ID: 902589102

View in Genome Browser
Species Human (GRCh38)
Location 1:17460705-17460727
Sequence TTCCCAGGGCTCCTCCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902589097_902589102 -4 Left 902589097 1:17460686-17460708 CCACATGCAAGATGCTGGCTTCC No data
Right 902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG No data
902589095_902589102 -2 Left 902589095 1:17460684-17460706 CCCCACATGCAAGATGCTGGCTT No data
Right 902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG No data
902589096_902589102 -3 Left 902589096 1:17460685-17460707 CCCACATGCAAGATGCTGGCTTC No data
Right 902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG No data
902589091_902589102 30 Left 902589091 1:17460652-17460674 CCAGGGGCCAAGGAGGATGCTTC No data
Right 902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG No data
902589093_902589102 23 Left 902589093 1:17460659-17460681 CCAAGGAGGATGCTTCAGGCAAA No data
Right 902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902589102 Original CRISPR TTCCCAGGGCTCCTCCAGGG TGG Intergenic
No off target data available for this crispr