ID: 902583403

View in Genome Browser
Species Human (GRCh38)
Location 1:17423465-17423487
Sequence CGCACCTGCAGCAGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902583403_902583412 23 Left 902583403 1:17423465-17423487 CCTCCAGGACTGCTGCAGGTGCG 0: 1
1: 0
2: 0
3: 9
4: 187
Right 902583412 1:17423511-17423533 TCCAGCGGAAGGCAGGCCTGAGG 0: 1
1: 0
2: 0
3: 24
4: 221
902583403_902583414 24 Left 902583403 1:17423465-17423487 CCTCCAGGACTGCTGCAGGTGCG 0: 1
1: 0
2: 0
3: 9
4: 187
Right 902583414 1:17423512-17423534 CCAGCGGAAGGCAGGCCTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 247
902583403_902583409 8 Left 902583403 1:17423465-17423487 CCTCCAGGACTGCTGCAGGTGCG 0: 1
1: 0
2: 0
3: 9
4: 187
Right 902583409 1:17423496-17423518 CCTGTATCTGTGAATTCCAGCGG 0: 1
1: 0
2: 2
3: 19
4: 179
902583403_902583411 16 Left 902583403 1:17423465-17423487 CCTCCAGGACTGCTGCAGGTGCG 0: 1
1: 0
2: 0
3: 9
4: 187
Right 902583411 1:17423504-17423526 TGTGAATTCCAGCGGAAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 123
902583403_902583410 12 Left 902583403 1:17423465-17423487 CCTCCAGGACTGCTGCAGGTGCG 0: 1
1: 0
2: 0
3: 9
4: 187
Right 902583410 1:17423500-17423522 TATCTGTGAATTCCAGCGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902583403 Original CRISPR CGCACCTGCAGCAGTCCTGG AGG (reversed) Intronic
900419979 1:2552004-2552026 GGCAGGTCCAGCAGTCCTGGCGG - Intergenic
900424446 1:2569638-2569660 GGCAGGTCCAGCAGTCCTGGCGG + Intergenic
900540024 1:3197919-3197941 CTGACCAGCAGCAGGCCTGGCGG - Intronic
900983351 1:6059037-6059059 CTCTCCTGCAGCAGCCCTGTGGG - Intronic
901300624 1:8197839-8197861 CGTCCCTGCAGCTTTCCTGGCGG + Intergenic
901320873 1:8339204-8339226 TCCACCTGCAGAAGCCCTGGGGG + Intronic
902523147 1:17033802-17033824 CTCACCTCCAGCAATCCTGTGGG - Intronic
902583403 1:17423465-17423487 CGCACCTGCAGCAGTCCTGGAGG - Intronic
903440369 1:23383640-23383662 AGCACCTGCAGCCTGCCTGGTGG + Intronic
903510824 1:23873800-23873822 CCTTCCAGCAGCAGTCCTGGTGG - Exonic
903694064 1:25194692-25194714 CGCGGCTGCCGCAGCCCTGGGGG - Intergenic
903789406 1:25882269-25882291 CCCTCCTGCATCAGCCCTGGAGG + Intergenic
904995581 1:34628903-34628925 TGGCCCTGCAGCAGTCCTGTGGG + Intergenic
907047983 1:51311652-51311674 ACCACATGCAGCTGTCCTGGAGG - Intronic
908417480 1:63927588-63927610 TGAACTAGCAGCAGTCCTGGGGG + Intronic
914934267 1:151964522-151964544 AACACCAGCTGCAGTCCTGGTGG - Intergenic
918943128 1:191027022-191027044 GGCAGCTGCAGCTGTCCTGATGG - Intergenic
919536072 1:198789284-198789306 CCCACCCCCAGCAGGCCTGGAGG - Intergenic
919877606 1:201881795-201881817 AGCAGCTACAGCAGTCCAGGTGG + Exonic
920024966 1:202987647-202987669 CCCACGGTCAGCAGTCCTGGGGG + Intergenic
920612346 1:207454247-207454269 CACACCTGCAGGCGGCCTGGGGG - Exonic
922696188 1:227732165-227732187 CTGACCTGCAGCAGGCCTGCTGG - Exonic
922767980 1:228165913-228165935 CACAGCTCCTGCAGTCCTGGTGG + Exonic
923413309 1:233731074-233731096 TGCACCTGCAGCTGTTGTGGTGG + Intergenic
1062943300 10:1439999-1440021 AGGACCTGCCTCAGTCCTGGGGG - Intronic
1064128060 10:12681456-12681478 CGCTCCTGCAGCAGGGCTGCTGG + Intronic
1065857081 10:29839446-29839468 TGCCCCTGCAGCAGGGCTGGGGG + Intergenic
1067053564 10:43038746-43038768 AGAACCTGCAGCATCCCTGGAGG + Intergenic
1067528712 10:47055113-47055135 CCCACCTGCAGGCATCCTGGAGG + Intergenic
1070103958 10:73414305-73414327 GGAAGTTGCAGCAGTCCTGGGGG + Intergenic
1071229849 10:83572853-83572875 CCCACCTGGAGCAGTCAGGGAGG + Intergenic
1071447753 10:85764510-85764532 TTCACCTGCAGCAGCCCAGGTGG - Intronic
1071817914 10:89251732-89251754 CTCACCTGGAGCTGTCCTGCCGG + Exonic
1076548834 10:131264289-131264311 CACAGGTGCAGCAGTGCTGGTGG + Intronic
1077152460 11:1078398-1078420 GGCACCGGCAGCGGTCCTGCTGG - Intergenic
1077900813 11:6486831-6486853 AGCAACTGCAGTAATCCTGGTGG - Intronic
1078440561 11:11362710-11362732 GGCACCTTCATCATTCCTGGTGG + Intronic
1078931157 11:15912926-15912948 GGCAGCTGCACCACTCCTGGGGG + Intergenic
1080218535 11:29873691-29873713 AGCACCCTAAGCAGTCCTGGTGG - Intergenic
1081640216 11:44747951-44747973 CTCACCTGCAGCAGAGCTGCAGG + Intronic
1083274178 11:61587623-61587645 CCCAGCTGCAGAATTCCTGGGGG + Intergenic
1083628493 11:64084157-64084179 CGCGCCTTCTGCAGTCCTGGAGG + Intronic
1084751326 11:71205912-71205934 TTCACCTGCTGCAGCCCTGGGGG - Intronic
1084798001 11:71521187-71521209 CTCACCTGCAGAAATCCTTGAGG - Intronic
1085054856 11:73397644-73397666 GGCAACAGGAGCAGTCCTGGGGG + Intergenic
1086888255 11:92226821-92226843 CGAACCTGCAGCAGCCGCGGCGG + Intergenic
1086954048 11:92917286-92917308 GGCCCATGCAGGAGTCCTGGAGG + Intergenic
1089758804 11:120707825-120707847 CCCACATGCAGCAGTCCATGTGG - Intronic
1090645996 11:128767038-128767060 CGCACCTCCAGCATACTTGGGGG - Intronic
1092770348 12:11891096-11891118 CACACTTCCAGCAATCCTGGTGG - Exonic
1093101909 12:15038091-15038113 AGCACCTGCTACAGTACTGGAGG + Intergenic
1094221529 12:27998841-27998863 TGCACCTGCAGATTTCCTGGAGG + Intergenic
1095556614 12:43513896-43513918 CTCACCCGCAACAGGCCTGGGGG - Intronic
1096776201 12:53965898-53965920 GGCGCCTGCAGCAGTCTGGGTGG + Intergenic
1096783476 12:54004137-54004159 TGCAGCTGCAGCATTTCTGGGGG + Intronic
1100159988 12:91846815-91846837 CCCACCTGCAGCTGTCCTTAAGG + Intergenic
1101041877 12:100763622-100763644 TGCTCCTGCAGCAGGACTGGGGG - Intronic
1102033018 12:109753774-109753796 GGCACCTGCAGGAATGCTGGTGG - Intronic
1102962576 12:117102226-117102248 CGCTCCTGAAGAACTCCTGGTGG + Intergenic
1103435701 12:120923762-120923784 AGCACCTGGAGCAGTCCTTTGGG + Intergenic
1104002698 12:124870277-124870299 CTCACCAGCAGCAATCCAGGTGG - Intronic
1104755336 12:131265629-131265651 CACGCCTGCAGCAGACCTCGGGG - Intergenic
1105416832 13:20220726-20220748 GCCAACTGCAGCAGTCCTGGGGG + Intergenic
1105585352 13:21738150-21738172 CTCAACTGCAGCTGTCCAGGAGG + Intergenic
1114621972 14:24101481-24101503 GGCACCTTCAGGTGTCCTGGAGG - Intronic
1117650427 14:57899377-57899399 CACACCTGGAGCAGTACTGCTGG - Intronic
1118839957 14:69502545-69502567 CCCAGGTGCAGCAGGCCTGGGGG + Intronic
1121504274 14:94464452-94464474 CTCTCCTGCAGCAGGCATGGGGG + Intronic
1121646895 14:95524574-95524596 AGGACCTGCGGCAGTCCTGTTGG - Intergenic
1131034082 15:89209828-89209850 GGCAAACGCAGCAGTCCTGGTGG - Intergenic
1132151705 15:99466953-99466975 CACAGCGGCAGCAGGCCTGGAGG - Intergenic
1132525737 16:413673-413695 CCCACGTGCAGCAGGGCTGGGGG - Intergenic
1132865874 16:2092491-2092513 CGCACCTGCCGCAGCCGTGGGGG + Exonic
1133736327 16:8618786-8618808 CCCACTTTCAGCAGTCCTGGAGG + Intergenic
1136268226 16:29133067-29133089 CGCTTCTGCAGGTGTCCTGGCGG + Intergenic
1136275464 16:29177049-29177071 CTCACCTGGAGAAGCCCTGGGGG + Intergenic
1136499764 16:30664456-30664478 GGCACCTGCAGCAGGGGTGGGGG - Exonic
1136869987 16:33798123-33798145 AGCACCTGCACCTGCCCTGGAGG - Intergenic
1139477721 16:67211028-67211050 CGGAGCAGCAGCAGGCCTGGGGG + Exonic
1141622998 16:85247054-85247076 AGCAGCAGCAGCAGCCCTGGGGG - Intergenic
1142071537 16:88093405-88093427 CGCTTCTGCAGGTGTCCTGGCGG + Intronic
1142079825 16:88143114-88143136 CTCACCTGGAGAAGCCCTGGGGG + Intergenic
1203102184 16_KI270728v1_random:1317931-1317953 AGCACCTGCACCTGCCCTGGAGG + Intergenic
1143627323 17:8118028-8118050 CGCAGCAGCAGCCGGCCTGGAGG + Exonic
1143927297 17:10383166-10383188 CGTAGCTGCGGCAGGCCTGGAGG + Intergenic
1144524370 17:15977898-15977920 AGCACCTCCTGCAGTCCTGGAGG + Exonic
1144779357 17:17800050-17800072 GGAACCTGCAGGAGTCCTGTCGG - Intronic
1146945474 17:36870262-36870284 TGAACCTGCAGCTGGCCTGGGGG - Intergenic
1147154035 17:38534185-38534207 CGCAACTCCACCGGTCCTGGAGG + Intronic
1147721595 17:42543070-42543092 AGCACCAGCCGCAGTTCTGGGGG + Exonic
1149467819 17:56893525-56893547 AGCAGCTGCAGCAGGCTTGGTGG - Intronic
1149477798 17:56977954-56977976 CGCATTTGCAGGGGTCCTGGTGG + Intergenic
1149602603 17:57903076-57903098 CCCACCTCCAGCCATCCTGGAGG + Intronic
1149693843 17:58600741-58600763 CTCTCCTTCAGCAGTGCTGGAGG - Intronic
1151667866 17:75555974-75555996 TGCAGCTGCAGCAGCCATGGTGG + Intronic
1152250990 17:79212440-79212462 GGCCCCTGCAGCAGTCCTACAGG - Intronic
1152484021 17:80577778-80577800 TGGACCTGCAGCCTTCCTGGAGG + Intronic
1152749954 17:82058076-82058098 GGCTCCAGCAGCAGTCCTGGGGG + Exonic
1153666377 18:7370498-7370520 CCCACCAGCAGCAGCCCCGGGGG - Intergenic
1154976479 18:21462154-21462176 CGCACCTGCGGCACTGATGGTGG - Intronic
1157506021 18:48227256-48227278 AGCAGCAGCAGCATTCCTGGTGG - Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160498298 18:79388038-79388060 CTCAGCTGCAGCAGACCTGCTGG - Intergenic
1160681317 19:412843-412865 CCCGCCTGCGGCAGGCCTGGAGG - Intergenic
1160789686 19:917766-917788 CGCACCTGCTGCCGTCCCGGGGG + Intronic
1161405263 19:4088041-4088063 CGGACATGCTGCAGTCCAGGGGG - Intergenic
1163714358 19:18865433-18865455 CTCACCTGCAGCAGGCCCGTTGG - Exonic
1166744792 19:45136488-45136510 GGTAGCTGCTGCAGTCCTGGGGG + Intronic
1167466573 19:49653529-49653551 GGCGGCTGCAGCAGTGCTGGTGG - Exonic
1168079964 19:54002661-54002683 CACACCTGCATTACTCCTGGGGG + Intronic
925210923 2:2045362-2045384 GCCTCCTGCAGCAGGCCTGGTGG + Intronic
925736493 2:6968517-6968539 TGTGGCTGCAGCAGTCCTGGGGG + Intronic
925969842 2:9098611-9098633 CACACCTGCAGCTGACCAGGGGG + Intergenic
926280906 2:11445019-11445041 CCTTCCTGCAGCAGTCCTGCCGG - Exonic
929543495 2:42840821-42840843 CCCCACTGCAGGAGTCCTGGTGG - Intergenic
930021556 2:47004831-47004853 CTCAGCTGCAGGAGTCATGGGGG - Intronic
931695488 2:64867697-64867719 TGCGGCTGCAGCACTCCTGGTGG - Intergenic
937355074 2:121193074-121193096 CACACCTGCAGAACTCCTGCTGG + Intergenic
938811320 2:134855531-134855553 ATCTCCTGCAGCAGTCGTGGTGG - Intronic
941906005 2:170716503-170716525 CGCACCTGCAGCCGTCCTTCGGG + Exonic
942054838 2:172172711-172172733 CGCAACTGCAGCCGTGCCGGGGG + Intergenic
942599829 2:177629383-177629405 TGCAGCTGCAGCTGACCTGGAGG + Exonic
947779247 2:232742619-232742641 TGCATTTGCAGCAGTCCAGGTGG + Intronic
948392452 2:237622437-237622459 GGCTGCTGCAGCAGTTCTGGAGG - Intergenic
948580529 2:238984977-238984999 GGCACCCGTAGGAGTCCTGGAGG - Intergenic
1170525133 20:17228727-17228749 CACACCTGGAGGAGCCCTGGCGG - Intronic
1175118900 20:56703309-56703331 CGACCCTGGAGCAGTGCTGGGGG + Intergenic
1175383172 20:58577499-58577521 GGCACCTGCGGGAGACCTGGGGG - Intergenic
1176200741 20:63859207-63859229 GGCAGCGGCAGGAGTCCTGGAGG - Intergenic
1176218953 20:63961047-63961069 AGCACCTGCAGCAGGGCTGCTGG + Intronic
1176675581 21:9774375-9774397 AGCACCTGCAGGAGCCCTGATGG + Intergenic
1176862051 21:14016053-14016075 CTGACCCCCAGCAGTCCTGGAGG + Intergenic
1179887328 21:44319745-44319767 CCCCCCTGCAGGCGTCCTGGCGG + Intronic
1181147291 22:20858333-20858355 CCCACCTGCAGCGGCCCTGCAGG + Intronic
1182144964 22:27991991-27992013 AACACCTGCAGCCATCCTGGTGG + Intronic
1182312070 22:29416333-29416355 CCCACCTGCAGCAGTGATGCAGG - Intronic
1182550628 22:31099051-31099073 CGCCCCTACAGCAGCCCTGGCGG + Exonic
1183194133 22:36341681-36341703 CACACCTGCAGCAGGGCTGCGGG - Intronic
1183552104 22:38495198-38495220 TGCAGCAGCAGCAGCCCTGGTGG + Intronic
1183663247 22:39233700-39233722 TGGGCCTGCAGCTGTCCTGGGGG - Intronic
1184678193 22:46054560-46054582 AGCACCTGCAGCAGGGGTGGAGG + Intronic
1184749176 22:46474365-46474387 CCCACCTGCAGCAGCCCGAGGGG - Intronic
1184816633 22:46876803-46876825 CTTCCCTGCAGCAGCCCTGGGGG - Intronic
954453829 3:50586282-50586304 CACACATACAGCAGTCCTGCAGG + Intergenic
965802797 3:172511924-172511946 CACACCTGGAGCAGTGCAGGAGG + Intronic
967037133 3:185656243-185656265 CTCACCTGCAGCAGGACTGCTGG + Intronic
967490566 3:190086445-190086467 CCAACCTGCAGCAGTTCTGCTGG + Intronic
968628262 4:1637662-1637684 GGCCACTGCAGCAGTGCTGGGGG + Intronic
971252974 4:24988710-24988732 TGGACCTGCAGTATTCCTGGGGG + Intergenic
973943390 4:55932919-55932941 GGCACCTGCAGAAGTCGTGAAGG + Intergenic
975118573 4:70705184-70705206 CGCAGCAGCAGCGCTCCTGGAGG + Intronic
975683386 4:76897484-76897506 CGCCCCAGCAGCAGCCCAGGCGG - Exonic
976081038 4:81355316-81355338 TGCACCAGCTGGAGTCCTGGTGG + Intergenic
984565692 4:181327452-181327474 CACACCTGCAAGAGTACTGGGGG - Intergenic
985399961 4:189584313-189584335 AGCACCTGCAGGAGCCCTGATGG - Intergenic
986994357 5:13589931-13589953 TGCACCTAGGGCAGTCCTGGAGG - Intergenic
991107761 5:62862631-62862653 AGCACCTGCTCCAGTCTTGGAGG - Intergenic
992866427 5:80960936-80960958 CGCAGCTGCAGCCCTCCAGGAGG - Exonic
998152273 5:139764357-139764379 CCCAGCTGCAGCAGCCCAGGCGG - Intergenic
998262171 5:140639732-140639754 CGCGCCTTCCGCAGTGCTGGGGG - Exonic
999124307 5:149235736-149235758 CACATCTGCACCAGTTCTGGGGG - Intronic
1000963908 5:167632088-167632110 CACATCTGCAGCAATCCTGTGGG + Intronic
1002204407 5:177553321-177553343 GGCTCCTGCAGGAGTCTTGGAGG - Intronic
1002916312 6:1530498-1530520 GGCACCTGCTGCATTCTTGGTGG + Intergenic
1006333920 6:33410870-33410892 CTCACCTCCAACAGGCCTGGAGG - Intronic
1006370304 6:33640215-33640237 TGGAGCTGCAGCTGTCCTGGGGG - Intronic
1007356088 6:41318868-41318890 TGCACGTGCCGCTGTCCTGGAGG + Intergenic
1007842540 6:44728468-44728490 CGCACCTGCAGGAGACTAGGTGG - Intergenic
1016696412 6:147001271-147001293 CTCAGCTGCAGGACTCCTGGGGG + Intergenic
1019061593 6:169261239-169261261 CGCATCTGTGGCAGTCTTGGAGG - Intergenic
1019352870 7:563154-563176 CCCACCTGCACCTGCCCTGGTGG - Intronic
1019560665 7:1654966-1654988 CACCCCTGCAGCAGCCCGGGAGG + Intergenic
1019659896 7:2218365-2218387 CGCAGCTGCACCAGGGCTGGGGG - Intronic
1019895444 7:3979035-3979057 CACACCCACAGCAGTCCTGATGG + Intronic
1020258955 7:6519972-6519994 CCCACCTGCAGCATTCTTGATGG - Intronic
1022511331 7:30936729-30936751 CTCTCCTGCAGCAGTCCAGCTGG + Intergenic
1023907072 7:44530739-44530761 GCCACCTGCAGAAGCCCTGGGGG - Intronic
1024385736 7:48749101-48749123 CTCCACTGCAGGAGTCCTGGGGG + Intergenic
1024733073 7:52274133-52274155 CGCAGCTCCTGCAGTTCTGGAGG - Intergenic
1029459046 7:100685040-100685062 AGCACCTGCAGCAGGTGTGGGGG - Exonic
1029474760 7:100776433-100776455 CACACATGCCGCAGACCTGGCGG - Exonic
1033290472 7:140078661-140078683 CGACCCTGCAGCAGACATGGGGG + Intergenic
1034338523 7:150338405-150338427 ACCACCCGCAGCGGTCCTGGAGG + Exonic
1039079608 8:33722229-33722251 CGCACCTGGAGCCCACCTGGAGG - Intergenic
1040293672 8:46138322-46138344 CACGCCTGAAACAGTCCTGGGGG + Intergenic
1040308362 8:46223858-46223880 CCCTCCTGGAACAGTCCTGGGGG - Intergenic
1040325880 8:46341269-46341291 CCCACCTGAAACAGCCCTGGGGG - Intergenic
1041648693 8:60280773-60280795 CGCACCTGCTGCGGTCCGGAGGG - Intronic
1044781653 8:95749926-95749948 GGCCGCTGCAGGAGTCCTGGAGG + Intergenic
1048998902 8:139812008-139812030 CAGCCCTGCAGCAGACCTGGAGG + Intronic
1049674957 8:143885246-143885268 CACTGCTGCAGCAGGCCTGGGGG + Intergenic
1049812669 8:144582448-144582470 GGCCCCAGCAGCAGCCCTGGGGG + Intronic
1051014411 9:12458288-12458310 CACACCTGCTACAGTCATGGAGG - Intergenic
1059391613 9:114002740-114002762 GCCACCTGGAGCAGTTCTGGGGG - Intronic
1061949245 9:133927010-133927032 GGCACCTGCAGAAGTGCTGCGGG - Intronic
1062155553 9:135046271-135046293 CTCTCCTGCAGCATCCCTGGTGG + Intergenic
1191137724 X:57083416-57083438 CATGCCAGCAGCAGTCCTGGAGG - Intergenic