17:4746662-4746684 CCAAGGATCTGTGTGGTCCCAGG - Intergenic
1144155987 17:12503365-12503387 TCTAGAATGTTTGTGGTTTCAGG - Intergenic
1144177708 17:12723079-12723101 ACTAGGATCTTTGGGGATGAGGG + Intronic
1145861984 17:28218654-28218676 ACTTGTGTCTTTGTGGCTCCTGG - Intergenic
1147928333 17:43959970-43959992 ACTTGTGTCTTTGTGGCTCCTGG + Intronic
1149580775 17:57748971-57748993 ACTGGGATCCTTGTGCTTCAGGG - Intergenic
1149961013 17:61110053-61110075 TCTAGAATCTTTATGGTTTCAGG + Intronic
1151079259 17:71309771-71309793 TCTAGAATCTTTGTGGTTTCAGG - Intergenic
1151182323 17:72338303-72338325 CCTAGGATTTTTTTGCTTCCTGG + Intergenic
1153648309 18:7215290-7215312 ACCAGCATCTTGGTGGTTTCTGG - Intergenic
1153742823 18:8146764-8146786 TCTAGGATTTTTGTGGTTTTAGG + Intronic
1155631043 18:27893019-27893041 TCTAGGATTTTTATGGTTTCAGG - Intergenic
1155950593 18:31907771-31907793 ACAAGGAACTTTCTGTTTCCAGG - Intronic
1158085182 18:53642648-53642670 TCTAGGATTTTTATGGTTTCAGG - Intergenic
1160330626 18:77988278-77988300 CCTAGGATCTTTGTGCCTCGAGG - Intergenic
1161442133 19:4297985-4298007 ACAAGGCTCTTTGTGGACCCAGG - Exonic
1161874318 19:6895840-6895862 TCTAGGATCTTTGAGGTACATGG + Intronic
1163045250 19:14636728-14636750 TCTAGGATCTGTGTGATTCTAGG - Intronic
1165283792 19:34820303-34820325 AATAGGATCATTCTGGTTTCTGG + Intergenic
1166214063 19:41324368-41324390 TCTAGGACCTTTGTGATTCTAGG - Exonic
1166726797 19:45033375-45033397 ACTGGCCTCTTTGTTGTTCCTGG - Intronic
1168265314 19:55220312-55220334 ACAAAGAGCTGTGTGGTTCCTGG - Intergenic
1168692451 19:58385383-58385405 ACTGGGGTCTGTGTGGTTGCAGG - Intergenic
925446795 2:3933235-3933257 TCTAGGATTTTTATGGTTTCAGG + Intergenic
926731166 2:16036806-16036828 GCTAGGATTTTTGGGGTTGCAGG + Intergenic
927024699 2:19054382-19054404 TCTAGAATCTTTATGGTTTCAGG + Intergenic
927722499 2:25394273-25394295 TCTAGAATCTTTATGGTTTCAGG - Intronic
928188491 2:29138117-29138139 TCTAGGATTTTTGTAGTTCGAGG + Intronic
930474639 2:51865843-51865865 TCTAGAATCTTTATGGTTTCGGG + Intergenic
930539365 2:52685837-52685859 TCTAGAATTTTTGTGGTTTCAGG - Intergenic
931629653 2:64287284-64287306 ACTTGGATCTTTGTGGAGGCTGG + Intergenic
933398302 2:81759805-81759827 TCTAGAATTTTTGTGGTTTCAGG - Intergenic
933433088 2:82210156-82210178 TCTAGAATTTTTGTGGTTTCAGG + Intergenic
936695123 2:114937201-114937223 TCTAGGATCTTTATGGTTTCAGG + Intronic
936772035 2:115925242-115925264 TCTAGAATCTTTATGGTTTCAGG + Intergenic
937798541 2:126054092-126054114 TCTAGAATTTTTATGGTTCCAGG + Intergenic
938089671 2:128423159-128423181 ACTCGGTTCTTTGTGGTTGCAGG + Intergenic
938585234 2:132683974-132683996 AATAGCATCTGTGTGGTACCTGG - Intronic
939090800 2:137778030-137778052 ACTAGGATCTGTCTGGCTCCAGG + Intergenic
942607151 2:177704528-177704550 ACTTGGCTCTTGGTGGTCCCAGG - Intronic
943892087 2:193301675-193301697 TCTAGTTTCTATGTGGTTCCTGG - Intergenic
944305781 2:198177297-198177319 TCTAGGATTTTTATGGTTTCAGG + Intronic
945520446 2:210821039-210821061 TCTAGGATTTTTGTGGTTTTCGG - Intergenic
946015240 2:216599024-216599046 ACTAGGCTCCTTCTGGTTGCAGG - Intergenic
946541423 2:220688398-220688420 CCTTGGATCTCTGTGGCTCCTGG + Intergenic
948403265 2:237699911-237699933 GGAAGGCTCTTTGTGGTTCCTGG + Intronic
1170726477 20:18932275-18932297 TCTAGAATATTTGTGGTTTCAGG + Intergenic
1171514906 20:25722018-25722040 TCTAGGATTTCTGTGGTTTCAGG + Intergenic
1172952630 20:38731581-38731603 ACGTGGGTCTTGGTGGTTCCAGG - Intergenic
1176323113 21:5353639-5353661 TCTAGGATTTTTATGGTTCTAGG - Intergenic
1176480767 21:7285259-7285281 TCTAGGATTTTTATGGTTCTAGG - Intergenic
1177128088 21:17221159-17221181 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1177453245 21:21300280-21300302 ATTTGGATCTTCGTGGTTCAAGG - Intronic
1177459795 21:21395892-21395914 TCTAGGATTTTTATGGTTTCAGG - Intronic
1177876529 21:26639011-26639033 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1178155991 21:29854717-29854739 ACTAGGATCATGATGGTTCAAGG + Intronic
1181800106 22:25341200-25341222 CCTAGGGTTTTTGTGGTTTCAGG + Intergenic
1183814751 22:40290428-40290450 ACTCTGGTCTTTGAGGTTCCTGG + Intronic
949792754 3:7811361-7811383 AGAAGGATCTTTGTTGTTCATGG + Intergenic
950830358 3:15868908-15868930 TCTAGGATTTTTATGGTTTCAGG - Intergenic
950840333 3:15962504-15962526 TCTAGAATCTTTGTGGTTTCAGG + Intergenic
951153329 3:19319276-19319298 TCTAGAATCTTTATGGTTTCAGG + Intronic
951273050 3:20650940-20650962 ACTAGGATCTGTGTGTTGGCTGG - Intergenic
951749882 3:26022915-26022937 TCTAGAATCTTTATGGTTTCGGG + Intergenic
953080619 3:39613798-39613820 TCTAGGATTTTTATGGTTTCAGG - Intergenic
953242860 3:41165339-41165361 ACCCGGTTCTTTGTGATTCCAGG + Intergenic
953277136 3:41513177-41513199 TCTAGAATCTTTATGGTTTCAGG - Intronic
953495662 3:43384799-43384821 TCTAGAATCTTTATGGTTTCAGG - Intronic
954036848 3:47855360-47855382 ACCAGTTCCTTTGTGGTTCCAGG - Exonic
955154172 3:56399819-56399841 ACTCTGTTCTTTGTGTTTCCTGG - Intronic
955505474 3:59628724-59628746 TCTAGGGTTTTTATGGTTCCAGG - Intergenic
955894050 3:63680100-63680122 ACTAGTATCTTTGTGGCTTTGGG + Intergenic
957658299 3:83111488-83111510 CCTAGGATTTTTGTGGTTTTAGG - Intergenic
957775779 3:84756295-84756317 ATTTGGATCTCTGCGGTTCCTGG - Intergenic
958070512 3:88604846-88604868 TCTAGAATCTTTATGGTTTCAGG - Intergenic
960379642 3:116944342-116944364 TCTAGGATTTTTATGGTTTCGGG - Intronic
960750713 3:120949527-120949549 TCTAGGATTTTTATGGTTTCAGG + Intronic
960762753 3:121091887-121091909 TCTAGGATCTTTATGGTTTTAGG + Intronic
960763965 3:121104775-121104797 TCTAGGATTTTTGTGGTTTCAGG - Intronic
962140184 3:132782131-132782153 AGCAGGATGTTTGTGGTTCCTGG + Intergenic
962147048 3:132850685-132850707 TCTAGAATCTTTATGGTTTCGGG + Intergenic
962997438 3:140644725-140644747 TCTAGGATCTTTATGGTTTTAGG + Intergenic
963446188 3:145411624-145411646 TCTAGAATTTTTGTGGTTTCAGG - Intergenic
963832922 3:150027941-150027963 TCTAGAATCTTTATGGTTTCAGG - Intronic
964657070 3:159079121-159079143 AGTTGGTTCTTTGTGTTTCCAGG - Intronic
965252125 3:166355472-166355494 TCTAGGGTCTTTGTGGTTTTAGG - Intergenic
966665711 3:182468790-182468812 TCTAGAATCTTTATGGTTTCAGG + Intergenic
970539468 4:17062683-17062705 TCTAGAATCTTTATGGTTTCAGG - Intergenic
970679957 4:18495437-18495459 TCTAGGATTTTTGTGGTTTTAGG - Intergenic
970791574 4:19863916-19863938 TCTAGGATTTTTATGGTTTCAGG + Intergenic
972016309 4:34250415-34250437 TCTAGGATTTTTGTGGTCCTAGG + Intergenic
972040807 4:34595534-34595556 TCTAGAATTTTTGTGGTTTCAGG + Intergenic
973675636 4:53259330-53259352 TCTAGAATCTTTATGGTTTCAGG + Intronic
974084698 4:57247161-57247183 TCTAGAATCTTTATGGTTTCTGG - Intergenic
974879895 4:67742163-67742185 TCTAGAATCTTTATGGTTTCAGG + Intronic
974979680 4:68939576-68939598 TCTAGGATTTTTATGGTTTCAGG - Intronic
975623728 4:76320791-76320813 TCTAGAATTTTTGTGGTTTCAGG - Intronic
977904528 4:102460199-102460221 TCTAGAATCTTTATGGTTTCAGG - Intergenic
978515320 4:109562086-109562108 AGTAGCATTTTTGTGGATCCCGG + Intronic
979194998 4:117910430-117910452 TCTAGAATTTTTGTGGTTTCAGG + Intergenic
979553972 4:122023728-122023750 CCTAGAATCTTTATGGTTTCAGG - Intergenic
979717264 4:123855299-123855321 CCTTGGATCTTGGTGGTTGCTGG + Intergenic
979790366 4:124772853-124772875 TCTAGAATTTTTGTGGTTTCAGG + Intergenic
979988284 4:127342447-127342469 TCTAGGATCTTTATGGTTTCAGG - Intergenic
980860832 4:138497662-138497684 TCTAGAATCTTTATGGTTTCAGG + Intergenic
981052944 4:140329329-140329351 TCTAGAATCTTTATGGTTTCAGG - Intronic
981168889 4:141598032-141598054 TCTAGAATCTTTATGGTTTCAGG - Intergenic
981481044 4:145239431-145239453 TCTAGGGTTTTTGTGGTTTCAGG + Intergenic
981866410 4:149425449-149425471 ACTAGGATCTTGGGGGTTGATGG + Intergenic
982330040 4:154171125-154171147 TCTAGGGTTTTTGTGGTTTCAGG + Intergenic
982628590 4:157801813-157801835 TCTAGGATGTTTATGGTTTCAGG + Intergenic
983014948 4:162602084-162602106 ACAAGGACCCTTGTGCTTCCTGG + Intergenic
986040124 5:3985872-3985894 TCTAGGATTTTTATGGTTTCAGG + Intergenic
986202814 5:5593760-5593782 ACTGGGATTTTTATGGTTTCAGG - Intergenic
986355260 5:6917861-6917883 CCTAGAATCTTTATGGTTTCAGG - Intergenic
986487753 5:8256836-8256858 TCTAGAATTTTTGTGGTTTCAGG + Intergenic
987527791 5:19075994-19076016 TCTAGAATCTTTATGGTTTCAGG - Intergenic
988698890 5:33652725-33652747 TCTAGGATTTTTGTAGTTTCAGG + Intronic
989727873 5:44608856-44608878 ACTAGAATTTTTATGGTTTCAGG - Intergenic
990119419 5:52431685-52431707 AATAGGGTCTATGTGATTCCAGG - Intergenic
991042645 5:62191875-62191897 TCTAGAATCTTTATGGTTTCAGG + Intergenic
992580195 5:78166876-78166898 TCTAGAATCTTTATGGTTTCAGG - Intronic
994221993 5:97207027-97207049 TCTAGGATTTTTATGGTTTCAGG + Intergenic
994353272 5:98769845-98769867 ACTAGGATCTAGCCGGTTCCAGG - Intronic
996255500 5:121398188-121398210 TCTAGGATTTTTGTGGTTTTAGG + Intergenic
996323636 5:122247924-122247946 TCTAGGATTTTTATGGTTCTAGG + Intergenic
996769581 5:127072173-127072195 AACAGGGTCTTTCTGGTTCCAGG + Intronic
996961965 5:129262035-129262057 CCTAGAATCTTTATGGTTTCAGG + Intergenic
997218813 5:132139810-132139832 TCTAGAATCTTTATGGTTTCAGG - Intergenic
997576710 5:134984164-134984186 TCTAGAATTTTTGTGGTTTCAGG - Intronic
999490760 5:152048478-152048500 TCTAGGATTTTTATGGTTTCAGG + Intergenic
1000688492 5:164284305-164284327 ACTAGTATCTTTATGGTTTCAGG + Intergenic
1001119821 5:168970726-168970748 AAGAGGATCTTTCTGGTTTCAGG - Intronic
1001931294 5:175674876-175674898 TCTTGCATCTTTGTGGTTGCAGG - Intronic
1003431125 6:6038615-6038637 TCTAGGATTTTTATGGTTTCAGG + Intergenic
1003581241 6:7342758-7342780 TCTAGGATTTTTATGGTTTCAGG + Intronic
1003851747 6:10230682-10230704 AATAGAATTTTTGTGGTTTCAGG - Intergenic
1006639371 6:35481317-35481339 TCAAGGATCTGTGTGTTTCCTGG - Intronic
1007872438 6:45055701-45055723 TCTAGAATCTTTATGGTTTCAGG - Intronic
1008171831 6:48217272-48217294 TCTAGAATTTTTATGGTTCCAGG + Intergenic
1008401962 6:51073687-51073709 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1008431586 6:51424180-51424202 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1009577766 6:65489006-65489028 TCTAGGATTTTTATGATTCCAGG - Intronic
1009589456 6:65647545-65647567 TCTAGAATCTTTATGGTTTCAGG - Intronic
1010028077 6:71242844-71242866 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1010358200 6:74960900-74960922 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1010637351 6:78277335-78277357 TCTAGAATCTTTGTGGTTTCAGG + Intergenic
1010675809 6:78741596-78741618 TCTAGGATTTTTATGGTTCTAGG - Intergenic
1010858245 6:80870768-80870790 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1011628064 6:89299373-89299395 ACTAGGACTTTTGAGGATCCTGG + Intronic
1011832394 6:91389154-91389176 TCTAGAATTTTTGTGGTTTCAGG - Intergenic
1012005764 6:93711407-93711429 TCTAGGATTTTTATGGTTTCAGG + Intergenic
1012079791 6:94741765-94741787 TCTAGAATTTTTGTGGTTTCAGG - Intergenic
1012509407 6:99985704-99985726 TCTAGGATTTTTGTAGTTTCAGG - Intronic
1012717172 6:102690088-102690110 TCTAGAATCTTTGTGGTTTCAGG + Intergenic
1013405869 6:109842870-109842892 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1013998803 6:116341604-116341626 TCTAGGGTTTTTATGGTTCCAGG + Intronic
1014735019 6:125083190-125083212 ACTCTGACCTTTGTGGTTCTTGG + Exonic
1015707087 6:136099885-136099907 TCTAGGGTTTTTGTGGTTTCAGG + Intronic
1016333485 6:142978840-142978862 TCTAGGGTTTTTGTGGTTTCAGG - Intergenic
1017274030 6:152544819-152544841 ATTATGATCTTTGTGCTTCCGGG - Intronic
1017472174 6:154749833-154749855 ACTAGCATCTTTGTGGAGCAGGG + Intronic
1020495002 7:8839533-8839555 ACTAGGATTTTTATAGTTTCAGG + Intergenic
1020788783 7:12600123-12600145 TCTAGAATCTTTATGGTTTCAGG + Intronic
1020949793 7:14661083-14661105 TCTAGGGTCTTTGTGGTTTTAGG - Intronic
1021091396 7:16486938-16486960 TCTAGGTTTTTTGTTGTTCCTGG - Intronic
1021159152 7:17250357-17250379 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1021176426 7:17455197-17455219 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1021183707 7:17538074-17538096 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1023467380 7:40471025-40471047 GCCTGGATCTTTGTGGCTCCAGG + Intronic
1024417436 7:49123280-49123302 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1024672932 7:51612974-51612996 ACTGAGAGCTTTGTGGCTCCTGG - Intergenic
1024768796 7:52693300-52693322 TCTAGTATTTTTATGGTTCCAGG - Intergenic
1027457024 7:78404698-78404720 TCTAGGATTTTTATGGTTTCAGG - Intronic
1027638920 7:80709901-80709923 TCTAGGATTTTTATGGTTTCAGG - Intergenic
1030480704 7:110100356-110100378 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1031261717 7:119529457-119529479 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1034229733 7:149513089-149513111 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1034986467 7:155518621-155518643 AATGGCATCTTAGTGGTTCCTGG + Intronic
1037353621 8:17993200-17993222 TCTAGAATTTTTGTGGTTTCAGG + Intronic
1038143729 8:24874346-24874368 TCTAGGATTTTTATGGTTTCAGG - Intergenic
1039527039 8:38226171-38226193 AGTGGAATCGTTGTGGTTCCTGG + Intronic
1041837072 8:62228473-62228495 ACTAGGGTTTTTATGGTTCTAGG - Intergenic
1043556279 8:81434098-81434120 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1043848211 8:85185392-85185414 TCTAGGATTTTTATGGTTTCAGG - Intronic
1043875970 8:85486647-85486669 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1044903722 8:96976878-96976900 TCTAGAATCTGTGTGGTTTCAGG - Intronic
1046432424 8:114145825-114145847 GTTATGATCTTTGTGTTTCCAGG + Intergenic
1047342031 8:123990829-123990851 TCTAGGAATTTTGTGGTTTCTGG + Intronic
1047604572 8:126462287-126462309 TCTAGGATTTTTATGGTTCTAGG - Intergenic
1050400689 9:5250284-5250306 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1050891060 9:10825157-10825179 ACTATGATCTCTGTGGAACCTGG - Intergenic
1051230932 9:14954742-14954764 TCTAGGATTTTTGTGGTTTTAGG - Intergenic
1052253959 9:26431722-26431744 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1053126898 9:35588954-35588976 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1053548202 9:39046028-39046050 ACTAGGGCCTTTATGGTTACTGG - Intergenic
1055218822 9:73902525-73902547 TCTAGAATCTTTGTGGTTGATGG - Intergenic
1055318624 9:75059436-75059458 TCTAGGATTTTTGTGGTTTTAGG - Intergenic
1055430909 9:76242777-76242799 ACTAGCATCTTTGTGCATCTTGG + Intronic
1056027059 9:82509639-82509661 TCTAGAATTTTTGTGGTTTCAGG - Intergenic
1057541828 9:95980908-95980930 TCTAGAATCTTTTCGGTTCCTGG + Intronic
1059033082 9:110722121-110722143 TCTAGAATTTTTATGGTTCCAGG - Intronic
1059306250 9:113355422-113355444 CCTAGCAGCTTTCTGGTTCCTGG - Intronic
1059674169 9:116521525-116521547 TCTAGAATCTTTATGGTTTCAGG - Intronic
1060450126 9:123730137-123730159 TCTAGGATTTTTGTGGTTTTAGG - Intronic
1062177805 9:135173899-135173921 ACCAGCATCCTTGTTGTTCCTGG + Intergenic
1185587323 X:1249535-1249557 TCTAGGCTATTTGAGGTTCCTGG + Intergenic
1185658353 X:1704882-1704904 TCTAGGATTTTTATGGTTTCAGG + Intergenic
1186093006 X:6070053-6070075 ACTAGTATGTTACTGGTTCCTGG - Intronic
1186772804 X:12834137-12834159 TCTAGGATTTTTGTGGTTTTAGG + Intergenic
1188397871 X:29706820-29706842 TCTAGAATCTTTATGGTTTCAGG - Intronic
1188466457 X:30486978-30487000 TCTAGGATTTTTGTGGTTTTAGG + Intergenic
1188889969 X:35597774-35597796 TCTAGAATCTTTGTTGTTTCAGG - Intergenic
1190979972 X:55448285-55448307 TCTAGGATTTTTATGGTTTCAGG - Intergenic
1191001936 X:55669441-55669463 TCTAGGATTTTTATGGTTCTAGG + Intergenic
1193160801 X:78227044-78227066 TCTAGGATTTTTATGGTTCTAGG + Intergenic
1193366668 X:80642589-80642611 TCTAGAATCTTTATGGTTTCAGG - Intergenic
1193433475 X:81441555-81441577 TCTAGGATATTTGTAGTTCGAGG + Intergenic
1193567513 X:83096501-83096523 TCTAGGATTTTTATGGTTTCAGG - Intergenic
1193994825 X:88352699-88352721 CCTAGGATATTTGGGGTTCCAGG + Intergenic
1194191433 X:90841238-90841260 TCTAGGATTTTTGTGGTTTTAGG - Intergenic
1194225756 X:91255009-91255031 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1194347275 X:92781737-92781759 TCTAGAATTTTTGTGGTTTCAGG - Intergenic
1194615232 X:96092708-96092730 TCTAGGATGTTTGTGGTTTCGGG - Intergenic
1195173385 X:102290918-102290940 TCTAGAATTTTTGTGGTTTCAGG + Intergenic
1195185480 X:102396178-102396200 TCTAGAATTTTTGTGGTTTCAGG - Intronic
1195226843 X:102804488-102804510 TCTAGGATTTTTATGGTTTCAGG + Intergenic
1195838652 X:109148303-109148325 TCTAGGATCTTTGCTGTTTCAGG - Intergenic
1195855115 X:109323113-109323135 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1196176805 X:112647204-112647226 TCTAGGGTTTTTATGGTTCCAGG - Intronic
1196193364 X:112816281-112816303 ACTAGGATCTTTATGTGTGCTGG - Intronic
1196250526 X:113454728-113454750 TCTAGAATTTTTGTGGTTTCAGG + Intergenic
1198559444 X:137833039-137833061 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1199234154 X:145471613-145471635 TCTAGGCCCTTTGTGCTTCCTGG + Intergenic
1200358997 X:155582203-155582225 TCTAGGGTTTTTGTGGTTTCAGG - Intronic
1200538076 Y:4423653-4423675 TCTAGGATTTTTGTGGTTTTAGG - Intergenic
1200562298 Y:4719895-4719917 TCTAGAATCTTTATGGTTTCAGG + Intergenic
1200655602 Y:5898375-5898397 TCTAGAATTTTTGTGGTTTCAGG - Intergenic
1200674780 Y:6136377-6136399 ACTGGCTTCTTTGTGTTTCCTGG - Intergenic
1200879553 Y:8198475-8198497 TCTAGGGTCTTTATGGTTTCAGG - Intergenic
1201931084 Y:19349476-19349498 CCTAGGATTTTTGTGGTTTTGGG - Intergenic
1201961543 Y:19686014-19686036 TCTAGGATTTTTATGGTTTCAGG + Intergenic