ID: 902594337

View in Genome Browser
Species Human (GRCh38)
Location 1:17498056-17498078
Sequence AGGGAAAGTAGTCATTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902594337_902594344 8 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594344 1:17498087-17498109 ATACCCAGTAGTGGGATTGCTGG No data
902594337_902594347 17 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594347 1:17498096-17498118 AGTGGGATTGCTGGATTGAATGG No data
902594337_902594342 -1 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594342 1:17498078-17498100 TCTGGATAGATACCCAGTAGTGG No data
902594337_902594343 0 Left 902594337 1:17498056-17498078 CCAGCCTAATGACTACTTTCCCT No data
Right 902594343 1:17498079-17498101 CTGGATAGATACCCAGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902594337 Original CRISPR AGGGAAAGTAGTCATTAGGC TGG (reversed) Intergenic