ID: 902594337

View in Genome Browser
Species Human (GRCh38)
Location 1:17498056-17498078
Sequence AGGGAAAGTAGTCATTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902594337_902594344 8 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594344 1:17498087-17498109 ATACCCAGTAGTGGGATTGCTGG 0: 1417
1: 9343
2: 26302
3: 15708
4: 10794
902594337_902594347 17 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594347 1:17498096-17498118 AGTGGGATTGCTGGATTGAATGG 0: 177
1: 621
2: 3190
3: 6269
4: 14600
902594337_902594342 -1 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594342 1:17498078-17498100 TCTGGATAGATACCCAGTAGTGG 0: 52
1: 914
2: 2055
3: 4806
4: 26838
902594337_902594343 0 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594343 1:17498079-17498101 CTGGATAGATACCCAGTAGTGGG 0: 48
1: 878
2: 1969
3: 4517
4: 26018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902594337 Original CRISPR AGGGAAAGTAGTCATTAGGC TGG (reversed) Intergenic
No off target data available for this crispr