ID: 902594336

View in Genome Browser
Species Human (GRCh38)
Location 1:17498055-17498077
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902594336_902594342 0 Left 902594336 1:17498055-17498077 CCCAGCCTAATGACTACTTTCCC No data
Right 902594342 1:17498078-17498100 TCTGGATAGATACCCAGTAGTGG No data
902594336_902594343 1 Left 902594336 1:17498055-17498077 CCCAGCCTAATGACTACTTTCCC No data
Right 902594343 1:17498079-17498101 CTGGATAGATACCCAGTAGTGGG No data
902594336_902594347 18 Left 902594336 1:17498055-17498077 CCCAGCCTAATGACTACTTTCCC No data
Right 902594347 1:17498096-17498118 AGTGGGATTGCTGGATTGAATGG No data
902594336_902594344 9 Left 902594336 1:17498055-17498077 CCCAGCCTAATGACTACTTTCCC No data
Right 902594344 1:17498087-17498109 ATACCCAGTAGTGGGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902594336 Original CRISPR GGGAAAGTAGTCATTAGGCT GGG (reversed) Intergenic