ID: 902584807

View in Genome Browser
Species Human (GRCh38)
Location 1:17432240-17432262
Sequence GCAGATAACCAGGGGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902584807_902584817 21 Left 902584807 1:17432240-17432262 CCTAGCTTCCCCTGGTTATCTGC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 902584817 1:17432284-17432306 GCCTGGCTGGAATATGCTACAGG 0: 1
1: 0
2: 1
3: 6
4: 79
902584807_902584813 -1 Left 902584807 1:17432240-17432262 CCTAGCTTCCCCTGGTTATCTGC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 902584813 1:17432262-17432284 CCCTTCTTTGTTTAACTGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 136
902584807_902584815 4 Left 902584807 1:17432240-17432262 CCTAGCTTCCCCTGGTTATCTGC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 902584815 1:17432267-17432289 CTTTGTTTAACTGGCAGGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 131
902584807_902584816 8 Left 902584807 1:17432240-17432262 CCTAGCTTCCCCTGGTTATCTGC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 902584816 1:17432271-17432293 GTTTAACTGGCAGGCCTGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 164
902584807_902584811 -5 Left 902584807 1:17432240-17432262 CCTAGCTTCCCCTGGTTATCTGC 0: 1
1: 0
2: 0
3: 12
4: 193
Right 902584811 1:17432258-17432280 TCTGCCCTTCTTTGTTTAACTGG 0: 1
1: 0
2: 1
3: 16
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902584807 Original CRISPR GCAGATAACCAGGGGAAGCT AGG (reversed) Intronic
901012700 1:6210365-6210387 GCAGATGACCAGGTGGACCTGGG - Exonic
901393650 1:8964662-8964684 CCAGAGAACTGGGGGAAGCTGGG - Intronic
901468410 1:9438697-9438719 GCAGCTGACCTGGGGGAGCTGGG - Intergenic
901494630 1:9613988-9614010 CAAGAGAACCAGGGGAAGATGGG - Exonic
901931766 1:12600575-12600597 GCAGGTCACCATGGGGAGCTGGG - Intronic
902584807 1:17432240-17432262 GCAGATAACCAGGGGAAGCTAGG - Intronic
903601297 1:24542891-24542913 TCAGAAGACCCGGGGAAGCTTGG - Intergenic
904163120 1:28535899-28535921 GCTGAAATCCAGGGGAAGCCGGG + Exonic
904266231 1:29319870-29319892 GCAGGTCACCAGGGGAGGCTGGG + Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
908164914 1:61448489-61448511 CCAGAAAGCCAGGGGTAGCTGGG - Intronic
908571788 1:65419189-65419211 TCAGGTAGCCAGGGGAAGCTAGG + Intergenic
908641640 1:66230061-66230083 GCTGACAACAAAGGGAAGCTTGG + Intronic
910465333 1:87493072-87493094 GAAGATAAAGAGGGGAAGGTGGG + Intergenic
910836510 1:91518145-91518167 GCAGATAACCTGGTGATACTAGG + Intronic
912591672 1:110827423-110827445 GCTGATCACCACGAGAAGCTAGG - Intergenic
913182160 1:116332812-116332834 GCACATCACCAAAGGAAGCTTGG - Intergenic
916175338 1:162033457-162033479 GCAGATAACTTGCTGAAGCTTGG + Intergenic
916607771 1:166359843-166359865 GTAGAGAACCAGGGGATCCTGGG + Intergenic
917143252 1:171859118-171859140 ACACATAACCTGGAGAAGCTGGG - Intronic
919135373 1:193501222-193501244 GCAGAGAACCGTGGGCAGCTGGG + Intergenic
919539580 1:198830467-198830489 GGAGAAAACCAGTGGTAGCTGGG - Intergenic
920123638 1:203676666-203676688 CCAGATCACCAGGGGGAGCAAGG + Intronic
920791049 1:209093080-209093102 GCAGATACCATGGGGAACCTTGG + Intergenic
922800347 1:228362148-228362170 GGTGAGAACCAGAGGAAGCTTGG - Intronic
1064613594 10:17129373-17129395 GCAGATGAGCAGGGGCAGTTGGG - Intronic
1069877877 10:71574175-71574197 GCAGATAAAGAGGGGGAGTTGGG - Intronic
1070691731 10:78532136-78532158 GCAGATGGCCAGTGGATGCTGGG - Intergenic
1070780700 10:79135958-79135980 GTACACAATCAGGGGAAGCTGGG + Intronic
1071093353 10:81945924-81945946 GCAGGAAACCACCGGAAGCTAGG + Intronic
1074433727 10:113416025-113416047 GGAGCTCACCAGGGGAAGCCAGG + Intergenic
1077289880 11:1784073-1784095 GCAGACAGCCAGGGTCAGCTGGG - Intergenic
1077784525 11:5368039-5368061 GCAAAGAACCAAGTGAAGCTTGG - Intronic
1078184786 11:9042370-9042392 ACAGAAAGCCAGGGGAATCTTGG - Intronic
1079289655 11:19175696-19175718 GCAGAAATCCAGGGGTAGATGGG - Intronic
1080177122 11:29378419-29378441 GAAGATAAGCTGTGGAAGCTAGG - Intergenic
1081461560 11:43277033-43277055 CCAGAAAACCACTGGAAGCTAGG + Intergenic
1081794814 11:45811901-45811923 GCAGATCCCCAGGGGCTGCTGGG + Exonic
1084213096 11:67632824-67632846 GCAGATACTCAGGGCAAGTTGGG + Intronic
1086142233 11:83512049-83512071 GGAGGGAGCCAGGGGAAGCTGGG + Intronic
1088702012 11:112421928-112421950 GGAGATAACAAGGGGAACCCTGG - Intergenic
1090081324 11:123614808-123614830 GCTGATAACCAGCAGCAGCTTGG - Exonic
1091027731 11:132156993-132157015 GCCCATAGCCAGCGGAAGCTGGG + Intronic
1091792216 12:3278493-3278515 GCAGACAACGAAGGGAAGCTGGG - Exonic
1100680128 12:96909359-96909381 GGAGATGACCATGGGAATCTGGG + Intronic
1101777154 12:107805844-107805866 CCAGAGAACCACGGAAAGCTGGG + Intergenic
1101967491 12:109291471-109291493 GCAGAAAACCAGGGCAGGATGGG - Intronic
1104238792 12:126966513-126966535 GCAGGAAACCAGGAGAAGGTAGG + Intergenic
1108033461 13:46261455-46261477 GCAGGCAACCACTGGAAGCTGGG + Intronic
1110513266 13:76378741-76378763 GCAGGTAGCCAGGGGACACTGGG + Intergenic
1114369945 14:22075744-22075766 CCAGAAAACCACGAGAAGCTGGG + Intergenic
1116870304 14:50063703-50063725 GCAGAAAAGCATGGGTAGCTGGG + Intergenic
1118385904 14:65255378-65255400 GCAGATACCCAGAGGGAGATAGG - Intergenic
1119604273 14:76001406-76001428 CTAGATAGCGAGGGGAAGCTAGG - Intronic
1119666061 14:76485983-76486005 GCTGACATCCAGGGGGAGCTTGG + Intronic
1119709561 14:76812296-76812318 GAAGTTAACCTGGGGAAGATCGG + Intronic
1121068290 14:90991057-90991079 GCAGAATATCAGGGTAAGCTGGG + Intronic
1121235366 14:92388183-92388205 GCAGATGCCAAGGGGAGGCTGGG - Intronic
1122478481 14:102029112-102029134 TCAGACTACCAGGGGAAGCCAGG - Intronic
1124207712 15:27736583-27736605 GAAGATAACCAGGGGCATTTAGG - Intergenic
1125574902 15:40748550-40748572 GCAGTTAACCAGGGACACCTGGG - Intronic
1128982583 15:72197923-72197945 GGAGAGAAGCTGGGGAAGCTGGG - Intergenic
1129192897 15:73947704-73947726 GGAGAAACCCAGGGGAAGGTGGG + Intronic
1132911707 16:2317144-2317166 GGAGCTGACCAGGGGAAGGTTGG - Intronic
1132982608 16:2746211-2746233 GCAGAGATCCAGGGGCAGGTAGG - Intergenic
1134494210 16:14719593-14719615 GCAGAGAACCATTTGAAGCTGGG - Intronic
1134499591 16:14758713-14758735 GCAGAGAACCATTTGAAGCTGGG - Intronic
1136151056 16:28349456-28349478 GCAGAGAACCATTTGAAGCTGGG + Intronic
1136195687 16:28651720-28651742 GCAGAGAACCATTTGAAGCTGGG - Intronic
1136212025 16:28765845-28765867 GCAGAGAACCATTTGAAGCTGGG - Intronic
1136256745 16:29045773-29045795 GCAGAGAACCATTTGAAGCTGGG - Intronic
1136990948 16:35151111-35151133 GCTGATACCCAGGAGAGGCTGGG + Intergenic
1139936255 16:70573486-70573508 GCAGACTTCCAGAGGAAGCTCGG - Exonic
1140280046 16:73545588-73545610 GCAGCAAACCTGGGGAAACTGGG - Intergenic
1141495499 16:84406837-84406859 GAGGATAACCAGGGGAAGTGGGG - Intronic
1142412834 16:89924898-89924920 GCAGATGCTCAGGGGAGGCTTGG - Intronic
1146677606 17:34784309-34784331 GGAGATAACCCTGGGAAGATGGG + Intergenic
1151428210 17:74044999-74045021 ACAGATAGCCAGGGGCAGCAAGG - Intergenic
1151889446 17:76943505-76943527 GCAGATTCCCACGCGAAGCTGGG - Intronic
1152072066 17:78138834-78138856 GCAGAAAGCCAAGGGAAGCAGGG + Intronic
1152885447 17:82846544-82846566 GCTGAGACCCAGGGGAAGCTTGG + Intronic
1153673862 18:7438445-7438467 GCAGATAAGCTGAGGAAGCCAGG + Intergenic
1154117764 18:11626194-11626216 GCAGAGAACCATTTGAAGCTGGG + Intergenic
1155045491 18:22099614-22099636 GCTGATAAACAGTGGAAGATGGG + Intergenic
1158158163 18:54449157-54449179 CCAGCTAACCATGGGAAGCTAGG + Intergenic
1159123956 18:64201454-64201476 CCTGGTAACCAGGGGAAGATGGG + Intergenic
1159424864 18:68272175-68272197 GCAGGCAACCACCGGAAGCTAGG + Intergenic
1160469319 18:79114294-79114316 GCAGATGACCCGAGGAATCTAGG + Intronic
1162365264 19:10244804-10244826 ACAGATATTCAGGGGAGGCTGGG + Intergenic
1163701937 19:18790478-18790500 ACAGAGAGCCAGGGAAAGCTGGG - Intronic
1165126401 19:33600924-33600946 AAAGACAACCAGGGGCAGCTAGG - Intergenic
1167528433 19:50000087-50000109 CCAGAAAACCAGGGACAGCTGGG - Intronic
1167727455 19:51225907-51225929 GCTGACAACCAGGAGAAGATCGG - Exonic
1168680418 19:58311427-58311449 GCAGTAAAGCATGGGAAGCTTGG - Intronic
925957826 2:8985580-8985602 GCAGATAATTATGGGAAGCTAGG - Intronic
928389977 2:30902089-30902111 TCAGACAGCCAGGGAAAGCTTGG + Intergenic
928531179 2:32193218-32193240 ACAGAAGACTAGGGGAAGCTGGG - Intronic
929486810 2:42361830-42361852 CCAGGTTGCCAGGGGAAGCTTGG - Exonic
930956110 2:57204774-57204796 GCAGAGAACCAGCAGATGCTGGG + Intergenic
934653277 2:96104262-96104284 GCAGAGGAGCAGGGGAAGTTGGG - Intergenic
937121945 2:119446635-119446657 GCAGAGACCCAGGGGAAGAAGGG - Intronic
937319226 2:120951085-120951107 ACAGATGACCAGGGGAATGTCGG + Intronic
937474817 2:122205843-122205865 GGAGTTAACCATGGGAAGTTGGG + Intergenic
940200368 2:151143597-151143619 GCAGATGTCCTGGGGAAACTGGG - Intergenic
941293557 2:163707116-163707138 ACAGATAAACATGGTAAGCTTGG - Intronic
941875293 2:170426183-170426205 GAAGATAAACAGGGGGTGCTGGG + Intronic
941916115 2:170815137-170815159 GCATACAACCAGGTGAAGCTCGG - Intronic
943727114 2:191263238-191263260 GCAGATAAGAAGGGGAAAGTAGG - Intronic
945564488 2:211380216-211380238 GCAGAAAACCAGGAGCTGCTTGG + Exonic
1169470162 20:5878202-5878224 GCACATTGACAGGGGAAGCTGGG - Intergenic
1169475913 20:5931027-5931049 GCAGATGCCAGGGGGAAGCTGGG - Intergenic
1173583783 20:44166628-44166650 ACAGACACCCAGGGGAGGCTGGG + Intronic
1173925992 20:46781702-46781724 CCAGTTCACCAGGGGAAGCCTGG - Intergenic
1174439751 20:50541130-50541152 GCTGATATCCAGGGAATGCTGGG - Intronic
1174505466 20:51014959-51014981 GCACAGAGCGAGGGGAAGCTGGG + Intronic
1175340432 20:58225963-58225985 GCAGATACCCAGTGGAGGCCAGG - Intronic
1176075982 20:63248399-63248421 GCAGGGAACCAGGGGAAACGTGG - Intronic
1176239484 20:64069336-64069358 GCAGAGAGCCAGGGCCAGCTGGG - Intronic
1176262359 20:64188724-64188746 GCAGATGACCAGTGGCAGATGGG + Intronic
1179353832 21:40640187-40640209 GCAGAAAACTATGGGAAGGTGGG + Intronic
1180238719 21:46483408-46483430 GCAGATAAGCATGAGAGGCTTGG + Intronic
1180754599 22:18152285-18152307 GCAGAAAACCTGGGGAGGGTGGG - Intronic
1181908155 22:26216168-26216190 ACAGAAAACCAGGGAGAGCTGGG + Intronic
1182413090 22:30203506-30203528 GCAGAGAAGCAGGGGAAGGATGG - Intergenic
1183781721 22:40003206-40003228 GCAGGTAACACAGGGAAGCTGGG + Intronic
1184520804 22:44992855-44992877 GAAGAAAACCAGGGAGAGCTGGG - Intronic
1184834665 22:47014164-47014186 GCAGAAAGCCAGGGGTAGCCCGG - Intronic
952405913 3:33005036-33005058 GAAGAAAACCAGGAGAAGTTTGG + Intronic
952889671 3:38031525-38031547 GCCGATAGCCAGGGGAAGAGAGG - Intergenic
955163694 3:56490023-56490045 GCACAGGACCAGGGGAAGGTTGG - Intergenic
955494398 3:59516604-59516626 TCAGATAAACAGGGGAACATGGG + Intergenic
957383554 3:79466889-79466911 GAATATATCCAGAGGAAGCTTGG + Intronic
961098343 3:124176589-124176611 GGAGACAAGCAGGAGAAGCTAGG + Intronic
961311596 3:126005527-126005549 GCACAGAGCCAGGGGAGGCTGGG - Intergenic
965119777 3:164539486-164539508 CCAGATAACTAGTGGTAGCTAGG + Intergenic
966639537 3:182174353-182174375 TCAGACAACCAGGGGAAGGATGG + Intergenic
969043134 4:4316749-4316771 GCATATAACCAGAGGAAACTCGG + Intronic
969291805 4:6244944-6244966 GCAGGTGACCAGGGGTAACTCGG + Intergenic
969616913 4:8258647-8258669 TAAGATCACTAGGGGAAGCTGGG - Intergenic
969881869 4:10180994-10181016 GCAGACAACCATGAGAACCTTGG - Intergenic
974004038 4:56537986-56538008 GTAGAAATCCAGGTGAAGCTAGG - Intronic
977435905 4:96993935-96993957 GAAGAGAAAAAGGGGAAGCTGGG + Intergenic
977799603 4:101211151-101211173 GCAAATAAGCAGGGGAAGCCAGG + Intronic
979572216 4:122241071-122241093 GATGATAACCAAGGGATGCTGGG + Intronic
981248101 4:142564230-142564252 GCAGTTTACCTGGGGAAGCCAGG + Intronic
983321595 4:166202457-166202479 GTAGATAACCAGGGTAAGTGGGG - Intergenic
984197063 4:176670923-176670945 AGAGATCACCAGGGGAAGTTAGG + Intergenic
986907803 5:12516830-12516852 GCAAATAACCAGTTGAAACTTGG - Intergenic
987237348 5:15956278-15956300 GAAGACAACCATGGGCAGCTTGG - Intergenic
990599005 5:57338404-57338426 GCAGATAACCAGAGGCAGTGTGG - Intergenic
992143924 5:73825975-73825997 TCAGATAACCAAGGGAAGAGTGG + Intronic
997375339 5:133393705-133393727 GAAGGTTACCAGGGGAACCTGGG - Intronic
997490721 5:134273570-134273592 GAAGGGAGCCAGGGGAAGCTAGG + Intergenic
998887572 5:146710237-146710259 GCATATTAGCAGGGAAAGCTTGG - Intronic
998979492 5:147685997-147686019 GTAGACAACCAGCTGAAGCTAGG + Intronic
999228691 5:150048690-150048712 GAAAATAACTAGGGGGAGCTTGG + Intronic
1000973501 5:167739920-167739942 GGAGATAACAAGGGGAAGCGAGG - Intronic
1002318884 5:178363269-178363291 GCAGATAACAAGAGGATGATAGG - Intronic
1003958290 6:11186573-11186595 TCAGAGAAGCTGGGGAAGCTGGG - Intronic
1004621024 6:17330482-17330504 GCAGTAGACCAGGGGAAGCATGG - Intergenic
1007277376 6:40685052-40685074 GCAGAAGACCAGGTTAAGCTGGG - Intergenic
1008510008 6:52267389-52267411 GAAGATAACCTGGGTAGGCTGGG - Intronic
1008613824 6:53207414-53207436 GCTGAAATTCAGGGGAAGCTGGG - Intergenic
1013304235 6:108833344-108833366 GCAGACTTCCAGGGAAAGCTTGG - Intergenic
1016390049 6:143565714-143565736 GCAGAAAACCAGTGGATGATGGG + Intronic
1016977118 6:149820149-149820171 CCACAGAACAAGGGGAAGCTGGG + Exonic
1019554859 7:1624149-1624171 TCAGAAAAGCAGGGGTAGCTGGG + Intergenic
1020434086 7:8143584-8143606 GCAGAGAGCCAGGGAATGCTGGG + Intronic
1022407029 7:30100010-30100032 GCCGACAACCACCGGAAGCTAGG - Intronic
1022978026 7:35576298-35576320 GCAGATAAGGAAGAGAAGCTTGG + Intergenic
1023842644 7:44105729-44105751 GCAGACAGCCAGGGGACGCAGGG - Intronic
1023992283 7:45135405-45135427 GCAGCCAGCCCGGGGAAGCTGGG + Intergenic
1024242969 7:47449473-47449495 GGAGTTAACCAGGTAAAGCTGGG - Intronic
1030204508 7:106939878-106939900 CCAGAAAAGCAGAGGAAGCTTGG + Intergenic
1031456894 7:121992284-121992306 GCAGATGACCAAGGGGAGATAGG - Intronic
1033601725 7:142893475-142893497 GGGGACAACCAGGGGAAGATTGG - Intergenic
1034099101 7:148436310-148436332 GCAGGTGGCCAGGGGGAGCTGGG + Intergenic
1034266347 7:149782914-149782936 GCAGAAAGGCAGAGGAAGCTCGG - Intergenic
1037162814 8:15793444-15793466 GTAGATAACTGGGGGAAGATAGG - Intergenic
1037802540 8:22043399-22043421 GCAGAGACCCAGGGGAAGTGGGG - Intronic
1039557602 8:38487831-38487853 GCAGAGAGCCAGTGGCAGCTGGG - Intergenic
1044155799 8:88845176-88845198 GCAGTTACCCAGGAGAAGGTGGG + Intergenic
1045251310 8:100485393-100485415 GCAGAAAACCAGGAAAAGCTGGG - Intergenic
1047778252 8:128091242-128091264 GCAGAGCACCAGGGCAACCTTGG - Intergenic
1050385582 9:5086929-5086951 GCAGATAATCAAGGGAAGGGGGG - Intronic
1050425522 9:5508999-5509021 GCAGATCCCCAGAGGAAGCACGG + Intergenic
1052283287 9:26756584-26756606 GGAGAGAGCCAGGGGAGGCTGGG + Intergenic
1059474837 9:114537730-114537752 GCAGATAACCACCAGGAGCTAGG + Intergenic
1060412702 9:123410637-123410659 GCAGCTACCCAGTGGATGCTGGG + Intronic
1060671777 9:125476100-125476122 GCAGGGAGCCAGAGGAAGCTAGG + Intronic
1062275898 9:135730512-135730534 GGAGATGAGCAGGGGAAGCAAGG + Intronic
1062534718 9:137016419-137016441 GCAGACAACCAGAGGCAGGTGGG + Exonic
1062710373 9:137972056-137972078 GAAGGTAACCAGGGGAACCTGGG - Intronic
1189695304 X:43656117-43656139 GCTGATACCCGGGGGGAGCTGGG - Intronic
1192434522 X:71134845-71134867 GCAGGTAAGCAGAGGAAGCGGGG + Exonic
1196057224 X:111368738-111368760 AGAGATAACTAGGGGAACCTTGG - Intronic
1197062295 X:122195782-122195804 GCAGATAACCAGGGTATGTGAGG - Intergenic
1197596554 X:128470921-128470943 GCAGTTACTCTGGGGAAGCTTGG + Intergenic
1197808239 X:130417418-130417440 GGAGATAACCTGGGAAAACTGGG - Intergenic
1198160316 X:134001567-134001589 GAAGACAAACAGGTGAAGCTGGG - Intergenic
1199115688 X:143989337-143989359 ACAGAAAACCACAGGAAGCTAGG - Intergenic
1201071259 Y:10149197-10149219 GCACATAGCCTGGTGAAGCTTGG - Intergenic
1202169302 Y:22024097-22024119 GCAGAGAACCAGAGGAAGGAGGG - Intergenic
1202222059 Y:22562268-22562290 GCAGAGAACCAGAGGAAGGAGGG + Intergenic
1202321056 Y:23633399-23633421 GCAGAGAACCAGAGGAAGGAGGG - Intergenic
1202549711 Y:26036657-26036679 GCAGAGAACCAGAGGAAGGAGGG + Intergenic